Fusion protein with tribasic group editing function and application thereof

Abstract

The invention provides a fusion protein with a tribasic group editing function and application thereof, and relates to the technical field of basic group editing. The fusion protein comprises adenine deaminase, N-methylpurine DNA (deoxyribonucleic acid) glycosylase and nuclease. Aiming at the problem that an existing base editing tool cannot edit by taking three bases as substrates at the same time, the invention provides a novel three-function base editor which is named as A, Camp; and G-BE. A, Camp; the G-BE can be edited by independently using A, C and G as substrates to realize the editing activity of A-G / T / C, C-T / G / A and G-T / A / C, and can also be edited by simultaneously using A, C and G as substrates on alleles.

Description

Technical Field

[0001] The present application relates to the field of base editing technology, and in particular to a fusion protein with three-base editing functions and its application. Background Art

[0002] At present, base editing technologies mainly include cytosine base editing technology (CBE), adenine base editing technology (ABE) and guanine base editing technology (gGBE), which can use C, A and G as substrates respectively to achieve efficient single-substrate base editing, and have broad application prospects in disease animal models, gene therapy, genetic screening, and crop genetic breeding.

[0003] In addition, by fusing two deaminases with the CRISPR system, dual-base editing technologies for two base substrates have been developed. However, there is currently no three-base editing technology that can edit three base substrates at the same time, and basic and applied research is in urgent need of such new technologies. Summary of the invention

[0004] To solve the above problems, the applicant, based on the working principle of base editing technology, fused adenine deaminase that can edit two base substrates (A and C) and N-methylpurine DNA glycosylase that can edit guanine bases with Cas9n, and developed a three-base editing tool that can simultaneously edit three base substrates of A, C, and G.

[0005] On the one hand, the present application provides a fusion protein for multi-base editing, the fusion protein comprising: adenine deaminase, N-methylpurine DNA glycosylase, nuclease; the adenine deaminase is selected from TadA dual, T AD AC 3.1, T AD AC 3.154, T AD AC 3.155, TadA-8e; the N-methyl purine DNA glycosylase is selected from one or more of N-methyl purine DNA glycosylase MPG v6.3 derived from humans, alkyl adenosine DNA glycosylase mAAG derived from mice, and adenosine DNA glycosylase derived from rats or Bacillus subtilis.

[0006] Further, the adenine deaminase is TadA dual; preferably, the amino acid sequence of the adenine deaminase includes the amino acid sequence shown in SEQ ID No.1 or an amino acid sequence having at least 98% sequence identity with SEQ ID NO.1; more preferably, the coding sequence of the adenine deaminase includes the nucleotide sequence shown in SEQ ID No.2 or a nucleotide sequence having at least 98% sequence identity with SEQ ID NO.2.

[0007] Specifically, the amino acid sequence of the adenine deaminase includes the amino acid sequence shown in SEQ ID No.1 or an amino acid sequence having 98%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% sequence identity with SEQ ID NO.1; the coding sequence of the adenine deaminase includes the nucleotide sequence shown in SEQ ID No.2 or an amino acid sequence having 98%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% sequence identity with SEQ ID NO.2 has nucleotide sequences with 98%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% sequence identity

[0008] More preferably, the amino acid sequence of the adenine deaminase is shown as SEQ ID No.1; the coding sequence of the adenine deaminase is shown as SEQ ID No.2.

[0009] Furthermore, the N-methylpurine DNA glycosylase is N-methylpurine DNA glycosylase MPG v6.3 derived from humans; preferably, the amino acid sequence of the N-methylpurine DNA glycosylase includes the amino acid sequence shown in SEQ ID No.3 or an amino acid sequence having at least 98% sequence identity with SEQ ID NO.3; more preferably, the coding sequence of the N-methylpurine DNA glycosylase includes the nucleotide sequence shown in SEQ ID No.4 or a nucleotide sequence having at least 98% sequence identity with SEQ ID NO.4.

[0010] Specifically, the amino acid sequence of the N-methylpurine DNA glycosylase includes the amino acid sequence shown in SEQ ID No.3 or an amino acid sequence having 98%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% sequence identity with SEQ ID NO.3; the coding sequence of the N-methylpurine DNA glycosylase includes the nucleotide sequence shown in SEQ ID No.4 or an amino acid sequence having 98%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% sequence identity with SEQ ID NO.4 has a nucleotide sequence with 98%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, and 99.9% sequence identity.

[0011] More preferably, the amino acid sequence of the N-methylpurine DNA glycosylase is shown as SEQ ID No.3; the coding sequence of the N-methylpurine DNA glycosylase is shown as SEQ ID No.4.

[0012] Further, the nuclease is selected from one or any several of Cas9, Cas3, Cas8a, Cas8b, Cas10d, Cse1, Csy1, Csn2, Cas4, Cas10, Csm2, Cmr5, Fok1, and Cpf1; preferably, the nuclease is Cas9; more preferably, the amino acid sequence of Cas9 includes the amino acid sequence shown in SEQ ID No.5 or an amino acid sequence having at least 98% sequence identity with SEQ ID NO.5; more preferably, the coding sequence of Cas9 includes the nucleotide sequence shown in SEQ ID No.6 or a nucleotide sequence having at least 98% sequence identity with SEQ ID NO.6.

[0013] Specifically, the amino acid sequence of the Cas9 includes the amino acid sequence shown in SEQ ID No.5 or an amino acid sequence having 98%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% sequence identity with SEQ ID NO.5; the coding sequence of the Cas9 includes the nucleotide sequence shown in SEQ ID No.6 or an amino acid sequence having 98%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% sequence identity with SEQ ID NO.6 has a nucleotide sequence with a sequence identity of 98%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, and 99.9%.

[0014] More preferably, the amino acid sequence of the Cas9 is shown as SEQ ID No.5; the coding sequence of the Cas9 is shown as SEQ ID No.6.

[0015] Furthermore, the fusion protein also includes an NLS (nuclear localization sequence); preferably, the NLS is located at at least one end of the fusion protein; more preferably, the NLS is located at both ends of the fusion protein; more preferably, the amino acid sequence of the NLS includes the amino acid sequence shown in SEQ ID No.7 or an amino acid sequence having at least 98% sequence identity with SEQ ID NO.7; more preferably, the coding sequence of the NLS includes the nucleotide sequence shown in SEQ ID No.8 or a nucleotide sequence having at least 98% sequence identity with SEQ ID NO.8.

[0016] Specifically, the amino acid sequence of the NLS includes the amino acid sequence shown in SEQ ID No.7 or an amino acid sequence having 98%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% sequence identity with SEQ ID NO.7; the coding sequence of the NLS includes the nucleotide sequence shown in SEQ ID No.8 or an amino acid sequence having 98%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% sequence identity with SEQ ID NO.8 has a nucleotide sequence with a sequence identity of 98%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, and 99.9%.

[0017] More preferably, the amino acid sequence of the NLS is shown as SEQ ID No.7; the coding sequence of the NLS is shown as SEQ ID No.8.

[0018] Furthermore, in the fusion protein, adenine deaminase, nuclease, and N-methylpurine DNA glycosylase are sequentially connected starting from the N (nitrogen) end of the sequence toward the C (carbon) end.

[0019] In a preferred embodiment, starting from the N-terminus of the sequence toward the C-terminus, NLS, adenine deaminase, nuclease, N-methylpurine DNA glycosylase, and NLS are sequentially connected in the fusion protein.

[0020] In a preferred embodiment, the amino acid sequence of the fusion protein includes the amino acid sequence shown in SEQ ID No.17 or an amino acid sequence having at least 98% sequence identity with SEQ ID NO.17; the sequence encoding the fusion protein includes the nucleotide sequence shown in SEQ ID No.18 or a nucleotide sequence having at least 98% sequence identity with SEQ ID NO.18.

[0021] It will be understood by those skilled in the art that a known linker can be added between the NLS, adenine deaminase, nuclease and N-methylpurine DNA glycosylase for connection, and the fusion protein can also be subjected to known modifications, including phosphorylation, acetylation, ubiquitination, glycosylation, etc., without affecting the function of the fusion protein itself.

[0022] On the other hand, the present application also provides a biomaterial, which comprises any one of the following A)-D):

[0023] A) a gene encoding the fusion protein;

[0024] B) an expression cassette, the expression cassette comprising the gene described in A);

[0025] C) a recombinant vector, the recombinant vector containing A) the gene and / or B) the expression cassette;

[0026] D) A recombinant cell or recombinant bacterium, comprising the fusion protein as described above, the gene as described in A), the expression cassette as described in B or the recombinant vector as described in C).

[0027] The expression cassette described herein may also include functional elements such as promoters, terminators, and marker genes, and those skilled in the art may make routine selections based on actual conditions, as long as the expression of the gene described in A) can be achieved. The structure and composition of the expression cassette are not excessively restricted here.

[0028] The vector described in this article refers to a vector that can carry exogenous DNA or target gene into host cells for amplification and expression. The vector can be a cloning vector or an expression vector. Those skilled in the art can choose according to actual conditions, and no excessive restrictions are imposed here.

[0029] It is understandable that those skilled in the art can select appropriate gene editing systems and gene editing methods according to actual conditions to complete the transformation of the above-mentioned mutants.

[0030] On the other hand, the present application also provides a three-base gene editing system, which includes the fusion protein; preferably, the three-base gene editing system also includes sgRNA, and the sgRNA guides the fusion protein to perform gene editing on the target gene in the target cell; more preferably, the target sequence of the sgRNA includes at least one of SEQID No.25-SEQ ID No.28; preferably, the three-base gene editing system can edit 1-3 types of bases; more preferably, the three-base gene editing system can edit 3 types of bases; more preferably, the 3 types of bases include A, C, and G.

[0031] Preferably, the three-base gene editing system can simultaneously edit three types of bases of the allele, and can achieve base conversion from A to G or T or C, C to T or G or A, and G to T or A or C in the editing target.

[0032] In a specific implementation, the target sequence of the sgRNA includes any one, any two, any three or all four of SEQ ID No. 25, SEQ ID No. 26, SEQ ID No. 27, and SEQ ID No. 28.

[0033] In a preferred embodiment, the editing target is one or more of DMD, TTR, USP46, and HFE.

[0034] The inventors of this application combined the known adenine deaminase mutant (TadA dual) with two bases (A / C) editing activity and the N-methylpurine DNA glycosylase mutant (MPG v6.3) with guanine base editing activity, and compared the editing efficiency of different constructions for the three bases A, C, and G through fusion and screening. After verification, TadA-dual-MPG v6.3 was constructed and named A, C&G-BE. In addition, this application verifies that A, C&G-BE can use the three bases A, C, and G as substrates at the same time to achieve the editing activities of AG / T / C, CT / G / A, and GT / A / C. The most important thing is that the three bases can be edited simultaneously on the same DNA (i.e., allele).

[0035] On the other hand, the present application also provides the use of the above-mentioned fusion protein, or the above-mentioned biological material, or the above-mentioned three-base gene editing system in gene editing for non-disease diagnosis and treatment purposes and / or preparation of gene editing products.

[0036] Further, the application is to edit 1-3 types of bases; preferably, the application is to edit 3 types of bases; more preferably, the 3 types of bases include A, C, and G.

[0037] The application is to simultaneously edit three types of bases of the allele, and can achieve base conversion from A to G or T or C, C to T or G or A, and G to T or A or C in the editing target.

[0038] The present invention has the following beneficial effects:

[0039] In view of the problem that existing base editing tools cannot use three bases as substrates for editing at the same time, the present invention provides a new type of trifunctional base editor, named A, C&G-BE. A, C&G-BE can edit with A, C, and G as substrates separately, realizing the editing activities of AG / T / C, CT / G / A, and GT / A / C, and can also edit with A, C, and G as substrates on alleles at the same time. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] The drawings described herein are used to provide a further understanding of the present application and constitute a part of the present application. The illustrative embodiments of the present application and their descriptions are used to explain the present application and do not constitute an improper limitation on the present application. In the drawings:

[0041] Figure 1 It is a schematic diagram of the design and construction of different plasmids;

[0042] Figure 2 This is a statistical comparison of the base editing efficiency of different construction groups at the endogenous target DMD in humans;

[0043] Figure 3 This is a representative statistical diagram of base editing efficiency of A, C&G-BE in human endogenous target DMD;

[0044] Figure 4 This is a statistical comparison of the base editing efficiency of different construction groups at the endogenous target TTR in humans;

[0045] Figure 5 This is a representative statistical diagram of base editing efficiency of A, C&G-BE on the endogenous target TTR of humans;

[0046] Figure 6 This is a statistical comparison of the base editing efficiency of different construction groups at the endogenous human target USP46;

[0047] Figure 7 This is a representative statistical diagram of base editing efficiency of A, C&G-BE at the endogenous human target USP46;

[0048] Figure 8 This is a statistical comparison of the base editing efficiency of different construction groups at the endogenous target HFE in humans;

[0049] Fig. 9 This is a representative statistical diagram of base editing efficiency of A, C&G-BE at the endogenous target HFE in humans;

[0050] Fig.10 This is a comparison chart of the simultaneous editing efficiency of A, C, and G by A, C&G-BE on the same allele at different target sites in humans. DETAILED DESCRIPTION

[0051] Technical terms:

[0052] Identity: refers to the degree of similarity between the nucleotide sequences of two nucleic acid molecules or between the amino acid sequences of two protein molecules in molecular evolution research.

[0053] Recombination: Broadly speaking, any gene exchange process that causes genotype changes is called recombination.

[0054] Expression cassette: An expression cassette is a group of DNA sequences consisting of a promoter, a target gene, and a reporter gene, which can be expressed in specific tissues and easily detected.

[0055] Recombinant vector: A recombinant vector is a vector that transfers the target gene into the basic skeleton of a cloning vector, thereby enabling the target gene to be expressed.

[0056] Recombinant bacteria: A fungal cell strain that uses genetic engineering methods to efficiently express exogenous genes.

[0057] Recombinant cell: The term "recombinant cell" means any cell type that is susceptible to transformation, transfection, transduction, etc. with a nucleic acid construct or expression vector comprising a polynucleotide of the present invention. The term "recombinant cell" encompasses any progeny of a parent cell that is not identical to the parent cell due to mutations that occur during replication.

[0058] In order to more clearly explain the overall concept of the present application, the following is described in detail in conjunction with the accompanying drawings of the specification by way of embodiment. In the following description, a large number of specific details are provided to provide a more thorough understanding of the present invention. However, it is obvious to those skilled in the art that the present invention can be implemented without one or more of these details. In other examples, in order to avoid confusion with the present invention, some technical features well known in the art are not described.

[0059] It should be noted that the following detailed descriptions are exemplary and are intended to provide further explanation of the present application. Unless otherwise specified, all technical and scientific terms used herein have the same meanings as those commonly understood by those skilled in the art to which the present application belongs.

[0060] Unless otherwise specified, in the following embodiments, the reagents or instruments used without indicating the manufacturer are all conventional products that can be purchased commercially.

[0061] The processes, conditions, reagents, experimental methods, etc. for implementing the present invention, except for the contents specifically mentioned below, are all common knowledge and common common sense in the art, and the present invention has no particular limitations, such as those described in Sambrook et al., Molecular Cloning, A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the recommended conditions of the manufacturer.

[0062] 1.1 Plasmid design and construction

[0063] 1.1.1. Based on the functional determination of existing base editing proteins, three fusion plasmids were constructed ( Figure 1): AYBE-v6.3, TadA-dualv3 (without UGI), A,C&G-BE.

[0064] Among them, the amino acid sequence of TadA dual is shown in SEQ ID No.1, and the nucleotide sequence is shown in SEQ ID No.2, the amino acid sequence of TadA-8e is shown in SEQ ID No.9, and the nucleotide sequence is shown in SEQ ID No.10, the amino acid sequence of MPG v6.3 is shown in SEQ ID No.3, and the nucleotide sequence is shown in SEQ ID No.4, the amino acid sequence of MPG v3 is shown in SEQ ID No.11, and the nucleotide sequence is shown in SEQ ID No.12, the amino acid sequence of Cas9 (D10A) is shown in SEQ ID No.5, and the nucleotide sequence is shown in SEQ ID No.6, the amino acid sequence of NLS is shown in SEQ ID No.7, and the nucleotide sequence is shown in SEQ ID No.8.

[0065] Specifically, SpCas9 TadDE (addgene #193837) and ABE8e (addgene #138489) were used as vectors to synthesize MPG v3 and MPG v6.3, and then cloned and assembled to construct plasmids AYBE v6.3, TadA-dual v3 (without UGI), A, C & G-BE, and the amino acid and nucleotide sequences of control plasmids ABE8e, gGBE v6.3, and AYBE v3 are shown in Table 1.

[0066] Table 1. Construction group plasmid sequences

[0067]

[0068] 1.1.2. Five endogenous targets from humans, DMD, TTR, USP46, and HFE (sequences are shown in Table 1) were designed for screening. The DNA of the targets DMD, TTR, USP46, and HFE shown in Table 1 were artificially synthesized and connected to the BbsⅠ site of the sgRNA expression plasmid U6-sgRNA-EF1α-GFP (used to express the sgRNA of the corresponding target) through Golden Gate cloning to obtain the recombinant target plasmid. The target and sequence are shown in Table 2.

[0069] Table 2. Targets and sequences used

[0070] Target name Sequence (5'-3') SEQ ID No. DMD ATCTTACAGGAACTCCAGGATGG 25 TTR TGAATCCAAGTGTCCTCTGATGG 26 USP46 TAAGCATAGACTCCAGGATAAGG 27 HFE ACGTGCCAGGTGGAGCACCCAGG 28

[0071] 1.1.3. Perform Sanger sequencing on the plasmids constructed in 1.1.1 and 1.1.2 to ensure they are completely correct.

[0072] 1.2 Cell transfection

[0073] HEK293T 2×10 5 The cells were plated in 24-well plates. When the cells grew to 70%-80%, the plasmid combination was transfected according to the working plasmid:sgRNA=750ng:250ng. Each plasmid combination was transfected in 3 replicates, with 2×10 5 cells. A blank control without transfection of any plasmid was set up at the same time. After 24h and 48h of transfection, the supernatant was discarded and 500μL of complete culture (89% DMEM (Gibco) + 10% FBS (BioVision Technology) + 1% PS (Gibco)) was added until the cell genome was extracted.

[0074] Working plasmids: plasmids AYBE v6.3, TadA-dual v3 (without UGI), A, C & G-BE, with plasmids ABE8e, gGBE v6.3, AYBE v3 as controls.

[0075] 1.3. Genome extraction and preparation of amplicon libraries

[0076] 72h after transfection, BIOSEARCH QuickExtract TM The cell genomic DNA was extracted using a DNA extraction kit (QE09050). The Hitom kit was then used to design the corresponding identification primers (Table 3), i.e., a bridge sequence 5'-ggagtgagtacggtgtgc-3' was added to the 5' end of the forward identification primer, and a bridge sequence 5'-gagttggatgctggatgg-3' was added to the 5' end of the reverse identification primer, to obtain a first-round PCR product. The first-round PCR product was then used as a template for a second-round PCR, mixed together, cut and recovered, purified, and then sent to a sequencing company for NGS sequencing.

[0077] Table 3. Primers used to identify the targets

[0078]

[0079] 1.4 Data Analysis

[0080] www.rgenome.net was used to process the NGS results, and the A, C, and G bases upstream of the PAM sequence (usually 2-14 nt) were counted. Graphpad was used to summarize and plot the data to obtain the final editing efficiency results (such as Figure 2-10 ). The editing window is numbered as follows: starting from the end farthest from the PAM end, the first base (nt) is the first, and so on, until the 20th.

[0081] in conclusion:

[0082] like Figure 2-9 As shown, by statistically analyzing the high-throughput sequencing data of 4 targets,

[0083] ABE8e can effectively realize A to G base conversion with an efficiency of 42.0%-63.7%; AYBEv3 can effectively catalyze A to G conversion (efficiency of 9.5%-33.7%), and can also effectively catalyze A to Y (Y = T or C) base conversion, with an efficiency of 13.6%-26.6% for A to C and 4.4%-8.0% for A to T; In addition, ABE8e also has a weak ability to catalyze C, with an efficiency of 1.03%-12.2% (the sum of C to G / T / A); gGBE v6.3 mainly realizes G to T or G to C base transversion, with efficiencies of 2.3%-13.4% for G to T and 3.5%-15.4% for G to C, and also has a weak G to A editing ability, with an efficiency of 0.4%-1.3%;

[0084] In addition to effectively catalyzing the conversion from A to G (efficiency of 10.1%-46.6%), AYBEv6.3 can also effectively achieve A to Y (Y = T or C) base conversion and G to T or G to C base transversion, with efficiencies of 10.8%-16.8% for A to C, 8.6%-10.7% for A to T, 2.9%-4.7% for G to T, 2.4%-8.2% for G to C, and 0.4%-1.1% for G to A; it also has a weak ability to catalyze C, with an efficiency of 0.43%-2.9%. However, it cannot achieve simultaneous editing of three bases on the same allele (efficiency of 0), which may be caused by the extremely low editing efficiency of C.

[0085] TadA-Dual-MPG v3 can effectively achieve A to G base conversion (efficiency of 6.0%-38.1%), A to Y (Y = T or C) base conversion, C to T or C to G base transversion, with efficiency of 6.0%-38.1% for A to G, 5.3%-13.5% for A to C, 2.5%-7.7% for A to T, 7.5%-20.1% for C to T, and 5.4%-24.1% for C to G; but it does not have the catalytic editing ability of G;

[0086] A, C & G-BE can effectively catalyze the editing of A, with A to G base conversion (efficiency of 4.4%-39.3%), A to C at 0.9%-6.4%, and A to T at 1.0%-4.6%; it also has the ability to catalyze the editing of C, with C to T at 6.3%-18.5%, C to G at 5.4%-24.1%, and C to A at 1.3%-4.1%; it also has the ability to catalyze the editing of G, with G to T at 3.5%-8.0%, G to C at 3.3%-11.8%, and G to A at 0.7%-0.9%.

[0087] By further counting the editing efficiency when three bases of the same DNA mutated simultaneously, it was found that only A, C & G-BE had the ability to edit three bases simultaneously ( Fig.10 ), the editing efficiency is 3.21%-6.50%, therefore, this tool is named A,C&G-BE.

[0088] The above is only an embodiment of the present application and is not intended to limit the present application. For those skilled in the art, the present application may have various changes and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application should be included in the scope of the claims of the present application.

Claims

1. A fusion protein for multi-base editing, characterized in that: The fusion protein comprises: adenine deaminase, N-methylpurine DNA glycosylase, and nuclease; the adenine deaminase is selected from TadA dual, T AD AC 3.1, T AD AC3.154, T AD AC 3.155, TadA-8e; the alkyladenine DNA glycosylase is selected from one or more of N-methylpurine DNA glycosylase MPG v6.3 from human, alkyladenosine DNA glycosylase mAAG from mouse, and adenosine DNA glycosylase from rat or Bacillus subtilis.

2. The fusion protein according to claim 1, characterized in that The adenine deaminase is TadA dual; preferably, the amino acid sequence of the adenine deaminase includes the amino acid sequence shown in SEQ ID No.1 or an amino acid sequence having at least 98% sequence identity with SEQ ID NO.1; more preferably, the coding sequence of the adenine deaminase includes the nucleotide sequence shown in SEQ ID No.2 or a nucleotide sequence having at least 98% sequence identity with SEQ ID NO.

2.

3. The fusion protein according to claim 1, characterized in that The N-methylpurine DNA glycosylase is N-methylpurine DNA glycosylase MPG v6.3 derived from humans; preferably, the amino acid sequence of the N-methylpurine DNA glycosylase includes the amino acid sequence shown in SEQ ID No.3 or an amino acid sequence having at least 98% sequence identity with SEQ ID NO.3; more preferably, the coding sequence of the N-methylpurine DNA glycosylase includes the nucleotide sequence shown in SEQ ID No.4 or a nucleotide sequence having at least 98% sequence identity with SEQ ID NO.

4.

4. The fusion protein according to claim 1, characterized in that The nuclease is selected from one or any several of Cas9, Cas3, Cas8a, Cas8b, Cas10d, Cse1, Csy1, Csn2, Cas4, Cas10, Csm2, Cmr5, Fok1, and Cpf1; preferably, the nuclease is Cas9; more preferably, the amino acid sequence of Cas9 includes the amino acid sequence shown in SEQ ID No.5 or an amino acid sequence having at least 98% sequence identity with SEQ ID NO.5; more preferably, the coding sequence of Cas9 includes the nucleotide sequence shown in SEQ ID No.6 or a nucleotide sequence having at least 98% sequence identity with SEQ ID NO.

6.

5. The fusion protein according to claim 1, characterized in that The fusion protein further comprises an NLS; preferably, the NLS is located at at least one end of the fusion protein; more preferably, the NLS is located at both ends of the fusion protein; more preferably, the amino acid sequence of the NLS comprises the amino acid sequence shown in SEQ ID No.7 or an amino acid sequence having at least 98% sequence identity with SEQ ID NO.7; more preferably, the coding sequence of the NLS comprises the nucleotide sequence shown in SEQ ID No.8 or a nucleotide sequence having at least 98% sequence identity with SEQ ID NO.

8.

6. The fusion protein according to claim 1, characterized in that In the fusion protein, adenine deaminase, nuclease, and N-methylpurine DNA glycosylase are sequentially connected from the N-terminal to the C-terminal.

7. Biomaterial, characterized in that The biological material includes any one of the following A)-D): A) a gene encoding the fusion protein according to any one of claims 1 to 6; B) an expression cassette, the expression cassette comprising the gene described in A); C) a recombinant vector, the recombinant vector containing A) the gene and / or B) the expression cassette; D) A recombinant cell or recombinant bacterium, comprising the fusion protein according to any one of claims 1 to 6, the gene according to A), the expression cassette according to B or the recombinant vector according to C).

8. A three-base gene editing system, characterized in that: The three-base gene editing system comprises the fusion protein described in any one of claims 1-6; preferably, the three-base gene editing system also comprises sgRNA, and the sgRNA guides the fusion protein to perform gene editing on the target gene in the target cell; more preferably, the target sequence of the sgRNA comprises at least one of SEQID No.25-SEQ ID No.28; preferably, the three-base gene editing system is capable of editing 1-3 types of bases; more preferably, the multi-base gene editing system is capable of editing 3 types of bases; more preferably, the 3 types of bases include A, C, and G.

9. Use of the fusion protein as described in any one of claims 1-6, or the biomaterial as described in claim 7, or the three-base gene editing system as described in claim 8 in gene editing for non-disease diagnosis and treatment purposes and / or in preparing gene editing products.

10. The use according to claim 9, characterized in that: The application is to edit 1-3 types of bases; preferably, the application is to edit 3 types of bases; more preferably, the 3 types of bases include A, C, and G.

Images