ATF6 gene molecular marker primer related to egg weight trait and its application

Abstract

The present invention relates to an ATF6 gene molecular marker primer related to egg weight trait and its application, belonging to the field of biotechnology. The present invention uses the genomic DNA of the chicken to be tested as a template, adopts specific primers to perform PCR amplification on it, and then performs Sanger sequencing and SNP molecular marker gene typing on the PCR amplification product to achieve the selection of the chicken's first egg weight and 37-week egg weight traits. By eliminating C / T and T / T genotype individuals and retaining C / C genotype individuals, the beneficial effect is that the molecular marker can be used as a genetic marker for chicken breeding, and chickens with larger and more uniform egg weight at the beginning of egg laying and 37 weeks of age are selected; the chicken's first egg weight and 37-week egg weight traits can be efficiently and quickly identified, and the uniformity of the egg weight of the chicken flock can be improved, providing a scientific basis for the early breeding of chickens, which is of great value for chicken breeding. In addition, the detection method disclosed in the present invention is simple and easy to operate, and can be carried out in the laboratory.

Description

Technical Field

[0001] The invention relates to an ATF6 gene molecular marker primer related to egg weight traits and application thereof, belonging to the field of biotechnology. Background Art

[0002] Egg weight is one of the quality evaluation indicators. It is not only an important indicator for egg grading, freshness and egg structure evaluation, but also an important factor in breeding and farming benefits. The feed cost of chickens is directly related to the output and quality of eggs. By breeding chickens with larger egg weights, resource utilization efficiency can be improved and feed waste can be reduced. However, eggs that are too large will result in reduced egg production and reduced eggshell strength, affecting egg quality. Therefore, to improve egg weight and eggshell strength, it is necessary to select the size of eggs. At the beginning of laying, egg weight is greatly affected by factors such as age at laying, body weight, and light, and is positively correlated with age at laying. As the age of the hen increases, egg weight also increases until it slowly flattens in the middle of laying. The initial egg weight has a significant impact on the quality of eggs in the early stage of laying and even the entire laying cycle. 37 weeks of age belongs to the middle of laying, which is the peak period of laying. Therefore, breeding for the initial egg weight and the egg weight at 37 weeks of age can effectively reduce the impact of other factors on egg weight and improve breeding efficiency. Molecular markers are used to accurately identify the genotypes of the egg weight at the start of laying and the egg weight at 37 weeks of age, and applied to breeding selection, thereby achieving more accurate early selection.

[0003] The activating transcription factor 6 (ATF6) encoded by the ATF6 gene is an endoplasmic reticulum-localized protein. In bones and cartilage, ATF6 is involved in the differentiation of osteoblasts. Its overexpression stimulates the increase of osteocalcin transcription. The pathological increase of osteocalcin content is closely related to the occurrence of premature ovarian failure, which may affect the egg-laying cycle. In addition, the ATF6 gene also regulates key steps in the physiological process of follicles, affects the differentiation and apoptosis of granulosa cells, and participates in the growth and maintenance of follicles. The above studies show that there is a close connection between ATF6 and reproductive traits. However, the research on ATF6 and egg weight traits is currently in a blank stage. Summary of the invention

[0004] The purpose of the present invention is to address the defects of the prior art and to propose an ATF6 gene molecular marker primer related to the egg weight trait and its application for rapid detection and screening of egg weight.

[0005] The present invention measured the egg weight of hens, performed SNP genotyping using whole genome resequencing technology, and screened the ATF6 gene molecular markers that were significantly correlated with the egg weight at the start of egg production and the egg weight at 37 weeks of age through whole genome association analysis, providing new gene and molecular marker resources for the breeding of the egg weight at the start of egg production and the egg weight at 37 weeks of age.

[0006] The present invention solves the technical problem through the following technical scheme: firstly, a molecular marker primer of the ATF6 gene related to the egg weight trait is provided, the nucleotide sequence of the molecular marker primer is shown in SEQ ID NO:1 and SEQ ID NO:2, the molecular marker is located at the 3735125th base on chromosome 8 of the chicken reference genome GRCg7b version, and the base is mutated to T or C. The sequence is shown in the 59th base as shown in SEQ ID NO:3 or SEQ ID NO:4.

[0007] The present invention further provides an application of the above molecular marker primers for detecting SNP genotypes related to the egg weight at the beginning of laying and the egg weight at 37 weeks of age in 20 groups including recessive White Rock chickens. The detection method comprises the following steps:

[0008] The first step is to provide a chicken DNA sample to be tested, and perform PCR amplification using a molecular marker primer pair to obtain an amplification product, wherein the chicken DNA sample to be tested contains a SNP molecular marker at base 3735125 of chicken chromosome 8;

[0009] The second step is to perform Sanger sequencing on the PCR product;

[0010] Step 3: Determine the SNP molecular marker genotype at base 3735125 of chicken chromosome 8 based on the sequencing results of step 2.

[0011] Wherein, the deoxyribonucleotide sequence of the molecular marker primer pair described in the first step is:

[0012] Upstream primer: 5'-GTCAAATCAGAGAAGCCAGGGAAG-3' (SEQ ID NO: 1)

[0013] Downstream primer: 5'-GACTTCCTGCACCACTCTCTTATTC-3' (SEQ ID NO: 2)

[0014] The final concentration of the reaction system is 25 μl.

[0015] Chicken DNA to be tested 50 ng,

[0016] 2 x Accurate Taq Master Mix 12.5 μl,

[0017] Upstream primer 1 μl,

[0018] Downstream primer 1 μl,

[0019] Add sterile water to 25 μl.

[0020] The reaction conditions of the PCR amplification are: pre-denaturation at 94°C for 5 minutes; denaturation at 94°C for 30 seconds, annealing at 55°C for 30 seconds, extension at 72°C for 60 seconds, for a total of 30 cycles; extension at 72°C for 2 minutes; storage at 4°C; the nucleotide sequence of the amplified product is shown in SEQ ID NO: 3 or SEQ ID NO: 4, the amplified product is 336 bp in length, and contains the 3735125th base of chicken chromosome 8.

[0021] In the third step, the judgment criterion is that the starting egg weight and egg weight at 37 weeks of the C / C genotype chickens at the SNP site are higher than those of the C / T and T / T genotype individuals, and the starting egg weight and egg weight at 37 weeks of the C / T genotype chickens are higher than those of the T / T genotype individuals.

[0022] The present invention detects the genotype of the egg weight at the beginning of laying and the egg weight at 37 weeks of age of a chicken by using the ATF6 gene molecular marker, and obtains that the egg weight at the beginning of laying and the egg weight at 37 weeks of age of a C / C genotype chicken are higher than those of individuals with C / T and T / T genotypes, and the egg weight at the beginning of laying and the egg weight at 37 weeks of age of a C / T genotype chicken are higher than those of individuals with T / T genotypes. By using the genomic DNA of the chicken to be tested as a template and using specific primers to perform PCR amplification on it, and then performing Sanger sequencing and SNP molecular marker genotyping on the PCR amplification product, the genotype of the SNP molecular marker can be used to select the egg weight at the beginning of laying and the egg weight at 37 weeks of age of the chicken. In breeding, according to the breeding goal, individuals with C / T and T / T genotypes can be eliminated and individuals with C / C genotypes can be retained. The beneficial effect is that the molecular marker can be used as a genetic marker for chicken breeding to select chickens with larger and more uniform egg weights at the beginning of laying and at 37 weeks of age; the egg weights at the beginning of laying and at 37 weeks of age can be identified efficiently and quickly, and the uniformity of the egg weights of the flock can be improved, providing a scientific basis for the early selection of chickens, which is of great value for chicken breeding. In addition, the detection method disclosed in the present invention is simple and easy to operate, and can be carried out in the laboratory. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 This is the Manhattan plot of the genome-wide association analysis between egg weight at start of production and egg weight at 37 weeks of age.

[0024] Figure 2 These are the Sanger sequencing results of the PCR amplification products of the three genotypes. DETAILED DESCRIPTION

[0025] The following embodiments are applicable to chicken breeding, and the breeds of chickens cited are not limited to the following embodiments.

[0026] Example 1

[0027] In this example, the egg weight at the beginning of laying and the egg weight at 37 weeks of recessive White Rock hens were measured, and whole-genome SNP genotyping was performed using second-generation sequencing technology. ATF6 gene molecular markers significantly associated with the egg weight at the beginning of laying and the egg weight at 37 weeks of age were screened through whole-genome association analysis. The results are as follows: Figure 1 shown.

[0028] In this example, the following experiment was conducted to identify and apply the ATF6 gene molecular markers related to the egg weight at the beginning of laying and the egg weight at 37 weeks of age.

[0029] 1. Phenotypic and genotypic testing

[0030] (1) Experimental materials and phenotypic determination of egg weight at the start of egg production and at 37 weeks of age

[0031] A total of 2213 recessive White Rock hens were selected as experimental animals and raised under the same feeding conditions with free access to food and water throughout the whole process. The egg weight data were recorded at the beginning of laying and at 37 weeks of age.

[0032] (2) Extraction of genomic DNA

[0033] Blood was collected from the subwing vein of the individual to be tested, lysed after anticoagulation, digested with proteinase K, extracted with saturated sodium chloride method, dissolved in TE and stored at -20℃.

[0034] (3) PCR amplification

[0035] The fragment containing the 3735125th base of chromosome 8 was amplified using the genomic DNA extracted as above as a template.

[0036] Upstream primer: 5'-GTCAAATCAGAGAAGCCAGGGAAG-3' (SEQ ID NO: 1)

[0037] Downstream primer: 5'-GACTTCCTGCACCACTCTCTTATTC-3' (SEQ ID NO: 2)

[0038] The final concentration of the reaction system is 25 μl.

[0039] DNA to be tested 50 ng,

[0040] 2 x Accurate Taq Master Mix 12.5 μl,

[0041] Upstream primer 1 μl,

[0042] Downstream primer 1 μl,

[0043] Add sterile water to 25 μl.

[0044] The reaction conditions of PCR amplification are: 94℃ pre-denaturation for 5min; 94℃ denaturation for 30sec, 55℃ annealing for 30sec, 72℃ extension for 60sec, 30 cycles in total; 72℃ extension for 2min; 4℃ storage; 10μl was taken for agarose detection, and a single target band with a length of 336 bp was amplified, containing the SNP molecular marker at the 3735125th base site of chicken chromosome 8. The sequence of the amplified product is as follows:

[0045] SEQ ID NO: 3

[0046] GTCAAATCAGAGAAGCCAGGGAAGTGCCCTGGTCAGCCCTGCCGACCATTCTTGGCTCCCAGAGGGCCAACAGAGGAACCCCAGGTAGTCCTTCCTTCCTGCAGGGAGCACGGCCACTTGCTGGCTGTTTGTTAATGGTGAGACGTCTGGGATGCTTCATAGAGGAC TCTGAAGCTGATTATGGGAAGCAGTCCGGGATGTGGCAGCCCTTGGCAAACGAATTTAGCACATAAGGTTACTTTGCTGAAACAGAATGCTGCCTGCTGACATGCGTGTTATGTGTGTAGGTGATCTGTAGCATTGAACTGGTGAATAAGAGAGTGGTGCAGGAAGTC

[0047] SEQ ID NO: 4

[0048] GTCAAATCAGAGAAGCCAGGGAAGTGCCCCTGGTCAGCCCTGCCGACCATTCTTGGCTCCAGAGGGCCAACAGAGGAACCCCAGGTAGTCCTTCCTTCCTGCAGGGAGCACGGCCACTTGCTGGCTGTTTGTTAATGGTGAGACGTCTGGGATGCTTCATAGAGGAC TCTGAAGCTGATTATGGGAAGCAGTCCGGGATGTGGCAGCCCTTGGCAAACGAATTTAGCACATAAGGTTACTTTGCTGAAACAGAATGCTGCCTGCTGACATGCGTGTTATGTGTGTAGGTGATCTGTAGCATTGAACTGGTGAATAAGAGAGTGGTGCAGGAAGTC

[0049] (4) Sanger sequencing and genotyping

[0050] The PCR products of each sample were subjected to Sanger sequencing, and the sequencing peaks of different genotypes were obtained as shown in Figure 2 shown.

[0051] 2. Correlation Analysis

[0052] Recessive White Lock hens with clear records of egg weight phenotype were selected for correlation analysis. The collected egg weight data were statistically tested using the ANOVA test function of the R 4.2 statistical drawing software, and the pairwise mean comparison mode was selected to statistically test the genotypes of the experimental flocks and the egg weight at the beginning of laying and the egg weight at 37 weeks of age. P<0.05 indicated significant differences. The results are shown in Table 1. Among the tested individuals, the egg weight at the beginning of laying and the egg weight at 37 weeks of age of the three genotypes were significantly different (P<0.05). The average value of the egg weight at the beginning of laying of C / C genotype individuals was 48.15g, which was higher than 47.53g of T / T genotype individuals (P<0.05). The average value of the egg weight at the beginning of laying of C / T genotype individuals was 48.09g, which was higher than 47.53g of T / T genotype individuals (P<0.05). The average egg weight of C / C genotype individuals at 37 weeks of age was 58.72g, which was higher than 57.97g of C / T genotype individuals (P<0.05) and 57.37g of T / T genotype individuals (P<0.05). The egg weight of C / T genotype individuals at 37 weeks of age was higher than that of T / T genotype individuals (P<0.05). The results showed that the molecular marker of chicken ATF6 gene was significantly correlated with the phenotype of egg weight at the beginning of laying and egg weight at 37 weeks of age. According to the actual breeding goals, C / C genotype individuals can be selected to breed chickens with larger egg weight at the beginning of laying and egg weight at 37 weeks of age, improve the overall egg weight at the beginning of laying, egg weight at 37 weeks of age and uniformity, and improve breeding efficiency.

[0053] Table 1 Association analysis between ATF6 gene molecular markers and egg weight at first laying and egg weight at 37 weeks of age

[0054]

[0055] Note: Data in the same column with the same letters on their shoulders indicate no significant difference, while data with different letters on their shoulders indicate significant difference (P<0.05).

[0056] Example 2

[0057] Genotype frequencies of different varieties

[0058] 1. Blood Sample Collection

[0059] Blood samples from 19 breeds, including Luodao Red Laying Hens, Bai Leghorn Laying Hens, Kebao Broilers, Camellia Chickens, Fujian Hetian Chickens, Langshan Chickens, Liyang Chickens, Guangxi Ma Chickens, Xinghua Chickens, Guangxi Black-Bone Chickens, Guangxi Three Yellow Chickens, Beijing Oily Chickens, Big Bone Chickens, Daweishan Miniature Chickens, Wenchang Chickens, Wuding Chickens, Piao Chickens, Bearded Chickens and Tibetan Chickens, were collected by subwing vein blood collection and stored at -20℃ for future use.

[0060] 2. Extraction of Genomic DNA

[0061] Take the tissue sample obtained in step 1 and use Omega's tissue genomic DNA extraction kit to extract genomic DNA. The specific method refers to the standard operating procedure provided by Omega.

[0062] 3. Genotype detection

[0063] Using the genomic DNA obtained in step 2 as a template, a primer pair consisting of an F nucleotide sequence (SEQ ID NO: 1) and an R nucleotide sequence (SEQ ID NO: 2) was used for PCR amplification and Sanger sequencing to obtain the C / C genotype, C / T genotype, and T / T genotype of the individual.

[0064] 4. Results Analysis

[0065] Luodao Red Layer and White Leghorn Layer are common commercial laying hen breeds with high egg production rate and moderate and uniform egg weight. Cobb broiler is a common commercial broiler breed with large body and poor egg production performance. Camellia chicken, Fujian Hetian chicken, Langshan chicken, Liyang chicken, Guangxi Ma chicken, Xinghua chicken, Guangxi black-bone chicken, Guangxi Sanhuang chicken, Beijing oil chicken, big bone chicken, Daweishan miniature chicken, Wenchang chicken, Wuding chicken, Diao chicken, Bearded chicken and Tibetan chicken are well-known local chicken breeds in China. Egg weight is positively correlated with body weight. Cobb broiler has a larger body weight and larger egg weight during the laying period, but the egg weight uniformity is uneven, and the C gene frequency is higher than other strains. The above results show that this SNP locus can be used as a molecular marker for egg weight at the beginning of laying and egg weight at 37 weeks of age. See Table 2.

[0066] Table 2 Distribution of allele frequencies of ATF6 gene molecular markers in different varieties

[0067]

[0068] In addition to the above implementations, the present invention may also have other implementations. Any technical solution formed by equivalent replacement or equivalent transformation falls within the protection scope required by the present invention.

Claims

1. An application of a primer for detecting a SNP site of the ATF6 gene related to egg weight, characterized in that: The nucleotide sequences of the detection primers are shown in SEQ ID NO:1 and SEQ ID NO:

2. The SNP site is located at the 3735125th base on chromosome 8 of the chicken reference genome GRCg7b version, and the base mutates to T or C. The detection primers are used to detect the traits of the initial egg weight and the egg weight at 37 weeks of age of chickens. The initial egg weight and the egg weight at 37 weeks of age of chickens with the C / C genotype at the SNP site are higher than those of the C / T and T / T genotype individuals, and the initial egg weight and the egg weight at 37 weeks of age of chickens with the C / T genotype are higher than those of the T / T genotype individuals.

2. The use of the detection primers for the ATF6 gene SNP site associated with the egg weight trait according to claim 1, characterized in that: The detection method comprises the following steps, The first step is to provide a chicken DNA sample to be tested, and perform PCR amplification with the detection primers to obtain an amplified product, wherein the chicken DNA sample to be tested contains the 3735125th base of chromosome 8 of the chicken reference genome GRCg7b version; The second step is to perform Sanger sequencing on the PCR product; The third step is to determine the genotype of the SNP site at base 3735125 of chromosome 8 of the chicken reference genome GRCg7b version based on the sequencing results of the second step.

3. The use of the detection primers for the ATF6 gene SNP site associated with the egg weight trait according to claim 2, characterized in that: The final volume of the reaction system was 25 μl. Chicken DNA to be tested 50 ng 2 x Accurate Taq Master Mix 12.5 μl Upstream primer 1 μl Downstream primer 1 μl Add sterile water to 25 μl. The reaction conditions of the PCR amplification are: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 sec, annealing at 55°C for 30 sec, extension at 72°C for 60 sec, for a total of 30 cycles; extension at 72°C for 2 min; storage at 4°C; the length of the amplified product is 336 bp, and its nucleotide sequence is shown in SEQ ID NO: 3 or SEQ ID NO: 4.

Images