KASP molecular marker primer combination related to chilling requirement of peach and application thereof

Abstract

This invention discloses a KASP molecular marker primer combination related to chilling requirement in peaches and its application. By utilizing the single-base difference between bases at positions 26,042,043 on chromosome 6 and positions 46,470,090 on chromosome 1, two primer combinations were designed: KASP molecular marker Chr06:26042043 and KASP molecular marker Chr01:46470090. These two molecular marker primer combinations can be used to rapidly and accurately identify the genotype of peaches, thus allowing for preliminary differentiation of chilling requirement at the seedling stage. These two markers exhibit high specificity and predictive ability in detecting chilling requirement attributes in peaches. By reducing time and labor costs and simultaneously achieving high-throughput testing of multiple samples, this invention significantly improves detection efficiency and is of great significance for breeding peaches with target chilling requirements.

Description

Technical Field

[0001] This invention relates to a set of KASP molecular marker primer combinations related to chilling requirements of peaches, and provides them for assisting in the screening of peaches with different high and low chilling requirements (target chilling requirement peaches) that meet breeding needs, belonging to the field of molecular biology. Background Technology

[0002] The peach (Prunus persica (L.) Batsch) is the world's third largest deciduous economic fruit tree, mainly distributed in temperate regions between 30° and 45° north and south latitude. During its winter dormancy, the peach requires a certain amount of chilling exposure (i.e., chilling requirement) to promote bud break from dormancy and facilitate flowering and leaf development. In recent years, the trend of global warming has become evident, with frequent occurrences of abnormal weather phenomena such as warm winters, late spring frosts, and late frosts, posing new challenges to temperature-sensitive peach trees. High-chilling-requirement peaches cannot flower and grow normally due to insufficient chilling, resulting in a shrinking planting area and limiting the southward expansion of the peach industry. Meanwhile, while low-chilling-requirement peaches adapt to climate warming and can be planted in the south, their early flowering and leafing characteristics make them more susceptible to frost threats. In contrast, high-chilling-requirement peach trees have late flowering and late leafing characteristics, avoiding the damage of late spring frosts, but their high chilling requirement makes them less adaptable to climate warming. Furthermore, protected cultivation can bring good economic benefits, especially as its area gradually expands in the north. Therefore, there is an urgent need to accurately control chilling requirements in order to improve early-maturing regulation techniques. Thus, climate change (including insufficient and / or abnormal temperatures) and industry adjustments (precise zoning cultivation, southward expansion, and protected cultivation, etc.) have placed new demands on ensuring the sustainability of the peach industry. In order to ensure that peaches adapt to specific growth conditions and avoid flowering and leafing under suboptimal conditions, it is urgent to focus on breeding varieties with target chilling requirements and to comprehensively and quickly understand the high and low chilling requirements.

[0003] However, currently, chilling requirements can only be identified after peach trees have entered normal production and through years of observation, resulting in low breeding efficiency. Therefore, it is necessary to combine modern molecular marker-assisted selection technology to achieve early prediction of chilling requirements.

[0004] Marker-assisted breeding in fruit tree breeding relies on identifying DNA patterns associated with traits. The application of the peach reference genome, SNP arrays, and GBS has opened up possibilities for developing cost-effective and user-friendly marker-assisted selection molecular tools. Competitive allele-specific PCR (KASP) detection has become the preferred method for developing SNP-specific DNA detection, enabling rapid, economical, and reliable determination of SNP genotypes. However, to date, DNA detection in peaches remains very limited, with most related to fruit quality or disease resistance. Based on reported chilling requirement-related QTLs, researchers have developed genotyping toolkits based on high-resolution melting analysis to predict chilling requirements. Recently, US researchers developed a KASP DNA detection using four chilling requirement-related SNP markers identified in previous studies on chromosome 1 of the peach genome. These molecular markers can distinguish between low, medium, and high chilling requirement alleles in Clemson University peach breeding materials. In addition, Chinese scholars have established a PCR marker by using a 30bp deletion in the promoter of the key chilling requirement gene PpDAM6. This marker has been verified by local natural populations and can be used to distinguish peaches with a chilling requirement of more than 500h and those with a chilling requirement of less than 500h.

[0005] These studies provide an important theoretical and methodological foundation for developing efficient chilling requirement molecular tools and marker-assisted breeding strategies for peaches. However, chilling requirement is a quantitative trait, and its variation can be explained by multiple loci and is affected by environmental and population changes. Existing markers have shown good stability and effectiveness in larger populations, populations with more complex genetic backgrounds, or populations under different environments, but stable and effective molecular markers for peach chilling requirement are still lacking. Therefore, it is necessary to use genome prediction to associate more trait-related variations to ensure that DNA testing can accurately predict actual phenotypes and is applicable to various genetic and environmental backgrounds, thereby providing strong technical support for breeding peaches with target chilling requirements that meet various environmental and production requirements. Summary of the Invention

[0006] The purpose of this invention is to provide a set of KASP molecular marker primer combinations related to the chilling requirement of peaches and their applications.

[0007] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0008] A primer set for the KASP molecular marker Chr06:26042043 related to the chilling requirement of peaches is provided. The primer set includes forward primer 1, forward primer 2 and a shared reverse primer. The nucleotide sequence of forward primer 1 is shown in SEQ ID No. 1, the nucleotide sequence of forward primer 2 is shown in SEQ ID No. 2, and the nucleotide sequence of the shared reverse primer is shown in SEQ ID No. 3.

[0009] Another set of primers for the KASP molecular marker Chr01:46470090 related to the chilling requirement of peaches includes forward primer 1, forward primer 2, and a shared reverse primer. The nucleotide sequence of forward primer 1 is shown in SEQ ID No. 4, the nucleotide sequence of forward primer 2 is shown in SEQ ID No. 5, and the nucleotide sequence of the shared reverse primer is shown in SEQ ID No. 6.

[0010] To distinguish between different genotypes, different fluorescent signal tags were added to the 5' ends of the forward primers 1 and 2 of the Chr06:26042043 and Chr01:46470090 primer combinations, respectively. Preferably, a FAM fluorescent signal tag (GAAGGTGACCAAGTTCATGCT) was added to the 5' end of the forward primer 1, and a VIC fluorescent signal tag (GAAGGTCGGAGTCAACGGATT) was added to the 5' end of the forward primer 2.

[0011] This invention also discloses the application of the above-mentioned primer combination of KASP molecular marker Chr06:26042043 or KASP molecular marker Chr01:46470090 in identifying the high and low chilling requirements of peaches.

[0012] The chilling requirement of peaches is classified into low, medium, high, and very high chilling requirement peaches, which are respectively classified as low chilling requirement <400h, 400h≤chilling requirement <600h, 600h≤chilling requirement <900h, and chilling requirement ≥900h.

[0013] Preferably, the steps include:

[0014] (1) Primer synthesis: synthesize the above-mentioned primer combination of KASP molecular marker Chr06:26042043 or the above-mentioned primer combination of KASP molecular marker Chr01:46470090.

[0015] (2) DNA extraction: Extract genomic DNA from the peaches to be identified;

[0016] (3) KASP reaction: Using the genomic DNA extracted in step (2) as a template, the KASP reaction was carried out using the primer combination of KASP molecular marker Chr06:26042043 synthesized in step (1) or the primer combination of KASP molecular marker Chr01:46470090.

[0017] (4) KASP product detection and analysis: Detect the genotype of the amplified product and preliminarily determine the chilling requirement of peaches based on the genotype.

[0018] The order of steps (1) and (2) is not required.

[0019] Preferably, the KASP reaction system is a 5 μl PCR reaction system, containing 2.5 μl 2*KASP master mix, 1.25 μl primer combination and 1.25 μl genomic DNA; the reaction program of step (3) is as follows: 95℃ pre-denaturation, 10 min, 1 cycle; 95℃ denaturation for 20 s; 61-55℃ annealing extension for 60 s, 10 cycles in total; 95℃ denaturation for 20 s, 55℃ annealing extension for 60 s, 27 cycles in total; 25℃ reading for 30 s, 1 cycle.

[0020] This invention also discloses the application of molecular marker primer combinations in identifying the chilling requirement of peaches. The molecular marker primer combinations are two sets of KASP molecular marker primer combinations used together: the KASP molecular marker Chr06:26042043 primer combination and the KASP molecular marker Chr01:46470090 primer combination. This combination can more accurately identify the chilling requirement of peaches.

[0021] The present invention also discloses a kit containing the primer combination described above.

[0022] This invention utilizes the single-base difference between bases at positions 26,042,043 on chromosome 6 and bases at positions 46,470,090 on chromosome 1 to design primer combinations for the KASP molecular markers Chr06:26042043 and Chr01:46470090. A FAM fluorescent tag is added to the 5' end of the forward primer 1 for both Chr06:26042043 and Chr01:46470090, and a VIC fluorescent tag is added to the 5' end of the forward primer 2. Genotype is determined based on the proportion of fluorescent signals.

[0023] The peach genotypes identified by the Chr06:26042043 marker include C:C, C:T, and T:T. Specifically, if the base C is detected at the site, it is an allele linked to the FAM fluorescent tag sequence, and the proportion of FAM fluorescent signal is high, indicating that the peach configuration to be tested is homozygous genotype C:C. If the base T is detected, it is an allele linked to the VIC fluorescent tag sequence, and the proportion of VIC fluorescent signal is high, indicating that the peach configuration to be tested is homozygous genotype T:T. If both bases T and C are detected, it is an intermediate type linked to both the FAM and VIC fluorescent tag sequences, indicating that the peach configuration to be tested is heterozygous genotype C:T.

[0024] The peach genotypes identified by the Chr01:46470090 marker include T:T, T:C, and C:C. Specifically, if the base T is detected at the SNP site, it indicates an allele linked to the FAM fluorescent tag sequence, and the proportion of FAM fluorescent signal is high, then the peach configuration to be tested is determined to be homozygous genotype T:T; if the base C is detected, it indicates an allele linked to the VIC fluorescent tag sequence, and the proportion of VIC fluorescent signal is high, then the peach configuration to be tested is determined to be homozygous genotype C:C; if both bases T and C are detected, it indicates an intermediate type linked to both the FAM and VIC fluorescent tag sequences, then the peach configuration to be tested is determined to be heterozygous genotype T:C.

[0025] This invention utilizes molecular markers to rapidly and accurately identify the genotype of peaches at a specific locus, thereby preliminarily determining the chilling requirement of peaches. This invention, through genotyping, can quickly and initially distinguish the chilling requirement of peaches during the seedling stage, reducing time and labor costs while enabling high-throughput testing of multiple samples, significantly improving testing efficiency and playing a crucial role in breeding peaches with target chilling requirements. Attached Figure Description

[0026] Figure 1 The sequences and ideas used to design primers.

[0027] Figure 2 This is a schematic diagram of the typing results of the KASP molecular marker Chr06:26042043 in Example 2.

[0028] Figure 3 This shows the distribution of cooling requirements for different genotypes in Example 2.

[0029] Figure 4 This is a schematic diagram of the typing results of the KASP molecular marker Chr01:46470090 in Example 3.

[0030] Figure 5 This shows the distribution of cooling requirements for different genotypes in Example 3.

[0031] Figure 6 SNP genotyping of two positive controls for KASP molecular markers using first-generation sequencing (Sanger sequencing). Detailed Implementation

[0032] The specific embodiments of the present invention will be further described below with reference to the accompanying drawings, but the description of the embodiments does not limit the scope of protection of the present invention in any way.

[0033] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used herein in the description of this invention is for the purpose of describing particular embodiments only and is not intended to limit the invention.

[0034] Unless otherwise specified, all substances or instruments used in the following examples can be obtained from conventional commercial sources.

[0035] Example 1: Design of primer combinations for KASP detection of molecular markers

[0036] The upstream and downstream sequences of the SNPs at positions 26, 042, 043 on chromosome 6 and positions 46, 470, 090 on chromosome 1 were identified: >Chr06_26042043:26041893-26042193bp and >Chr01_46470090:46469940-46470240bp. KASP primers Chr06:26042043 and Chr01:46470090 were designed using Primer Premier 5.0 software to detect peach genotypes with different chilling requirements. KASP primers Chr06:26042043 and Chr01:46470090 were designed in the forward direction from 5' to 3'. The design concept is as follows: Figure 1 As shown in Table 1, the designed primer sequences are presented. Figure 1 In the diagram, the blue background indicates the Chr06_26042043-forward primer (SEQ ID No. 1 and SEQ ID No. 2), the yellow background indicates the Chr06_26042043-shared reverse primer (SEQ ID No. 3); the purple background indicates the Chr01:46470090-forward primer (SEQ ID No. 4 and SEQ ID No. 5), and the brown background indicates the Chr01:46470090-shared reverse primer (SEQ ID No. 6).

[0037] To differentiate between different genotypes, a FAM fluorescent tag (GAAGGTGACCAAGTTCATGCT) was added to the 5' end of forward primer 1 of Chr06:26042043 and forward primer 1 of Chr01:46470090, respectively; and a VIC fluorescent tag (GAAGGTCGGAGTCAACGGATT) was added to the 5' end of forward primer 2 of Chr06:26042043 and forward primer 2 of Chr01:46470090, respectively. This primer combination sequence can specifically bind to the corresponding upstream and downstream sequences of this SNP site.

[0038] The KASP primer Chr06:26042043 primer combination and the KASP primer Chr01:46470090 primer combination were obtained by diluting their respective forward primers 1, 2 and the common reverse primer to 10 μM with TE (pH 8.0), and then mixing them in a ratio of forward primer 1: forward primer 2: common reverse primer = 1:1:3.

[0039] Table 1. Sequences of KASP primers Chr06:26042043 and Chr01:46470090

[0040] Chr06:26042043-Forward Primer 1 CAGTGGTATGGCTGGGAACAAGAC(SEQ ID No.1) Chr06:26042043-Forward Primer 2 CAGTGGTATGGCTGGGAACAAGAT(SEQ ID No.2) Chr06:26042043-Shared reverse primer AAGTTCGATGCTCTCTCCTTAGAC(SEQ ID No.3) Chr01:46470090-Forward Primer 1 AAAATAAATCGTATCGCCGGGCAGT(SEQ ID No.4) Chr01:46470090-Forward Primer 2 AAAATAAATCGTATCGCCGGGCAGC(SEQ ID No.5) Chr01:46470090-Shared reverse primer AAAACACAGAGTATAGCCGGTTGG(SEQ ID No.6)

[0041] Example 2: Application of the KASP molecular marker Chr06:26042043

[0042] Twenty-seven genetically diverse peach accessions (including cultivated varieties, local varieties, and wild resources from China, the United States, Thailand, and other countries, belonging to germplasm types such as common peach, Gansu peach, wild peach, and Xinjiang peach) were used as experimental materials to determine their chilling requirements (Table 2). Among them, 39 peaches had low chilling requirements, 62 had medium chilling requirements, 164 had high chilling requirements, and 22 had very high chilling requirements. DNA was extracted from the 287 peach accessions using the CTAB method, and all DNA samples were diluted proportionally to concentrations ranging from 1 to 9 ng / μL.

[0043] Peach genotyping was performed using the KASP primers Chr06:26042043 provided in Example 2. The reaction system is as follows:

[0044] A 5 μl PCR reaction system was used, containing 2.5 μl 2*KASP master mix, 1.25 μl primer set, and 1.25 μl diluted sample DNA (Note: 1.25 μl TE buffer was used instead of sample DNA in the negative control; the positive control was selected from peach materials genotyped using first-generation sequencing (Sanger sequencing) (included in these 287 peaches, including the C:C genotype peach 'Yuxia Pantao' and the T:T genotype peach 'Yejihong' (see SNP genotyping diagram)). Figure 6 PCR analysis was performed according to the CFX Connect™ Real-Time System (Bio-Rad, USA) instrument user manual. The PCR reaction program was as follows: 95℃ pre-denaturation for 10 min, 1 cycle; 95℃ denaturation for 20 s; 61-55℃ annealing and extension for 60 s, 10 cycles; 95℃ denaturation for 20 s, 55℃ annealing and extension for 60 s, 27 cycles; 25℃ reading for 30 s, 1 cycle.

[0045] Three genotypes were detected using KASP primer Chr06:26042043: CC, CT, and TT. The relevant genotyping results are shown below. Figure 2-3 And Table 2. From Figure 2 It can be seen that the genotype was determined by detecting the fluorescence intensity of two KASP products. Each dot in the figure represents a sample of material to be tested. For ease of observation, the genotypes represented by the dots in the figure are labeled. Red dots represent homozygous genotype C:C, blue dots represent homozygous genotype T:T, green dots represent heterozygous genotype C:T, and black square dots represent negative controls. Among the 287 samples, there were 149 strains with the C:C genotype, 96 strains with the T:T genotype, and 42 strains with the C:T genotype.

[0046] Table 2. Chill requirements of the tested peaches and genotypes detected by KASP molecular marker Chr06:26042043.

[0047]

[0048]

[0049]

[0050] Depend on Figure 3 As shown in Table 2, the average chilling requirement for peaches with genotype C:C was 569 h; for peaches with genotype C:T it was 711 h; and for peaches with genotype TT it was 719 h. According to the independent samples t-test, there was no significant difference in chilling requirement between peaches with genotypes C:T and T:T, but both were significantly higher than those with genotype C:C (p < 0.01), indicating statistical significance. A total of 149 peach samples with genotype C:C were included, comprising 34 with low chilling requirement, 43 with medium chilling requirement, 72 with high chilling requirement, and 0 with very high chilling requirement. A total of 139 peach samples with genotypes C:T and T:T were included, comprising 5 with low chilling requirement, 19 with medium chilling requirement, 93 with high chilling requirement, and 22 with very high chilling requirement.

[0051] Example 3: Application of the KASP molecular marker Chr01:46470090

[0052] Twenty-seven genetically rich peach accessions (including cultivated varieties, local varieties, and wild resources from China, the United States, Thailand, and other countries, belonging to germplasm types such as common peach, Gansu peach, mountain peach, and Xinjiang peach) were used as test materials. Chilling requirements were determined (Table 3). Among them, 39 peaches had low chilling requirements, 62 had medium chilling requirements, 164 had high chilling requirements, and 22 had very high chilling requirements. DNA was extracted from the 287 peach accessions using the CTAB method, and all DNA samples were diluted proportionally to concentrations between 1-9 ng / μL. Genotyping of peaches was performed using the KASP primer Chr01:46470090 provided in Example 1. The reaction system is as follows:

[0053] A 5 μl PCR reaction system was used, containing 2.5 μl 2*KASP master mix, 1.25 μl primer set, and 1.25 μl diluted sample DNA (Note: 1.25 μl TE buffer was used instead of sample DNA in the negative control; the positive control was selected from peach materials genotyped using first-generation sequencing (reverse sequencing) (included in these 287 peaches, including the C:C genotype peach 'Flordaglo' and the T:T genotype peach 'Feicheng Baili'; see SNP genotyping diagram). Figure 6 PCR analysis was performed according to the CFX Connect™ Real-Time System (Bio-Rad, USA) instrument instruction manual. The PCR reaction program was as follows: 95℃ pre-denaturation for 10 min, 1 cycle; 95℃ denaturation for 20 s; 61-55℃ annealing and extension for 60 s, 10 cycles; 95℃ denaturation for 20 s, 55℃ annealing and extension for 60 s, 27 cycles; 25℃ reading for 30 s, 1 cycle.

[0054] KASP primer Chr01:46470090 detected three genotypes: T:T, T:C, and C:C. (See results below.) Figure 4-5 And Table 3. From Figure 4 As can be seen, the genotype was determined by detecting the fluorescence intensity of two KASP products. Each dot in the figure represents one sample of material to be tested. For ease of observation, the genotypes represented by the dots in the figure are labeled. Red dots represent homozygous genotype T:T, blue dots represent homozygous genotype C:C, green dots represent heterozygous genotype T:C, and black square dots represent negative controls. There are 259 samples with the T:T genotype, 13 samples with the C:C genotype, and 15 samples with the T:C genotype.

[0055] Table 3. Chill requirements of the tested peaches and genotypes detected by the KASP molecular marker Chr01:46470090.

[0056]

[0057]

[0058]

[0059]

[0060] Depend on Figure 5 As shown in Table 3, the average chilling requirement for peaches with genotype C:C was 367 h; for peaches with genotype T:C it was 314 h; and for peaches with genotype T:T it was 673 h. According to the independent samples t-test, there was no significant difference in chilling requirement between peaches with genotypes C:C and T:C, but both were significantly lower than those with genotype T:T (p < 0.01), which was statistically significant. A total of 28 peach samples with genotypes C:C and T:C were included, comprising 21 low chilling requirement peaches, 6 medium chilling requirement peaches, 1 high chilling requirement peach, and 0 extremely high chilling requirement peaches. A total of 259 peach samples with genotype T:T were included, comprising 18 low chilling requirement peaches, 56 medium chilling requirement peaches, 163 high chilling requirement peaches, and 22 extremely high chilling requirement peaches.

[0061] Table 4: The genotyping effect of two molecular markers on peach chilling requirement

[0062]

[0063] Note: Percentage refers to the proportion of a certain level of chilling requirement peaches identified by a certain marker and genotype in the total number of peaches identified by that marker and genotype, which is equal to (number of chilling requirement peaches identified by a certain marker and genotype at a certain level / total number of peaches identified by that marker and genotype) * 100%; Identification success rate refers to the probability of successfully identifying a certain level of chilling requirement peaches by a certain marker and genotype, which is equal to (number of chilling requirement peaches identified by a certain marker and genotype at a certain level / actual total number of peaches at that level) * 100%.

[0064] Based on the data analysis and organization in Table 4, the identification effects of different genotypes of the two KASP molecular markers (Chr06:26042043 and Chr01:46470090) on peach trees with different chilling requirements are clearly summarized.

[0065] In the C:C genotype samples marked with Chr06:26042043, 22.8% of the peaches had low chilling requirements, with an identification success rate of 87.2% for this chilling requirement attribute. Therefore, this genotype is very suitable for breeding low-chilling-requirement peach trees. 28.9% of the peaches had medium chilling requirements, with an identification success rate of 69.4%, indicating that this genotype also has good identification ability for medium-chilling-requirement peaches. 48.3% of the peaches had high chilling requirements, with the identification success rate decreasing to 43.9%, indicating relatively low identification ability for high-chilling-requirement peaches. 0% of the peaches had extremely high chilling requirements, and this genotype could not identify extremely high-chilling-requirement peach trees. Therefore, the identification effect of the C:C genotype is mainly concentrated on low- and medium-chilling-requirement peach trees, and the identification ability gradually weakens with increasing chilling requirements, especially failing to identify extremely high-chilling-requirement peach trees.

[0066] In the C:T and T:T genotype samples marked with Chr06:26042043, low-chillation-requirement peaches accounted for only 3.6%, with a low identification success rate of only 12.8%, indicating that this genotype does not have a good identification ability for low-chillation-requirement peach trees. Medium-chillation-requirement peaches accounted for 13.7%, with an identification success rate of 30.6%, showing limited effectiveness in identifying medium-chillation-requirement peach trees. High-chillation-requirement peaches accounted for 66.9%, with an identification success rate of 56.1%, indicating that this genotype has a good identification effect on peaches with high chillation requirements. For peach trees with extremely high chillation requirements, although they accounted for only 15.8%, the identification success rate reached 100%, indicating that the C:T and T:T genotypes are very suitable for identifying extremely high-chillation-requirement peach trees. Therefore, the C:T and T:T genotypes are mainly used for identifying high-chillation-requirement and extremely high-chillation-requirement peach trees, especially showing outstanding performance in identifying extremely high-chillation-requirement peach trees.

[0067] Among the C:C and T:C genotype samples marked with Chr01:46470090, low-chillation-requirement peaches accounted for as high as 75%, with an identification success rate of 53.8%, indicating that this genotype is suitable for screening low-chillation-requirement peach trees. Medium-chillation-requirement samples accounted for 21.4%, but the identification success rate was only 9.7%, showing weak identification effectiveness for medium-chillation-requirement peach trees. High-chillation-requirement and extremely high-chillation-requirement samples had very low proportions and identification success rates, failing to effectively identify these high- or extremely high-chillation-requirement peach trees. Therefore, the C:C and T:C genotypes are suitable for screening low-chillation-requirement (chillation requirement <400h) peach trees, but have poor identification ability for medium, high, and extremely high-chillation-requirement (chillation requirement ≥400h) peach trees.

[0068] In the T:T genotype samples marked Chr01:46470090, low-chillation-requirement peaches accounted for 7%, with an identification success rate of 46.2%, which, although low, still demonstrates a certain level of identification capability. Medium-chillation-requirement samples accounted for 21.6%, with a high identification success rate of 90.3%, indicating that the T:T genotype is very suitable for identifying peach trees with medium chillation requirements. High-chillation-requirement samples accounted for 62.9%, with an identification success rate of 99.4%, demonstrating the high accuracy of this genotype in identifying high-chillation-requirement peach trees. Although only 8.5% of the samples had a chilling requirement CR ≥ 900h, their identification success rate reached 100%, indicating that the T:T genotype has extremely high identification efficiency for peach trees with very high chilling requirements. Therefore, the T:T genotype is suitable for screening peach trees with medium, high, and very high chilling requirements (chilling requirement ≥ 400h), especially exhibiting very high identification capability in the high and very high chilling requirement ranges.

[0069] In summary, the C:C genotype of Chr06:26042043 and the C:C and T:C genotypes of Chr01:46470090 can be used to identify peach trees with low chilling requirements. For peach trees with medium, high, and very high chilling requirements, the C:T and T:T genotypes of Chr06:26042043 and the T:T genotype of Chr01:46470090 provide highly accurate identification capabilities. These two KASP molecular markers can be directly applied to molecular breeding programs to accelerate the breeding process by screening peach breeding materials and new varieties with different chilling requirements (CR).

[0070] In breeding, two markers can be used in combination to improve the success rate of identifying target chilling-required peaches and to accurately differentiate them for cultivation. For example, when cultivating low chilling-required peaches, the KASP molecular markers Chr06:26042043 and Chr01:46470090 can be used together. First, the C:C genotype of the KASP molecular marker Chr06:26042043 can be used to identify low chilling-required peach materials with a high probability (87.2% success rate). Then, the C:C and T:C genotypes of the KASP molecular marker Chr01:46470090 can be used to accurately identify most of the low chilling-required peaches (accounting for 75%), which greatly improves the probability and accuracy of obtaining low chilling-required peaches.

[0071] The molecular markers provided by this invention will demonstrate important reference and application prospects in various breeding projects in peach-growing regions around the world.

[0072] While the present invention has been disclosed above, it is not limited thereto. Any person skilled in the art can make various modifications and alterations without departing from the spirit and scope of the invention; therefore, the scope of protection of the present invention should be determined by the scope defined in the claims.

Claims

1. A KASP molecular marker Chr06:26042043 primer combination, or a KASP molecular marker Chr01:46470090 primer combination is applied to assist in screening peaches with different chilling requirement attributes. The KASP molecular marker Chr06:26042043 primer combination comprises a forward primer 1, a forward primer 2, and a common reverse primer, wherein the nucleotide sequence of the forward primer 1 is shown in SEQ ID No. 1, the nucleotide sequence of the forward primer 2 is shown in SEQ ID No. 2, and the nucleotide sequence of the common reverse primer is shown in SEQ ID No.

3. The KASP molecular marker Chr01:46470090 primer combination comprises a forward primer 1, a forward primer 2, and a common reverse primer, wherein the nucleotide sequence of the forward primer 1 is shown in SEQ ID No. 4, the nucleotide sequence of the forward primer 2 is shown in SEQ ID No. 5, and the nucleotide sequence of the common reverse primer is shown in SEQ ID No.

6.

2. Use according to claim 1, characterized in that, Different fluorescent signal tags are added to the 5' ends of the forward primer 1 and the forward primer 2 of the KASP molecular marker Chr06:26042043 primer combination, or different fluorescent signal tags are added to the 5' ends of the forward primer 1 and the forward primer 2 of the KASP molecular marker Chr01:46470090 primer combination.

3. Use according to claim 1, characterized in that, The steps include: (1) primer synthesis: synthesizing the KASP molecular marker Chr06:26042043 primer combination or the KASP molecular marker Chr01:46470090 primer combination of claim 1; (2) DNA extraction: extracting the genomic DNA of the peach to be selected; (3) KASP reaction: using the genomic DNA extracted in step (2) as a template, and using the KASP molecular marker Chr06:26042043 primer combination or the KASP molecular marker Chr01:46470090 primer combination synthesized in step (1) to perform KASP reaction; (4) KASP product detection and analysis: detecting the genotyping of the amplification product, and preliminarily determining the chilling requirement attribute of the peach according to the genotyping; The order of steps (1) and (2) is not required. 4.The application of a combination of molecular marker primer combinations in assisting in screening peaches with different chilling requirement attributes, wherein the molecular marker primer combinations comprise the KASP molecular marker Chr06:26042043 primer combination and the KASP molecular marker Chr01:46470090 primer combination of claim 1.

Images