A molecular marker primer for SH3GL3 gene related to egg weight trait and its application

Abstract

The present invention relates to a SH3GL3 gene molecular marker primer related to egg weight trait and its application, belonging to the field of biotechnology. The present invention uses the genomic DNA of the chicken to be tested as a template, adopts specific primers to perform PCR amplification on it, and then performs Sanger sequencing and SNP molecular marker gene typing on the PCR amplification product. The genotype of the SNP molecular marker can be used to select the egg weight trait of the chicken at 52 weeks of age. By eliminating A / G and A / A genotype individuals and retaining G / G genotype individuals, the beneficial effect is that the molecular marker can be used as a genetic marker for chicken breeding, and chickens with smaller and uniform egg weight at 52 weeks of age are selected; the egg weight trait of chickens at 52 weeks of age can be identified efficiently and quickly, and the uniformity of egg weight of chicken flocks can be improved, providing a scientific basis for the early selection of chickens, which is of great value for chicken breeding. In addition, the detection method disclosed in the present invention is simple and easy to operate, and can be carried out in the laboratory.

Description

Technical Field

[0001] The invention relates to a SH3GL3 gene molecular marker primer related to egg weight traits and application thereof, belonging to the field of biotechnology. Background Art

[0002] Egg weight is an important evaluation index of egg quality and plays a key role in egg structure evaluation and egg grading. The size of egg weight not only affects the edible value of eggs, but also affects its breeding value, so egg weight selection is essential. The factors affecting egg weight mainly include body weight and age, among which egg weight is positively correlated with laying age. As the age of the hen increases, egg weight also increases until it slowly flattens in the middle of laying. Egg weight at 52 weeks of age also affects the quality of eggs at 52 weeks of age and even the entire laying cycle. It is particularly important to improve egg-laying traits by controlling egg weight at 52 weeks of age and select excellent chickens. Using molecular markers to accurately identify genes that affect the egg weight trait of chickens at 52 weeks of age, applying them to early breeding selection, and breeding groups with smaller egg weight at 52 weeks of age can optimize the quality of eggs throughout the laying period and improve resource utilization efficiency. The physiological factors that affect the egg weight of chickens at 52 weeks of age mainly include the body weight of the chickens at 52 weeks of age and the egg-laying stage. The egg weight and body weight of the chickens at 52 weeks of age affect the egg quality in the early stage of egg laying and even the entire egg-laying cycle, and the egg weight is positively correlated with the age of the chicken. The SH3GL3 gene helps cell migration and differentiation during embryonic development, which may affect the development of the embryo and cause changes in egg weight. The SH3GL3 gene may also be closely related to an important pathway in the ovary, where it is upregulated and may regulate the ovulation process, providing new insights into the association between the SH3GL3 gene and reproductive traits. There have been no reports on the study of the SH3GL3 gene in chicken reproductive traits. Summary of the invention

[0003] The purpose of the present invention is to address the defects of the prior art and to propose a SH3GL3 gene molecular marker primer related to the egg weight trait and its application to quickly detect and screen the egg weight of chickens.

[0004] The present invention measured the egg weight of hens, performed SNP genotyping using whole genome resequencing technology, and screened the SH3GL3 gene molecular marker significantly correlated with the egg weight trait of chickens at 52 weeks of age through whole genome association analysis, providing new gene and molecular marker resources for the breeding of chickens with the egg weight trait at 52 weeks of age.

[0005] The present invention solves the technical problem through the following technical scheme: firstly, a SH3GL3 gene molecular marker primer related to egg weight trait is provided, the nucleotide sequence of the molecular marker primer is shown in SEQ ID NO:1 and SEQ ID NO:2, the molecular marker is located at the 11501580th base on chromosome 10 of the chicken reference genome GRCg7b version, and the base is mutated to T or C. The sequence is shown in SEQ ID NO:3 or SEQ ID NO:4 at the 216th base.

[0006] The present invention further provides an application of the above molecular marker primers for detecting SNP genotypes related to egg weight traits in chickens at 52 weeks of age. The detection method comprises the following steps:

[0007] The first step is to provide a chicken DNA sample to be tested, and perform PCR amplification using a molecular marker primer pair to obtain an amplification product, wherein the amplification product is 311 bp in length and contains the 11501580th base of chicken chromosome 10;

[0008] The second step is to perform Sanger sequencing on the PCR product;

[0009] The third step is to determine the genotype of the SNP molecular marker at base 11501580 of chicken chromosome 10 based on the sequencing results of the second step.

[0010] Wherein, the deoxyribonucleotide sequence of the molecular marker primer pair described in the first step is:

[0011] Upstream primer: 5'-GTCCCGGAGTTGAAAATTAGCC-3' (SEQ ID NO: 1)

[0012] Downstream primer: 5'-GCCACTTGTTGCTTCCTTTACC-3' (SEQ ID NO: 2)

[0013] The final concentration of the reaction system is 25 μl.

[0014] Chicken DNA to be tested 50 ng,

[0015] 2 x Accurate Taq Master Mix 12.5 μl,

[0016] Upstream primer 1 μl,

[0017] Downstream primer 1 μl,

[0018] Add sterile water to 25 μl.

[0019] The reaction conditions of the PCR amplification are: pre-denaturation at 94°C for 5 minutes; denaturation at 94°C for 30 seconds, annealing at 55°C for 30 seconds, extension at 72°C for 60 seconds, for a total of 30 cycles; extension at 72°C for 2 minutes; storage at 4°C; the nucleotide sequence of the amplified product is shown in SEQ ID NO: 3 or SEQ ID NO: 4, the amplified product is 311 bp in length, and contains the 11501580th base of chicken chromosome 10.

[0020] In the third step, the judgment standard is that the egg weight of chickens with G / G genotype at SNP site at 52 weeks of age is lower than that of A / G and A / A genotype individuals, and the egg weight of chickens with A / G genotype at 52 weeks of age is lower than that of chickens with A / A genotype.

[0021] The present invention detects the genotype of the egg weight trait of chickens at 52 weeks of age by using the SH3GL3 gene molecular marker, and obtains that the egg weight of the G / G genotype chickens at 52 weeks of age is lower than that of the A / G and A / A genotype individuals, and the egg weight of the A / G genotype chickens at 52 weeks of age is lower than that of the A / A genotype individuals. The genomic DNA of the chicken to be tested is used as a template, and PCR amplification is performed on it using specific primers, and then the PCR amplification product is subjected to Sanger sequencing and SNP molecular marker genotyping, and the genotype of the chicken at 52 weeks of age can be selected based on the genotype of the SNP molecular marker. In breeding, according to the breeding goal, the A / G and A / A genotype individuals can be eliminated, and the G / G genotype individuals can be retained. The beneficial effect is that the molecular marker can be used as a genetic marker for chicken breeding, and chickens with smaller and uniform egg weight at 52 weeks of age can be selected; the egg weight trait of the chicken at 52 weeks of age can be identified efficiently and quickly, and the uniformity of the egg weight can be improved, providing a scientific basis for the early selection of chickens, and having important value for chicken breeding. In addition, the detection method disclosed in the present invention is simple and easy to operate and can be carried out in a laboratory. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 Manhattan plot of genome-wide association analysis of egg weight at 52 weeks of age.

[0023] Figure 2 It is the Sanger sequencing result of the PCR amplification product. DETAILED DESCRIPTION

[0024] The following embodiments are applicable to chicken breeding, and the breeds of chickens cited are not limited to the following embodiments.

[0025] Example 1

[0026] In this example, the egg weight of recessive White Rock hens at 52 weeks of age was measured, and whole-genome SNP genotyping was performed using second-generation sequencing technology. The SH3GL3 gene molecular marker significantly associated with egg weight at 52 weeks of age was screened through whole-genome association analysis. The results are as follows: Figure 1 shown.

[0027] In this example, the SH3GL3 gene molecular marker related to egg weight of 52-week-old chickens was identified and applied through the following experiments.

[0028] 1. Phenotypic and genotypic testing

[0029] (1) Experimental materials and egg weight phenotype determination at 52 weeks of age

[0030] 1810 recessive White Rock hens were selected as experimental animals and raised under the same feeding conditions with free access to feed and water throughout the whole process. At 52 weeks of age, the egg weight of each chicken was recorded as the phenotypic data of egg weight at 52 weeks of age.

[0031] (2) Extraction of genomic DNA

[0032] Blood was collected from the subwing vein of the individual to be tested, lysed after anticoagulation, digested with proteinase K, extracted with saturated sodium chloride method, dissolved in TE and stored at -20℃.

[0033] (3) PCR amplification

[0034] The fragment containing the 11501580th base of chromosome 10 was amplified using the genomic DNA extracted as above as a template.

[0035] Upstream primer: 5'-GTCCCGGAGTTGAAAATTAGCC-3' (SEQ ID NO: 1)

[0036] Downstream primer: 5'- GCCACTTGTTGCTTCCTTTACC-3' (SEQ ID NO: 2) Final concentration of the reaction system (25 μl),

[0037] DNA to be tested 50 ng,

[0038] 2 x Accurate Taq Master Mix 12.5 μl,

[0039] Upstream primer 1 μl,

[0040] Downstream primer 1 μl,

[0041] Add sterile water to 25 μl.

[0042] The reaction conditions of PCR amplification are: 94℃ pre-denaturation for 5min; 94℃ denaturation for 30sec, 55℃ annealing for 30sec, 72℃ extension for 60sec, 30 cycles in total; 72℃ extension for 2min; 4℃ storage; 10μl was taken for agarose detection, and a single target band with a length of 311bp was amplified, containing the SNP molecular marker at the base site 11501580 of chicken chromosome 10. The sequence of the amplified product is as follows:

[0043] SEQ ID NO:3

[0044] GTCCCGGAGTTGAAAATTAGCCGTCTGGAACATGTAAGTCTGTGGCCTTTAACTTTGGAACATGTATTGAAGGAGTCTGCCATGGGTGCTCAGAATTCTGAAGTGGTTTTGTCTGACAGATCTTGTCTGGACCCCCGAGCTTCATTCAGCTTTTG CCTGGCTCGGCAGAAGGGCAAATGGAGATCTCCAGCAGGAGTTAAATTCCCAAAGCTTTCGTGTTCCCTGAAATCTAGAGATGGCAGTGCAGGGGGTGGGGGATGAGGCTGAGGTGAAGAAACTAAAGAAAGAGGGTAAAGGAAGCAACAAGTGGC

[0045] SEQ ID NO:4

[0046] GTCCCGGAGTTGAAAATTAGCCGTCTGGAACATGTAAGTCTGTGGCCTTTAACTTTGGAACATGTATTGAAGGAGTCTGCCATGGGTGCTCAGAATTCTGAAGTGGTTTTGTCTGACAGATCTTGTCTGGACCCCCGAGCTTCATTCAGCTTTTG CCTGGCTCGGCAGAAGGGCAAATGGAGATCTCCAGCAGGAGTTAAATTCCCAAAGCTTTCATGTTCCCTGAAATCTAGAGATGGCAGTGCAGGGGGTGGGGGATGAGGCTGAGGTGAAGAAACTAAAGAAAGAGGGTAAAGGAAGCAACAAGTGGC

[0047] (4) Sanger sequencing and genotyping

[0048] The PCR products of each sample were subjected to Sanger sequencing, and the sequencing peaks of different genotypes were obtained as shown in Figure 2 shown.

[0049] 2. Correlation Analysis

[0050] 1810 recessive White Lock hens with clear records of egg weight phenotype at 52 weeks of age were selected for correlation analysis. The ANOVA test function of R 4.2 statistical drawing software was used for statistical test, and the pairwise mean comparison mode was selected to perform statistical test on the genotype and egg weight traits at 52 weeks of age of the test flocks. P<0.05 indicated significant differences. The results are shown in Table 1. Among the tested individuals, the egg weights of the three genotypes at 52 weeks of age were significantly different (P<0.05). The average egg weight of G / G genotype individuals at 52 weeks of age was 57.58g, which was lower than 58.54g of A / G genotype individuals (P<0.05) and lower than 61.07g of A / A genotype individuals (P<0.05). The egg weight of A / G genotype individuals at 52 weeks of age was lower than that of A / A genotype individuals (P<0.05). The results showed that the site at base 11501580 of chromosome 10 was significantly associated with the egg weight phenotype of chickens at 52 weeks of age. According to the actual breeding goals, G / G genotype individuals can be selected to breed hens with smaller and more uniform egg weight at 52 weeks of age, thereby improving the overall egg weight and uniformity and improving the breeding efficiency.

[0051] Table 1 Association analysis between SH3GL3 gene marker genotype and egg weight at 52 weeks of age

[0052]

[0053] Note: Data in the same column with the same letters on their shoulders indicate no significant difference, while data with different letters on their shoulders indicate significant difference (P<0.05).

[0054] Example 2

[0055] Gene frequencies in different breeds.

[0056] 1. Blood Sample Collection

[0057] Blood samples from 18 breeds, including Luodao Red Laying Hens, White Leghorn Laying Hens, Cobb Broilers, Camellia Chickens, Fujian Hetian Chickens, Langshan Chickens, Liyang Chickens, Guangxi Ma Chickens, Xinghua Chickens, Guangxi Black-Bone Chickens, Guangxi Three Yellow Chickens, Beijing Oily Chickens, Big Bone Chickens, Daweishan Miniature Chickens, Wenchang Chickens, Wuding Chickens, Piao Chickens and Bearded Chickens, were collected by subwing vein blood collection and stored at -20℃ for future use.

[0058] 2. Extraction of Genomic DNA

[0059] The blood sample obtained in the first step was taken and genomic DNA was extracted using an Omega genomic DNA extraction kit. The specific method was based on the standard operating procedure provided by Omega.

[0060] 3. Genotype detection

[0061] Using the genomic DNA obtained in the second step as a template, a primer pair consisting of an F nucleotide sequence (SEQ ID NO: 1) and an R nucleotide sequence (SEQ ID NO: 2) was used for PCR amplification and Sanger sequencing to obtain the individual's G / G genotype, A / G genotype, and A / A genotype.

[0062] 4. Results Analysis

[0063] Luodao Red and White Leghorn are common commercial egg-laying chicken breeds with high egg production rates and moderate and uniform egg weights. Cobb broilers are common commercial broiler breeds with large body size, poor egg-laying performance, and large egg weights in the late egg-laying period. Camellia chicken, Fujian Hetian chicken, Langshan chicken, Liyang chicken, Guangxi Ma chicken, Xinghua chicken, Guangxi black-bone chicken, Guangxi Sanhuang chicken, Beijing You chicken, Dagu chicken, Daweishan miniature chicken, Wenchang chicken, Wuding chicken, Diao chicken, and Huxu chicken are well-known local chicken breeds in China. Egg weight is positively correlated with body weight. Cobb broilers are heavier and have larger egg weights in the late egg-laying period. The frequency of gene A is higher than that of other strains. This result also shows that the SH3GL3 gene molecular marker can be used as a potential molecular marker for the egg weight trait at 52 weeks of age, as shown in Table 2.

[0064] Table 2 Distribution of allele frequencies of SH3GL3 gene molecular markers in different varieties

[0065]

[0066] In addition to the above implementations, the present invention may also have other implementations. Any technical solution formed by equivalent replacement or equivalent transformation falls within the protection scope required by the present invention.

Claims

1. An application of a primer for detecting a SNP site of the SH3GL3 gene related to egg weight, characterized in that: The nucleotide sequences of the detection primers are shown in SEQ ID NO:1 and SEQ ID NO:

2. The SNP site is located at base 11501580 on chromosome 10 of the chicken reference genome GRCg7b version, and the base mutates to A or G. The detection primers are used to detect the egg weight trait of chickens at 52 weeks of age. The egg weight of chickens with G / G genotype at the SNP site at 52 weeks of age is lower than that of individuals with A / G and A / A genotypes, and the egg weight of chickens with A / G genotype at 52 weeks of age is lower than that of individuals with A / A genotypes.

2. The use of the detection primers for the SH3GL3 gene SNP site associated with the egg weight trait according to claim 1, characterized in that: The detection method comprises the following steps, The first step is to provide a chicken DNA sample to be tested, and perform PCR amplification with the detection primers to obtain an amplified product, wherein the amplified product is 311 bp in length and contains the 11501580th base of chromosome 10 of the chicken reference genome GRCg7b version; The second step is to perform Sanger sequencing on the PCR product; The third step is to determine the genotype of the SNP site at base 11501580 on chromosome 10 of the chicken reference genome GRCg7b version based on the sequencing results of the second step.

3. The use of the detection primers for the SH3GL3 gene SNP site associated with the egg weight trait according to claim 2, characterized in that: The final volume of the reaction system was 25 μl. Chicken DNA to be tested 50 ng 2 x Accurate Taq Master Mix 12.5 μl Upstream primer 1 μl Downstream primer 1 μl Add sterile water to 25 μl; The reaction conditions of the PCR amplification are: 94°C pre-denaturation for 5 min; 94°C denaturation for 30 sec, 55°C annealing for 30 sec, 72°C extension for 60 sec, a total of 30 cycles; 72°C extension for 2 min; 4°C storage; the nucleotide sequence of the amplified product is shown in SEQ ID NO: 3 or SEQ ID NO: 4.

Images