A Cas9-GR fusion protein and its application in gene editing

Abstract

The present invention belongs to the field of genetic engineering technology, and specifically relates to a Cas9-GR fusion protein and its application in gene editing. The present invention also provides a gene editing system based on dexamethasone induction, which can be induced in the presence of different concentrations of dexamethasone, so that the Cas9-sgRNA complex can be specifically allowed to enter the cell nucleus for gene editing, thereby reducing the adverse effects of overexpression of the corresponding elements of gene editing in vivo on plant growth and development, and providing new ideas for crop breeding research.

Description

Technical Field

[0001] The present invention belongs to the technical field of genetic engineering, and in particular relates to a Cas9-GR fusion protein and an application thereof in gene editing. Background Art

[0002] The CRISPR / Cas9 system has been widely used to knock out single genes in a variety of plants and study gene functions. CRISPR / Cas9 technology is usually transferred to the host in the form of DNA, and is integrated into the host genome along with a constitutive promoter with strong transcriptional activity. It is likely to be continuously expressed in the body, increasing the risk of off-target mutations. Studies have shown that in plants, this continuous expression of exogenous genes may competitively hinder the expression of host genes and affect the normal growth and development of the plant itself to a certain extent. For some crops, it may further affect the yield.

[0003] Therefore, as a tool for gene editing, CRISPR / Cas9 needs to screen out mutant offspring without CRISPR / Cas9 vector insertion in the genome through recombination after it has completed its editing function, so as to prevent it from continuing to edit foreign genes. However, this method is time-consuming and labor-intensive. Therefore, there is an urgent need for an inducible gene editing system that can realize the editing function in the presence of an inducer and not perform gene editing in the absence of an inducer. Summary of the invention

[0004] In view of this, the present invention provides the following technical solutions:

[0005] The present invention provides a Cas9-GR fusion protein, which comprises a Cas9 nuclease fragment and a glucocorticoid receptor fragment; the amino acid sequence of the Cas9 nuclease fragment is shown in SEQ ID NO: 1, and the glucocorticoid receptor fragment is shown in SEQ ID NO: 2.

[0006] Preferably, the nucleic acid sequence corresponding to the aforementioned Cas9 nuclease fragment is as shown in SEQ ID NO:4, and the nucleic acid sequence corresponding to the glucocorticoid receptor fragment is as shown in SEQ ID NO:5.

[0007] An optional Cas9-GR fusion protein, wherein the glucocorticoid receptor fragment is directly connected to one end of the Cas9 nuclease fragment or using a linker.

[0008] Preferably, the glucocorticoid receptor fragment is linked to the C-terminus of the Cas9 nuclease fragment.

[0009] An optional amino acid sequence of the Cas9-GR fusion protein is shown in SEQ ID NO: 3. Preferably, the corresponding nucleotide sequence is shown in SEQ ID NO: 6.

[0010] A vector expressing the Cas9-GR fusion protein.

[0011] A strain containing a vector expressing the above-mentioned Cas9-GR fusion protein.

[0012] Application of the above-mentioned Cas9-GR fusion protein, vector and strain in gene editing.

[0013] A method for inducible gene editing of plants, comprising the following steps:

[0014] a. Construct CRISPR / Cas9-GR backbone plasmid vector and sgRNA expression cassette respectively;

[0015] A method for constructing the CRISPR / Cas9-GR backbone plasmid vector is: using homologous recombination technology to connect the glucocorticoid receptor fragment to the C-terminus of the Cas9 nuclease fragment in the CRISPR / Cas9 vector to obtain the CRISPR / Cas9-GR backbone plasmid vector.

[0016] A sgRNA expression cassette, wherein the sgRNA expression cassette comprises a snRNA promoter and a sgRNA sequence.

[0017] b. Connect the sgRNA expression cassette in a to the backbone plasmid vector in a to obtain a CRISPR / Cas9-GR targeted knockout plasmid vector;

[0018] c. The targeted knockout plasmid vector constructed in b was transferred into the target cells, and cultured until hairy roots were first observed in the radicle segments, and positive strains were screened;

[0019] Preferably, the method of transferring into target cells is Agrobacterium transformation.

[0020] d. Take the hairy roots of the positive strain in c for subculture, add dexamethasone to induce editing during the subculture process, and obtain gene-edited plants. Preferably, the concentration of dexamethasone is 12-30 μM.

[0021] Beneficial effects:

[0022] This invention fuses the Cas9 nuclease with the glucocorticoid receptor (GR) for the first time. Under normal conditions, GR binds to the heat shock protein HSP90, making the protein complex too large to enter the cell nucleus, so that Cas9 cannot function. When dexamethasone (DXMS) is applied, DXMS competes with GR to separate HSP90, allowing the Cas9 protein to enter the nucleus and function.

[0023] The system of the present invention can make CRISPR / Cas9 specifically induced to express by dexamethasone, and the function of the system is verified in alfalfa hairy roots, thereby expanding the function of the CRISPR / Cas9 system and making it a more effective genetic engineering breeding tool. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 :Schematic diagram of the principle of the dexamethasone-inducible CRISPR / Cas9-GR system.

[0025] Figure 2 :pYLCRISPR / Cas9 plasmid map.

[0026] Figure 3 : Schematic diagram of sgRNA expression cassette.

[0027] Figure 4 : Schematic diagram of the construction of the sgRNA expression cassette.

[0028] Figure 5 :Schematic diagram of the pYLCRISPR / Cas9-GR final vector.

[0029] Figure 6 : Example 3 inducible vector target site sequencing peak diagram.

[0030] Figure 7 : Example 3 induced vector target gene editing statistical bar chart.

[0031] Figure 8 : Example 3 uninduced vector target site sequencing peak diagram.

[0032] Fig. 9 : Example 4 inducible vector target site sequencing peak diagram.

[0033] Fig.10 : Example 4 induced vector target gene editing statistical bar chart.

[0034] Fig.11 : Example 4 uninduced vector target site sequencing peak diagram. DETAILED DESCRIPTION

[0035] The present invention provides a Cas9-GR fusion protein, which comprises a Cas9 nuclease fragment and a glucocorticoid receptor fragment; the amino acid sequence of the Cas9 nuclease fragment is shown in SEQ ID NO: 1, and the glucocorticoid receptor fragment is shown in SEQ ID NO: 2.

[0036] Preferably, the nucleic acid sequence corresponding to the aforementioned Cas9 nuclease fragment is as shown in SEQ ID NO:4, and the nucleic acid sequence corresponding to the glucocorticoid receptor fragment is as shown in SEQ ID NO:5.

[0037] An optional Cas9-GR fusion protein, wherein the glucocorticoid receptor fragment is directly or using a linker connected to one end of the Cas9 nuclease fragment. Preferably, the glucocorticoid receptor fragment is connected to the C-terminus of the Cas9 nuclease fragment. Optionally, the linker is a flexible linker, which can be selected from one of polyglycine and SGGS sequences.

[0038] An optional amino acid sequence of the Cas9-GR fusion protein is shown in SEQ ID NO: 3. Preferably, the corresponding nucleotide sequence is shown in SEQ ID NO: 6.

[0039] A vector expressing the Cas9-GR fusion protein.

[0040] A strain containing a vector expressing the above-mentioned Cas9-GR fusion protein.

[0041] Application of the above-mentioned Cas9-GR fusion protein, vector and strain in gene editing.

[0042] A method for inducible gene editing of plants (principle Figure 1 ), including the following steps:

[0043] a. Construct CRISPR / Cas9-GR backbone plasmid vector and sgRNA expression cassette respectively;

[0044] A method for constructing the CRISPR / Cas9-GR backbone plasmid vector is: using homologous recombination technology to connect the glucocorticoid receptor fragment to the C-terminus of the Cas9 nuclease fragment in the CRISPR / Cas9 vector to obtain the CRISPR / Cas9-GR backbone plasmid vector.

[0045] Optionally, the CRISPR / Cas9 vector includes a single-target vector and a multi-target vector; preferably, the multi-target vector is a pYLCRISPR / Cas9 plasmid vector.

[0046] A sgRNA expression cassette (sgRNA expression cassette schematic diagram as shown in Figure 2 ), the sgRNA expression cassette comprises a snRNA promoter and a sgRNA sequence. Preferably, the sgRNA expression cassette is a multi-sgRNA expression cassette, comprising a multi-snRNA promoter and sgRNAs designed for different targets.

[0047] Optionally, a four-sgRNA expression cassette comprises four sgRNA sequences in series with a snRNA promoter; preferably, the snRNA promoter is selected from one or more of AtU3b, AtU3d, AtU6-1 and AtU6-29.

[0048] Preferably, a four-sgRNA expression cassette tandem sequence: AtU6-1-sgRNA-AtU6-29-sgRNA-AtU3b-sgRNA-AtU3d-sgRNA.

[0049] b. Connect the sgRNA expression cassette in a to the backbone plasmid vector in a to obtain a CRISPR / Cas9-GR targeted knockout plasmid vector; preferably, connect the sgRNA expression cassette to the Bsa Ⅰ restriction site of the pYLCRISPR / Cas9 plasmid vector.

[0050] c. The targeted knockout plasmid vector constructed in b is transferred into the target cells, cultured until hairy roots are first observed in the radicle segments, and positive strains are screened; preferably, the method of transferring into the target cells is Agrobacterium transformation.

[0051] Optionally, PCR technology is used to screen positive strains.

[0052] d. Take the hairy roots of the positive strain in c for subculture, add dexamethasone to induce editing during the subculture process, and obtain gene-edited plants. Preferably, the concentration of dexamethasone is 12-30 μM.

[0053] In the present invention, unless otherwise specified, all raw material components are commercially available products well known to those skilled in the art. The technical scheme of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, not all. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in the field without making creative work belong to the scope of protection of the present invention.

[0054] Example 1

[0055] Transform the Cas9 nuclease in the pYLCRISPR / Cas9 system into an inducible Cas9-GR:

[0056] (1) Obtaining GR sequence:

[0057] The GR sequence (SEQ ID NO: 2) was amplified from the pDEX00 plasmid (Gen ID: FM177582.1) using PCR technology.

[0058] Upstream primer (F primer): GACAGGCTAAGAAAAAGAAGgatccaattcagcaagccac (SEQ ID NO: 7).

[0059] Downstream primer (R primer): TGAACGATCGGGAGGATCCTAtttttgatgaaacagaagc (SEQ ID NO: 8).

[0060] (2) Linearization of pYLCRISPR / Cas9 vector: Linearize the pYLCRISPR / Cas9 vector (such as Figure 2 As shown in the article, Liu Yaoguang's group at South China Agricultural University, A Robust CRISPR / Cas9 System for Convenient, High-Efficiency Multiplex Genome Editing in Monocot and Dicot Plants) was linearized by restriction endonuclease BamHI digestion. The digestion system is shown in Table 1:

[0061] Table 1 Enzyme digestion system

[0062]

[0063] The digested product was run on agarose gel electrophoresis and a 9606 bp fragment was recovered from the gel.

[0064] (3) Connection between Cas9 and GR: The GR sequence was connected to the linearized pYLCRISPR / Cas9 vector using homologous recombination, and the pEASY-Basic Seamless Cloning and Assembly Kit (Full Gold) was used for homologous recombination connection. The cloning reaction system is shown in Table 2:

[0065] Table 2 Cloning reaction system

[0066]

[0067] All the reaction products were transformed into competent E. coli DH5α, spread on LB medium containing kanamycin, cultured overnight at 37°C, single colonies were selected, plasmids were extracted and sent to Sanger sequencing company for Sanger sequencing. The Cas9-GR sequence is shown in SEQ ID NO: 3.

[0068] Example 2

[0069] Construction of inducible gene editing system vector pYLCRISPR / Cas9-GR multi-target:

[0070] 1. Construction of sgRNA expression cassette (e.g. Figures 3-5 shown):

[0071] The sgRNA expression cassette contains a snRNA promoter and an sgRNA sequence. The sgRNA sequence is 97 nt in length and is divided into two parts, a 20 nt target sequence (gRNA) at the 5' region and a conserved structural sequence (crRNA) at the 3' region. In this scheme, four vectors (SEQ ID NO: 9-12) containing snRNA promoters suitable for dicots (AtU3b, AtU3d, AtU6-1, and AtU6-29) were used. This vector system can design 1-4 target site sequences (gRNA) and connect crRNA to form sgRNA. The sgRNAs designed for the same target gene are connected to different snRNA promoters to form sgRNA expression cassettes, and these sgRNA expression cassettes are connected in series.

[0072] For each gRNA, two pairs of primers were designed: the first pair of F primers contained the gRNA sequence and paired with crRNA, and the R primer was the universal primer gR-R; the second pair of R primers contained the gRNA sequence and paired with the snRNA promoter, and the F primer was the universal primer UF (see Table 3). The gRNA was connected to the crRNA and snRNA promoter respectively by the first round of PCR using these two pairs of primers, and the two PCR products overlapped at the gRNA sequence for the second round of overlapping PCR.

[0073] Table 3 First round PCR primer sets

[0074]

[0075] Table 4 First round PCR system 1 (amplification of gRNA+crRNA)

[0076]

[0077] Table 5 First round PCR system 2 (amplification of gRNA + snRNA promoter)

[0078]

[0079] Second round of overlapping PCR: The two PCR products of each gRNA in the first round were connected to finally obtain sgRNA expression cassettes driven by different snRNA promoters. Each sgRNA expression cassette was amplified with the following primers: Pps-GG1 / Pgs-GG1, Pps-GG2 / Pgs-GG2, Pps-GG3 / Pgs-GG3, Pps-GG4 / Pgs-GG4 (see Table 6 for details). Each pair of primers has different BsaI cleavage ends at the end, so that each sgRNA expression cassette can be connected in series using the golden gate cloning technology. If there are less than 4 gRNAs, the F primer of the first sgRNA expression cassette and the R primer of the last expression cassette must be Pps-GG1 and Pgs-GG4 to ensure that they can be connected to the pYLCRISPR / Cas9-GR vector after BsaI digestion.

[0080] Table 6 Second round overlapping PCR primer sets

[0081]

[0082] Take 0.5 μL of each of the two products of the first round of PCR for the second round of PCR. The PCR reaction system is shown in Table 7:

[0083] Table 7 Second round overlapping PCR system

[0084]

[0085] 2. Connection scheme between target site sgRNA expression cassette and pYLCRISPR / Cas9-GR vector:

[0086] Golden Gate cloning was used to simultaneously and sequentially assemble multiple sgRNA expression cassette fragments in the second round into the pYLCRISPR / Cas9-GR vector.

[0087] Table 8 Cutting and joining system

[0088]

[0089] Table 9 Cutting and joining procedures

[0090]

[0091] The ligation product was transformed into Escherichia coli DH5α, and sent for sequencing after colony PCR detection to verify the positive clones.

[0092] Example 3

[0093] Feasibility verification of inducible pYLCRISPR / Cas9-GR vector in Arabidopsis:

[0094] In order to verify the feasibility of Cas9-GR, six genes related to DNA methylation, AtROS1, AtROS3, AtSUVH5, AtAGO4, AtCMT2, and AtDDM1, were selected as target genes in Arabidopsis, and two gRNA target sites were designed for each gene as shown in the table below. The pYLCRISPR / Cas9-GR targeted knockout vector constructed in Example 1 and the unmodified pYLCRISPR / Cas9 vector were used as controls for gene knockout verification (the construction method is described in Example 2). Table 10 gRNA information

[0095]

[0096] Arabidopsis flower infection: (1) Agrobacterium culture: Prepare 500 mL LB liquid medium for each gene, add 5 mL of bacterial solution, and culture overnight at 29°C in a shaking incubator until OD600 reaches 1.2. Centrifuge the bacterial solution at 5000 rpm for 5 min, and resuspend the bacteria in 500 mL 1 / 2MS (10% sucrose + 300 μL / L Silwet-77).

[0097] (2) Infection: Grow robust Arabidopsis plants under a long-day (16 h light, 8 h dark) environment for about 25 days. Cut off the fruit pods on the plants, soak the above-ground parts of the plants completely in the bacterial solution for 5 min, spray water on the infected flowers with a spray bottle, and cover the infected plants with plastic wrap to maintain humidity. Incubate in the dark for 1 day, then remove the plastic wrap and place under normal culture conditions.

[0098] (3) Screening and identification: After the infected pods are fully mature, the seeds are collected, dried and spread on 1 / 2MS medium with resistance. After 7 days, the seedlings with normal growth are selected and transplanted into the soil. After 10 days, the genome identification PCR is used to identify the transgenic positive plants. The positive hairy root PCR detection primers are:

[0099] pYL-Cas9-F:CTGACGCTAACCTCGACAAG (SEQ ID NO:40);

[0100] pYL-Cas9-R:CCGATCTAGTAACATAGATGACACC (SEQ ID NO:41).

[0101] 3. Dexamethasone induced transgenic positive Arabidopsis:

[0102] (1) Preparation of dexamethasone: Dissolve dexamethasone powder in DMSO to prepare a 30 mM stock solution, filter and sterilize, and store at 4°C.

[0103] (2) Dexamethasone treatment of leaves: Prepare 30 μM DSMX, select a leaf, mark it, and spray DSMX continuously for 5 days.

[0104] 4. Statistics of gene editing efficiency:

[0105] Specific primers were designed near the upstream and downstream 200 bp of the target site gRNA of the edited gene. The positive hairy root genomic DNA was used as a template and amplified with the high-fidelity enzyme ExTaq. The PCR conditions were: pre-denaturation at 98℃ for 5min; denaturation at 98℃ for 10sec; annealing at 57℃ for 30sec; extension at 68℃ for 1min, denaturation to extension for 30 cycles; post-extension at 68℃ for 10min. The PCR product was sent to Bio-Sequencing Company for Sanger sequencing to detect whether there was a base mutation near the PAM site (as shown in Tables 11 and 12 and Figure 6 and Figure 7 Editing efficiency = edited plants / regenerated plants. Ten transgenic positive Arabidopsis plants without DXMS induction were selected for Sanger sequencing of sequences near the target site. The results are shown in Figure 8 , no gene editing results were detected.

[0106] Table 11. Editing efficiency of pYLCRISPR / Cas9 original vector

[0107]

[0108] Table 12. Editing efficiency of pYLCRISPR / Cas9-GR inducible vector under different concentrations of DXMS

[0109]

[0110] Example 4

[0111] Feasibility verification of inducible pYLCRISPR / Cas9-GR vector in alfalfa:

[0112] MsPALM1, MsNRPD1, MsPDS, and MsMYBS3 were selected as target genes in alfalfa, and 3 gRNA target sites were designed for each gene as shown in the table below, and pYLCRISPR / Cas9 and pYLCRISPR / Cas9-GR (the construction method is as described in Examples 1-2, and the gRNA information is shown in Table 13) targeted knockout vectors were constructed respectively.

[0113] Table 13 gRNA information

[0114]

[0115] 1. Alfalfa (Zhongmu No. 1) hairy root transformation:

[0116] (1) Agrobacterium transformation

[0117] The successfully constructed vector was transferred into the ArQual competent cell of Agrobacterium rhizogenes, cultured in the dark at 29°C for two days, a single colony was taken to 5 mL LB (strep+kana) liquid medium, cultured in a shaking incubator at 29°C overnight, 1 mL of bacterial liquid was taken to plate, and cultured in the dark at 29°C for two days until the solid medium was full of bacteria.

[0118] (2) Seed sterilization and germination

[0119] Take seeds with full grains and uniform size, soak them in 30% NaClO liquid for 20 min, soak them in 75% alcohol for 15 min, wash them 4 times with sterile water, place the sterilized seeds on 1 / 2MS culture medium, and culture them upside down at 25℃ for 30 h (root length is about 1 cm).

[0120] (3) Hairy root induction

[0121] About 30 h after germination, when the radicle of the seedlings was about 10 mm in length, the radicle was cut about 3 mm from the root tip with a sterile scalpel. The cut was filled with Agrobacterium. The inoculated seedlings were then placed in square Petri dishes (12 × 12 cm) filled with modified Fahraeus medium. The Petri dishes containing the inoculated seedlings were partially sealed (with several holes in the Parafilm seal to allow gas exchange) and placed vertically in a growth chamber at 20 °C for 1 week (photoperiod of 16 h) to optimize the transformation frequency and then transferred to a growth chamber at 25 °C (same light conditions). Hairy roots were first observed from the radicle cuts about 1 week after inoculation with Agrobacterium rhizogenes. Therefore, by observing the location and time of hairy root emergence, it is relatively straightforward to distinguish hairy roots from the early-emerging non-transformed lateral roots. About three quarters of the inoculated plants produced hairy roots, with an average of two roots per plant.

[0122] (4) Hairy root screening and cultivation

[0123] About 2 weeks after inoculation with Agrobacterium rhizogenes, cut off the hairy roots about 1 to 2 cm long, and subculture them every 2 weeks in a medium with antibiotics at 25°C. About 2 weeks after inoculation with Agrobacterium rhizogenes, cut off the hairy roots about 1 to 2 cm long, and subculture them every 2 weeks in a medium with antibiotics at 25°C.

[0124] Table 14 Hairy root medium (modified Fahraeus medium)

[0125]

[0126] 2. Treat transgenic positive alfalfa hairy roots with dexamethasone (DXMS): Dissolve dexamethasone powder with DMSO to prepare a 30 mM DXMS stock solution, filter and sterilize with a 0.22 μM filter membrane, and store at 4°C. When preparing a dexamethasone-containing culture medium, first prepare the hairy root culture medium and sterilize it at high temperature. Pour 50 mL of culture medium into each culture dish. After the culture medium solidifies, take 20 μL or 40 μL of 30 mM dexamethasone stock solution and evenly spread it on the surface of the culture medium to prepare a culture medium containing 12 μM and 24 μM dexamethasone, respectively. During the hairy root subculture process, the hairy roots were placed in a culture medium containing 12 μM and 24 μM DXMS inducers for induction for 5 days.

[0127] 3. Identification of positive hairy roots: For the hairy roots that survived in the resistance medium, 1-2 cm of hairy roots were taken to extract genomic DNA for PCR identification of transgenic positives. The pYLCRISPR / Cas9-GR plasmid was used as a positive control, and the Zhongmu No. 1 genome was used as a negative control. The specific primers in the pYLCRISPR / Cas9-GR vector were used for amplification. The PCR conditions were: pre-denaturation at 98°C for 5 min; denaturation at 98°C for 10 sec; annealing at 57°C for 30 sec; extension at 68°C for 1 min, denaturation to extension for 30 cycles; post-extension at 68°C for 10 min; storage at 4°C. Detect PCR products by agarose gel electrophoresis.

[0128] 4. Statistics of gene editing efficiency: Specific primers were designed near the upstream and downstream 200 bp of the target site of the editing gene gRNA of the transgenic positive material, and the positive hairy root genomic DNA was used as a template for high-fidelity enzyme ExTaq amplification. The PCR conditions were: pre-denaturation at 98℃ for 5min; denaturation at 98℃ for 10sec; annealing at 57℃ for 30sec; extension at 68℃ for 1min, denaturation to extension for 30 cycles; post-extension at 68℃ for 10min. The PCR product was sent to Sanger sequencing company for Sanger sequencing to detect whether there was a base mutation near the PAM site of the target site (as shown in Tables 15 and 16 and Fig. 9 and Fig.10 10 transgenic positive hairy roots without DXMS induction were selected for Sanger sequencing of the sequences near the target site. The results are shown in Fig.11 , no gene editing results were detected. Editing efficiency = edited plants / regenerated plants.

[0129] Table 15. Editing efficiency of pYLCRISPR / Cas9 original vector

[0130]

[0131] Table 16. Editing efficiency of pYLCRISPR / Cas9-GR inducible vector under different concentrations of DXMS induction

[0132]

[0133] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. An application of Cas9-GR fusion protein in gene editing, characterized in that: The editing function is achieved in the presence of the inducer, while gene editing is not performed in the absence of the inducer; The amino acid sequence of the Cas9-GR fusion protein is shown in SEQ ID NO:

3.

2. A vector for expressing the Cas9-GR fusion protein used in claim 1.

3. A bacterial strain containing the vector according to claim 2.

4. Use of the vector according to claim 2 or the strain according to claim 3 in gene editing.

5. A method for inducible gene editing of plants, characterized in that: The following steps are involved: a. Constructing a CRISPR / Cas9-GR backbone plasmid vector and an sgRNA expression cassette respectively; the CRISPR / Cas9-GR backbone plasmid vector is capable of expressing the Cas9-GR fusion protein according to claim 1; b. Connect the sgRNA expression cassette in a to the backbone plasmid vector in a to obtain a CRISPR / Cas9-GR targeted knockout plasmid vector; c. The targeted knockout plasmid vector constructed in b was transferred into the target cells, and cultured until hairy roots were first observed in the radicle segments, and positive strains were screened; d. Take the hairy roots of the positive strain in c for subculture, add dexamethasone to induce editing during the subculture process to obtain gene-edited plants.

6. The method according to claim 5, characterized in that The construction method of the CRISPR / Cas9-GR backbone plasmid vector described in a is: using homologous recombination technology to connect the glucocorticoid receptor fragment to the C-terminus of the Cas9 nuclease fragment in the CRISPR / Cas9 vector to obtain the CRISPR / Cas9-GR backbone plasmid vector.

7. The method according to claim 5, characterized in that The sgRNA expression cassette in a comprises a snRNA promoter and a sgRNA sequence.

8. The method according to claim 5, characterized in that c) The method for transferring into target cells is the Agrobacterium transformation method.

9. The method according to claim 5, characterized in that The concentration of dexamethasone in d is 12~30μM.

Images