Penicillin g expandase mutants and polynucleotides, expression vectors, uses

By subjecting penicillin G expandase to specific amino acid sequence mutations, its catalytic activity was improved, solving the problem of insufficient enzyme activity and achieving more efficient 7-ADCA production.

CN119286809BActive Publication Date: 2025-10-14HEBEI KAIENLI BIOTECHNOLOGY CO LTD
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411812860.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-12-10
Publication Date
2025-10-14
Estimated Expiration
2044-12-10

AI Technical Summary

Technical Problem

The activity of existing penicillin G expandase is low and cannot meet the production requirements of 7-ADCA in industrial applications, becoming the rate-limiting step in the whole-enzyme synthesis.

Method used

By introducing specific point mutations, such as R27M, L50V, M73T, R139K, Y184H, Y217A, R249A and T292A, into the amino acid sequence of penicillin G expandase, the catalytic activity and conversion efficiency of the enzyme are improved.

Benefits of technology

The conversion rate of penicillin G to G-7-ADCA was significantly improved, the enzyme activity was enhanced, and its application prospects in the industrial production of 7-ADCA were broadened.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119286809B_ABST
    Figure CN119286809B_ABST
Patent Text Reader

Abstract

The application belongs to the technical field of biological medicine, and particularly relates to a penicillin G expandase mutant, polynucleotide, expression vector and use. The mutant is a mutant with a R27M point mutation in the amino acid sequence shown in the sequence table SEQ ID NO. 19. The mutant also contains a point mutation at one or more of the following positions: L50V, M73T, R139K, Y184H, Y217A, R249A and T292A. The mutant provided in the application has a significantly improved conversion rate of penicillin G into G-7-ADCA than the wild type, and has a good application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of biological medicine, and particularly relates to a penicillin G expandase mutant, polynucleotide, expression vector and use. BACKGROUND

[0002] Cephalosporin antibiotics are widely used in clinical, have strong selective effect on bacteria, have little toxicity to humans, have the advantages of wide antibacterial spectrum, strong antibacterial effect, resistance to penicillinase, less allergic reaction than penicillin, and great market application amount. 7-amino-3-deacetoxycephalosporanic acid (7-ADCA) is one of the important mother nuclei for the synthesis of cephalosporin antibiotics, and as an important intermediate for the semi-synthesis of cephalosporin antibiotics, the demand is gradually increasing.

[0003] Currently, there are two main methods for producing 7-ADCA in industry: chemical enzyme method and fermentation method. The chemical enzyme method uses penicillin G as raw material, and obtains benzene acetyl-7-amino-3-deacetoxycephalosporanic acid (G-7-ADCA) by chemical oxidation, ring expansion and rearrangement, and then removes the side chain under the action of penicillin acylase to obtain 7-ADCA. This method has the disadvantages of high cost and environmental unfriendliness, and with the further development of industrial process, this method has been gradually eliminated. 7-ADCA can also be produced by fermentation in industry. In a report in 1995, it was first predicted that there is an enzyme that can change the five-membered ring of penicillin G into the six-membered ring of G-7-ADCA. Soon after, in 1998, Cho and his colleagues discovered that the expandase (DAOCS) can catalyze this reaction, making the theoretical method a reality. Currently, the commonly used method in industry is to clone the expandase gene into Pseudomonas, Penicillium chrysogenum or Streptomyces clavuligerus, and through exogenous addition of phenylacetic acid, salt or ester as substrate, G-7-ADCA is obtained by one-step fermentation. Subsequently, G-7-ADCA is removed from the acyl side chain under the catalysis of acyltransferase to obtain 7-ADCA.

[0004] The whole enzyme method for preparing 7-ADCA has the advantages of green environmental protection and low cost. The whole enzyme method starts from cheap penicillin G salt, generates G-7-ADCA through the catalysis of penicillin G expandase, and then hydrolyzes and removes the acyl side chain through the action of penicillin acylase to generate 7-ADCA. The synthesis route is as follows:

[0005] .

[0006] The research on penicillin acylase is very mature, and has been applied in industry for many years. The commonly used is immobilized penicillin acylase, and the activity of expandase is low, which is the rate-limiting step in the synthesis of 7-ADCA from penicillin G. Therefore, it is urgent to improve the availability and activity of expandase.

[0007] Penicillin G expandase (DAOCS), also known as deacetyloxycephalosporin C synthetase, is a 2+ It works in the presence of oxygen, oxygen, and α-ketoglutaric acid, primarily catalyzing the conversion of the five-membered thiazole ring of penicillin to a six-membered thiazine ring. It is a key step in catalyzing the synthesis of cephalosporin antibiotics by Streptomyces clavuligerus and other prokaryotes. This reaction does not require the exogenous addition of precursor chemicals such as phenylacetic acid as substrates and is also environmentally friendly. Therefore, DAOCS has important industrial application value. However, in actual applications, it was found that DAOCS had low biological activity in catalyzing penicillin G and could not meet industrial applications. This became the rate-limiting step in the synthesis of 7-ADCA using the holoenzyme method. Therefore, there is an urgent need to modify the expandase in order to significantly improve its conversion efficiency to penicillin G and lay a foundation for industrial applications. The crystal structure of scDAOCS derived from Streptomyces clavuligerus has been obtained. Its amino acid sequence is shown in the sequence listing as SEQ ID NO.19 (WT-scDAOCS), and its nucleotide sequence is shown in the sequence listing as SEQ ID NO.20. This makes it possible to modify scDAOCS through protein engineering technology to improve its catalytic activity and broaden its substrate spectrum, providing broad industrial application prospects for the enzymatic production of 7-ADCA. Summary of the Invention

[0008] The present invention aims to provide mutants of penicillin G expandase, which have substitutions at one or more positions in the parent polypeptide and exhibit significantly improved activity compared to their parent polypeptides. The present invention also provides genes encoding these mutants, nucleic acid constructs, vectors, host cells, and uses of the mutants.

[0009] In order to achieve the above object, the technical solution adopted by the present invention is: a mutant of penicillin G expandase, which has an R27M point mutation in the amino acid sequence shown in SEQ ID NO.19.

[0010] Preferably, the mutant further comprises point mutations at one or more of the following positions: L50V, M73T, R139K, Y184H, Y217A, R249A and T292A.

[0011] The present invention also provides a polynucleotide encoding the mutant.

[0012] The present invention further provides an expression vector comprising the polynucleotide, wherein the expression vector is used to encode and produce the one or more mutants in an expression host.

[0013] The present invention further provides a recombinant host cell comprising the expression vector.

[0014] The present invention further provides a use of the mutant, wherein the mutant is used to synthesize phenylacetyl-7-amino-3-deacetoxycephalosporanic acid (G-7-ADCA) using penicillin G as a raw material.

[0015] The present invention further provides a penicillin G ring expansion composition, which comprises the mutant, the expression vector or the recombinant host cell.

[0016] The present invention further provides a method for preparing the mutant, which comprises: culturing the recombinant host cell and recovering the mutant.

[0017] The present invention further provides a method for preparing phenylacetyl-7-amino-3-deacetoxycephalosporanic acid using the mutant. The method uses penicillin G as a raw material, adds the mutant, recombinant host cell culture or fermentation liquid to the reaction system, and reacts for 1.5-2 hours.

[0018] The mutant provided by the present invention catalyzes the conversion rate of penicillin G to G-7-ADCA significantly higher than that of the wild type, and has good application prospects. The present invention also constructs an expandase mutant expression library, which has greatly improved enzyme activity compared with the wild-type expandase, and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 The plasmid map is pET30a-scDAOCS. DETAILED DESCRIPTION

[0020] To facilitate understanding of the present invention, the present invention will be described in more detail below with reference to the accompanying drawings and specific embodiments. However, the present invention can be implemented in many different forms and is not limited to the embodiments described in this specification. On the contrary, the purpose of providing these embodiments is to make the understanding of the present invention more thorough and comprehensive.

[0021] 1. Mutants

[0022] The present invention relates to isolated penicillin G expandase mutants comprising substitutions at one or more of positions 27, 50, 73, 139, 184, 217, 249, and 292 of the polypeptide shown in the sequence table SEQ ID NO. 19, wherein the mutants have the activity of catalyzing the conversion of the five-membered thiazole ring of penicillin to a six-membered thiazine ring.

[0023] The above-mentioned variants having substitutions or deletions should be understood to encompass all possible combinations of one or more substitutions or deletions at the specified positions.

[0024] The penicillin G expandase mutant comprises point mutations at one or more of the following positions: R27M, L50V, M73T, R139K, Y184H, Y217A, R249A and T292A.

[0025] When there are two point mutations at the same time, the mutation positions include any one of the following combinations: R27M and L50V; R27M and R139K; R27M and M73T; R27M and Y184H; R27M and Y217A; R27M and R249A; R27M and T292A.

[0026] When there are three point mutations at the same time, the mutation positions include any one of the following combinations: R27M, L50V and R139K; R27M, L50V and Y184H; R27M, L50V and Y217A; R27M, L50V and R249A; R27M, L50V and M73T; R27M, L50V and T292A; R27M, R139K and Y184H; R27M, R139K and Y217A; R27M, R139K and R249A; R27M , R139K and T292A; R27M, R139K and M73T; R27M, Y184H and Y217A; R27M, Y184H and R249A; R27M, Y184H and M73T; R27M, Y184H and T292A; R27M, Y217A and R249A; R27M, Y217A and M73T; R27M, Y217A and T292A; R27M, R249A and M73T; R27M, R249A and T292A.

[0027] When there are four point mutations at the same time, the mutation positions include any one of the following combinations: R27M, L50V, R139K and Y184H; R27M, L50V, R139K and Y217A; R27M, L50V, R139K and R249A; R27M, L50V, R139K and M73T; R27M, L50V, R139K and T292A; R27M, R139K, Y184H and Y217A; R27M, R139K , Y184H and R249A; R27M, R139K, Y184H and M73T; R27M, R139K, Y184H and T292A; R27M, Y184H, Y217A and R249A; R27M, Y184H, Y217A and M73T; R27M, Y184H, Y217A and T292A; R27M, Y217A, R249A and M73T; R27M, Y217A, R249A and T292A.

[0028] When the point mutations are 5 at the same time, the positions of the mutations include any one of the following combinations: R27M, L50V, R139K, Y184H and Y217A; R27M, L50V, R139K, Y184H and R249A; R27M, L50V, R139K, Y184H and M73T; R27M, L50V, R139K, Y184H and T292A; R27M, R139K, Y184H, Y217A and R249A; R27M, R139K, Y184H, Y217A and M73T; R27M, R139K, Y184H, Y217A and T292A; R27M, Y184H, Y217A, R249A and M73T; R27M, Y184H, Y217A, R249A and T292A.

[0029] When the point mutations are 6 at the same time, the positions of the mutations include any one of the following combinations: R27M, L50V, R139K, Y184H, Y217A and R249A; R27M, L50V, R139K, Y184H, Y217A and M73T; R27M, L50V, R139K, Y184H, Y217A and T292A; R27M, R139K, Y184H, Y217A, R249A and M73T; R27M, R139K, Y184H, Y217A, R249A and T292A; R27M, Y184H, Y217A, R249A, M73T and T292A.

[0030] When the point mutations are 7 at the same time, the positions of the mutations include any one of the following combinations: R27M, L50V, R139K, Y184H, Y217A, R249A and M73T or R27M, L50V, R139K, Y184H, Y217A, R249A and T292A.

[0031] When the point mutations are 8 at the same time, the positions of the mutations include: R27M, L50V, R139K, Y184H, Y217A, R249A, M73T and T292A.

[0032] In a further embodiment, in addition to the specific substitutions or deletions, the variant is selected from the group consisting of:

[0033] a) a polypeptide having at least 65% sequence identity to the polypeptide as shown in SEQ ID NO. 9;

[0034] b) a polypeptide encoded by a polynucleotide that hybridizes under low stringency conditions with the mature polypeptide coding sequence of SEQ ID NO. 9, or the full-length complement thereof.

[0035] c) a polypeptide encoded by a polynucleotide having at least 65% identity to the mature polypeptide coding sequence as set forth in SEQ ID NO. 9;

[0036] d) a fragment of the polypeptide as set forth in SEQ ID NO. 9 having penicillin G expandase activity.

[0037] These variants can further comprise one or more additional substitutions at one or more (e.g., several) other positions. These amino acid changes can be of a minor nature, that is conservative amino acid substitutions or insertions that do not significantly affect the folding and / or activity of the protein; small deletions, typically of 1-30 amino acids; small amino- or carboxyl-terminal extensions, such as an initial methionine residue; a small linker peptide of up to 20-25 residues; or a small extension that facilitates purification by changing net charge or another function, such as a poly-histidine sequence, an antigenic epitope or a binding domain.

[0038] Examples of conservative substitutions are within the groups of basic amino acids (arginine, lysine and histidine), acidic amino acids (glutamic acid and aspartic acid), polar amino acids (glutamine and asparagine), hydrophilic amino acids (lysine, arginine, asparagine and glutamine), hydrophobic amino acids (leucine, isoleucine and valine), aromatic amino acids (phenylalanine, tryptophan and tyrosine), and small amino acids (glycine, alanine, serine, threonine and methionine). Alternatively, the amino acid changes are of a minor nature, that is conservative amino acid substitutions which do not significantly affect the folding and / or activity of the polypeptide. For example, amino acid changes which do not significantly affect the folding and / or activity of the polypeptide are known in the art and are described, for example, by Bowie et al., Science 253: 164-170 (1991).

[0039] 2. Preparation of mutants

[0040] Any mutagenesis procedure known in the art can be used to prepare these variants, such as random mutagenesis, site-directed mutagenesis, synthetic gene construction, semi-synthetic gene construction, and the like.

[0041] 3. Polynucleotides

[0042] The present application also relates to isolated polynucleotides encoding the mutants of the present application. The polynucleotide molecules are in particular the gene sequences encoding the mutant proteins described above.

[0043] 4. Nucleic acid constructs

[0044] The present application also relates to nucleic acid constructs comprising a polynucleotide encoding a mutant of the present application operably linked to one or more control sequences that direct the expression of the coding sequence in a suitable host cell under conditions compatible with the control sequences.

[0045] The polynucleotide can be manipulated in a variety of ways to provide expression of a variant, depending on the expression vector and the control sequences that control expression.

[0046] The control sequence can be a promoter, i.e., a polynucleotide recognized by a host cell for expression of the polynucleotide. The promoter can be any polynucleotide that shows transcriptional activity in the host cell, including mutants, truncated and hybrid promoters, and can be obtained from a gene encoding an extracellular or intracellular polypeptide that is homologous or heterologous to the host cell.

[0047] 5. Expression Vector

[0048] The present invention also relates to recombinant cloning vectors and recombinant expression vectors comprising polynucleotides encoding variants of the present invention. Recombinant cloning vectors comprise any polynucleotide encoding a variant of the present invention. Recombinant expression vectors may also comprise the 3' untranslated region of the exogenous gene, namely, a polyadenylation signal and any other DNA fragments involved in mRNA processing or gene expression. The polyadenylation signal directs the addition of polyadenylic acid to the 3' end of the mRNA precursor. When constructing recombinant expression vectors using the genes described above, any enhancing, constitutive, tissue-specific, or inducible promoter may be added before the transcription initiation nucleotide, either alone or in combination with other promoters. Furthermore, when constructing recombinant expression vectors using the genes of the present invention, enhancers, including translational enhancers or transcriptional enhancers, may be used. These enhancer regions may be the ATG start codon or adjacent start codons, but must be in frame with the coding sequence to ensure correct translation of the entire sequence. The translation control signals and start codons can be derived from a variety of sources, including natural or synthetic sources. The translation initiation region may be derived from the transcriptional initiation region or a structural gene.

[0049] A recombinant expression vector can be any vector (e.g., a plasmid or virus) that undergoes a recombinant DNA procedure and can cause expression of a polynucleotide. The choice of vector will depend on the compatibility of the vector with the host cell into which the vector is to be introduced. The vector can be a linear or closed circular plasmid. It can also be an autonomously replicating vector, i.e., a vector that exists as an extrachromosomal entity. The replication of the vector is independent of chromosomal replication, such as a plasmid, an extrachromosomal element, a minichromosome, or an artificial chromosome. The vector can contain any elements for ensuring self-replication. Alternatively, the vector can be a vector that, when introduced into the host cell, is integrated into the genome and replicates together with the chromosome or chromosomes into which it has been integrated. In addition, a single vector or plasmid, or two or more vectors or plasmids (which together contain the total DNA to be introduced into the genome of the host cell), or a transposon can be used. The vector preferably contains one or more selectable markers that allow easy selection of transformed, transfected, transduced, or similar cells. A selectable marker is a gene whose product confers biocide or viral resistance, heavy metal resistance, auxotrophy, and the like.

[0050] 6. Recombinant Host Cells

[0051] The present invention also relates to recombinant host cells comprising a polynucleotide encoding a mutant of the present invention that is operably linked to one or more control sequences that direct the production of the mutant of the present invention. The construct or vector comprising the polynucleotide is introduced into the host cell so that the construct or vector is maintained as a chromosomal integrant or as an autonomously replicating extrachromosomal vector. The host cell can be any cell useful in recombinantly producing a mutant, such as a prokaryotic cell or a eukaryotic cell.

[0052] 7. Mutant Generation Method

[0053] The present invention also relates to methods for producing mutants of penicillin G expandase, comprising: (a) cultivating a recombinant host cell of the present invention under conditions suitable for expression of the mutant; and (b) recovering the mutant.

[0054] Use methods known in the art to cultivate these host cells in a kind of nutrient medium that is suitable for producing this mutant.For example, can pass through shake flask culture, or in a kind of applicable substratum and under the condition that allows this mutant to express and / or separate, carry out small-scale or large-scale fermentation (comprising continuous fermentation, batch fermentation, batch-fed fermentation or solid-state fermentation) and cultivate this cell in laboratory or industrial fermentor tank.This substratum comprises carbon source and nitrogen source and inorganic salt.Suitable substratum can be obtained from commercial supplier, or can be prepared according to disclosed composition (for example, in the American Type Culture Collection catalogue).If this mutant is secreted in this nutrient medium, then this mutant can directly reclaim from this substratum.If this mutant does not secrete, then it can reclaim from cell pyrolysis liquid.

[0055] The mutants can be detected using methods known in the art that are specific for these mutants. These detection methods include, but are not limited to, the use of specific antibodies, the formation of an enzyme product, or the disappearance of an enzyme substrate. For example, an enzyme assay can be used to determine the activity of the mutant.

[0056] The mutant can be recovered using methods known in the art. For example, the mutant can be recovered from the nutrient medium by a variety of conventional procedures including, but not limited to, collection, centrifugation, filtration, extraction, spray drying, evaporation, or precipitation.

[0057] The mutant can be purified to obtain a substantially pure mutant by various procedures known in the art, including, but not limited to, chromatography (e.g., ion exchange chromatography, affinity chromatography, hydrophobic interaction chromatography, chromatofocusing, and size exclusion chromatography), electrophoretic procedures (e.g., preparative isoelectric focusing), differential solubility (e.g., hydrogen sulfate precipitation), SDS-PAGE, or extraction.

[0058] In an alternative aspect, the mutant is not recovered, but rather a host cell of the invention expressing the mutant is used as a source of the mutant.

[0059] 8. Application of Mutants

[0060] The present invention also relates to a method for enzymatically producing 7-ADCA using a penicillin G expandase mutant. The method comprises: using penicillin G as a raw material, adding the penicillin G expandase mutant and a culture or fermentation broth of a recombinant host cell to a reaction system, and reacting for 1.5-2 hours to synthesize 7-ADCA (phenylacetyl-7-amino-3-deacetoxycephalosporanic acid).

[0061] The examples involve the addition amounts, contents and concentrations of various substances, wherein the percentages mentioned are by mass unless otherwise specified.

[0062] The whole gene synthesis, primer synthesis and sequencing in the examples were completed by Suzhou Genewiz Biotechnology Co., Ltd.

[0063] The molecular biology experiments in the examples include plasmid construction, enzyme digestion, ligation, preparation of competent cells, transformation, medium preparation, etc., which are mainly performed according to the Molecular Cloning Laboratory Guide (3rd Edition), J. Sambrook, D. w. Russell (USA) edited, Huang Peitang et al. translation, Science Press, Beijing, 2002. If necessary, the specific experimental conditions can be determined by simple tests.

[0064] The PCR amplification experiments were performed according to the reaction conditions or kit instructions provided by the plasmid or DNA template supplier. If necessary, it can be adjusted by simple test.

[0065] LB medium: 10 g / L tryptone, 5 g / L yeast extract, 10 g / L sodium chloride, pH 7.2. (LB solid medium plus 20 g / L agar powder).

[0066] Kanamycin (Kan, 100 mg / L) is used according to the requirements of the antibiotic gene carried by the plasmid.

[0067] Protein purification reagents:

[0068] 1M PB solution: take 174.0 g of potassium phosphate dibasic and dilute to 1 L of ultrapure water (potassium dihydrogen phosphate pH value is 7.1);

[0069] 4M sodium chloride solution: take 117.0 g of sodium chloride and dilute to 0.5 L of ultrapure water;

[0070] 4M imidazole solution: take 136.0 g of imidazole and dilute to 0.5 L of ultrapure water;

[0071] Equilibrium liquid: take 50 g of glycerol, 13 mL of sodium chloride mother liquor, 10 mL of 1M PB solution, and dissolve in 100 mL of water, then add ultrapure water to 500 mL;

[0072] Impurity removal liquid: take 20 g of glycerol, 5 mL of 4M sodium chloride solution, 4 mL of 1M PB solution, 1.25 mL of 4M imidazole solution, and dissolve in 100 mL of ultrapure water, then add ultrapure water to 200 mL (adjust pH to 7.1 with hydrochloric acid);

[0073] Coomassie brilliant blue staining solution: weigh 100 mg of Coomassie brilliant blue G-250, dissolve in 50 mL of 90% ethanol, add 100 mL of 85% phosphoric acid, and dilute to 1000 mL with ultrapure water;

[0074] Eluent: Dissolve 20 g of glycerol, 5 mL of 4 M sodium chloride solution, 4 mL of 1 M PB solution, and 12.5 mL of 4 M imidazole solution in 100 mL of ultrapure water, then add ultrapure water to make up to 200 mL (adjust the pH to 7.1 with hydrochloric acid).

[0075] Desalting equilibrium solution: Take 10 mL of 1M PB solution and dilute to 500 mL with ultrapure water.

[0076] The technical solution of the present invention is further described below in conjunction with Examples 1-5 and the accompanying drawings.

[0077] Example 1 Construction of an engineered bacterium expressing an expandase mutant

[0078] Based on the amino acid sequence WT-scDAOCS (SEQ ID NO. 19) of the wild-type penicillin G expandase from Streptomyces clavuligerus (GenBank accession number 1W28_A), the codon was optimized according to the codon preference of Escherichia coli (SEQ ID NO. 20). Suzhou Jinweizhi Biotechnology Co., Ltd. was commissioned to synthesize and clone into the NdeI and XhoI sites of the plasmid pET30a to obtain the plasmid pET30a-ScDAOCS. The plasmid schematic diagram is shown in the figure. Figure 1 As shown. Electroporation (BIO-RAD Gene Pulser) or Ca 2+ The recombinant plasmid was transformed into the expression host Escherichia coli BL21 (DE3) by mediated chemical transformation to obtain Ec-WT-scDAOCS.

[0079] Example 2 Purification of expandase mutants

[0080] 1. Fermentation and cell disruption of expandase strains

[0081] The engineered E. coli strain was activated by spreading it onto LB plates. A single colony was picked from the activated LB plate and transferred to 4 ml of LB liquid medium containing 100 mg / L kanamycin. The culture was incubated overnight at 37°C and 220 rpm. Subsequently, a 1 v / v% inoculum was transferred to 1 L of LB medium containing 100 mg / L kanamycin. The culture was cultured at 37°C until the OD600 reached 0.6-0.8. Protein expression was induced by adding a final concentration of 0.2 mM IPTG. Induction was continued at 25°C for 16 hours to obtain recombinant cells expressing expandase.

[0082] The bacteria were collected by centrifugation at 4 °C, 12000 rpm for 10 min, and the bacteria were washed once with 0.1 M potassium phosphate buffer (pH 8.0). The bacteria were resuspended with 30 mL of 0.1 M potassium phosphate buffer (pH 8.0), and then broken by ultrasonic cell disrupter (Ningbo Xinzhi JY92-IIN) for 20 min. The bacteria were then centrifuged at 4 °C, 12000 rpm for 30 min, and the supernatant was collected to obtain the crude enzyme solution of the expandase.

[0083] 2. Purification of expandase mutants

[0084] The protein purification of the penicillin G expandase mutants included the following steps, and all the protein purification steps were performed at 4 °C:

[0085] (1) The bacteria were resuspended with the equilibration buffer at a concentration of 15 w / v%, and then treated by ultrasonic disruption for 5 seconds on and 5 seconds off, for a total of 30 min. The supernatant after disruption was collected by centrifugation for 30 min;

[0086] (2) Mixed with 1 mL of Ni-NTA resin (Qiagen, Hilden, Germany), and incubated at 4 °C for 30 min on a gentle rotator. Then it was loaded into an empty column for protein purification;

[0087] (3) The column was washed with 4 column volumes of the wash buffer to remove impurities, and then the elution buffer was added when the Coomassie blue staining of the wash buffer showed a light blue color;

[0088] (4) The column was eluted with 3 column volumes of the elution buffer until the Coomassie blue staining showed a light blue color;

[0089] (5) The target protein bound to the Ni-NTA resin was eluted with 10 mL of the elution buffer. The eluate was concentrated using an Amicon Ultra centrifugal filter (Merck KGaA, Darmstadt, Germany) at 5,000 g for 30-60 min;

[0090] (6) The protein solution was loaded onto a pre-equilibrated PD-10 column (GE Healthcare, Buckinghamshire, UK), and the buffer was exchanged with 5 mL of desalting buffer. Finally, the desalted protein fraction was aliquoted, frozen with liquid nitrogen, and stored at -80 °C. The protein concentration was determined by the Bradford method using BSA as a standard.

[0091] Example 3 Catalytic reaction of expandase mutants

[0092] 1. Reaction system for catalyzing penicillin G to generate G-7-ADCA by expandase mutants

[0093] Reaction solution formula: 20 mM pH 7.4 phosphate buffer, 10 mg / L FeSO4, 0.1 mM ascorbic acid, 10 mM α-ketoglutaric acid, 10 mM penicillin G.

[0094] Reaction: Add 170 μL of reaction solution to 30 μL of pure enzyme, mix thoroughly, and incubate at 25°C on a shaker at 220 rpm for 2 h. After completion of the reaction, quench the reaction with 200 μL of methanol and perform HPLC analysis.

[0095] 2. Product test results

[0096] Detection of the amount of G-7-ADCA produced: After 2 h of reaction, centrifuge at 12,000 rpm for 1 min, and collect the supernatant for HPLC detection.

[0097] Liquid chromatography conditions were as follows: column: Agilent Z0RBAXSB - C18 StableBond Analytical 4.6x250mm; mobile phase: 20 mM sodium phosphate buffer, pH 3.0; methanol: 55:45; flow rate: 1 mL / min; detection wavelength: 215 nm.

[0098] Example 4 Expandase mutants generated based on error-prone PCR technology

[0099] 1. Construction of random mutation point library by error-prone PCR

[0100] A random mutant library was constructed using error-prone PCR using the wild-type expandase expression plasmid pET30a-scDAOCS as a template. The following primer pair, scDAOCS-F / scDAOCS-R, was designed: forward primer scDAOCS-F: ATGGATACCACCGTTCCGAC, and reverse primer scDAOCS-R: TTAGGCTTTGGTTTTGGTGCG.

[0101] The mutant DNA sequence of about 0.95 kb was obtained by PCR amplification using plasmid pET30a-scDAOCS as a template. The 50 μL error-prone PCR reaction system included: 10 ng of plasmid (pET30a-scDAOCS) template, 50 pmol of a pair of primers scDAOCS-F and scDAOCS-R, 1×Taq buffer, 0.2 mM dGTP, 0.2 mM dATP, 1 mM dCTP, 1 mM dTTP, 7 mM MgCl2, (0 mM, 0.05 mM, 0.1 mM, 0.15 mM, 0.2 mM) MnCl2, 2.5 units of Taq enzyme (Takara). The PCR reaction conditions are shown in Table 1.

[0102] Table 1 Error-prone PCR reaction conditions

[0103] .

[0104] The PCR product was electrophoresed and verified, and after verification, the gel was recovered (Axygen DNA gel recovery kit AP-GX-50). The plasmid pET30a-scDAOCS was used as a template, and the recovered product (random mutation fragment) of about 0.95 kb was used as a large primer, and KOD-plus DNA polymerase was used for MegaPrimer, and the reaction program is shown in Table 2.

[0105] Table 2 Reaction program

[0106] .

[0107] Subsequently, the plasmid template was digested with restriction endonuclease DpnI (Thermo) and electrotransformed into E. coli BL21 (DE3) to obtain a random mutation library of more than 500 clones.

[0108] 2. 96-well plate culture of random mutation library clones

[0109] Single colonies were picked from each LB plate and plated into a 96-well plate (each well containing 500 μL of liquid LB-Kan medium). A pET30a empty-plasma control strain was used. After incubation at 37°C and 400 rpm for 12 hours, 5% of the overnight culture was transferred to a new 96-well deep-well plate. The remaining culture was added with an equal volume of 30% glycerol and stored in a -80°C freezer. 500 μL of LB medium containing kanamycin was added to the 96-well plate and incubated at 37°C and 400 rpm for 4 hours. IPTG was then added to a final concentration of 0.2 mmol / L and incubated at 20°C and 400 rpm for 20 hours. Centrifuge at 3,700 g for 10 min to harvest the cells. Resuspend the cells in 200 μL of potassium phosphate buffer (50 mmol / L, pH 7.4, containing 100 mg / L lysozyme, 300 U / mL DNase I, and 10% Triton X-100). Centrifuge and collect the supernatant. Purify the expandase according to the expandase purification protocol and quantify the protein concentration.

[0110] Example 5: Conversion rate test of expandase mutants

[0111] 1. Determination of G-7-ADCA Synthesis Activity of Mutants

[0112] To 30 μL of enzyme solution, 170 μL of substrate solution (reaction mixture: 20 mM phosphate buffer, pH 7.4, 10 mg / L FeSO₄, 0.1 mM ascorbic acid, 10 mM α-ketoglutarate, 10 mM penicillin G) was added. After 2 h of reaction, the reaction was quenched by adding 200 μL of methanol. The sample was then filtered and analyzed by HPLC. Quantification was performed by comparison with a quantitative curve of a standard substance.

[0113] 2. Conversion rate data results of catalytic penicillin G conversion

[0114] The present invention tested the enzymatic activity of 480 expandase mutants and found that the enzymatic activity of 15 was significantly improved, named ScDAOCS-1 to ScDAOCS-15. These 15 strains were commissioned to Suzhou GeneWeichi Company for nucleic acid sequencing, mainly for single mutation sites. Table 3 shows the conversion efficiency of these single mutants.

[0115] Table 3 Conversion rates of single mutant expandase mutants generated using error-prone PCR

[0116] .

[0117] Eight mutant sites with significantly improved catalytic activity were obtained, which were R27M, L50V, M73T, R139K, Y184H, Y217A, R249A and T292A. The highest mutation efficiency site was R27M. Further combined mutation of this mutation with the remaining 7 sites was performed to construct all mutants containing 2-8 combined mutations. Protein expression, purification and catalytic activity determination were performed, and it was found that the catalytic activity of all combined mutants was higher than that of wild type and single mutant site mutants. Only the top 10 combined mutant strains with the highest enzyme activity were listed, named ScDAOCS-16-ScDAOCS-25, and the conversion efficiency of these mutants is shown in Table 4.

[0118] Table 4 Conversion rate of expanded enzyme mutant combination

[0119] strains Relative conversion rate (%) sequence mutation location WT-scDAOCS 100 SEQ ID NO.19 none ScDAOCS-16 256.36 SEQ ID NO.9 R27M, L50V, M73T, R139K, Y184H, Y217A, R249A, T292A ScDAOCS-17 186.53 SEQ ID NO.10 R27M, M73T, Y184H, Y217A, T292A ScDAOCS-18 170.64 SEQ ID NO.11 R27M, M73T, Y184H, T292A ScDAOCS-19 167.35 SEQ ID NO.12 R27M, L50V, Y184H, Y217A, T292A ScDAOCS-20 230.50 SEQ ID No. 13 R27M, L50V, M73T, Y184H, Y217A, R249A, T292A ScDAOCS-21 179.38 SEQ ID NO.14 R27M, M73T, R139K, Y184H, Y217A, T292A ScDAOCS-22 198.34 SEQ ID NO.15 R27M, L50V, R139K, Y184H, Y217A, T292A ScDAOCS-23 220.96 SEQ ID NO.16 R27M, L50V, M73T, R139K, Y184H, Y217A, R249A ScDAOCS-24 185.33 SEQ ID NO.17 R27M, L50V, Y184H, Y217A, R249A ScDAOCS-25 208.63 SEQ ID NO.18 R27M, L50V, M73T, R139K, Y184H, Y217A, T292A .

Claims

1. A penicillin G expandase mutant, characterized in that: The mutant is obtained by performing R27M point mutation on the amino acid sequence shown in SEQ ID NO.19 in the sequence listing, and its amino acid sequence is shown in SEQ ID NO.1 in the sequence listing.

2. A penicillin G expandase mutant, characterized in that: The mutant is obtained by performing point mutations at one or more of the following positions of the mutant shown in SEQ ID NO. 1: L50V, M73T, R139K, Y184H, Y217A, R249A and T291A.

3. A polynucleotide encoding the mutant according to claim 1 or 2.

4. An expression vector comprising the polynucleotide according to claim 3, characterized in that: The expression vector is used to encode and produce one or more mutants according to claim 1 or 2 in an expression host. A recombinant host cell comprising the expression vector according to claim 4 .

6. Use of the mutant according to claim 1 or 2, characterized in that: The mutant is used to synthesize phenylacetyl-7-amino-3-deacetoxycephalosporanic acid using penicillin G as raw material.

7. A penicillin G ring-expanded composition, characterized in that: The composition comprises the mutant according to claim 1 or 2.

8. A method for preparing the mutant according to claim 1 or 2, characterized in that: The mutant is recovered after culturing the recombinant host cell according to claim 5.

9. A method for synthesizing phenylacetyl-7-amino-3-deacetoxycephalosporanic acid, characterized in that: The method uses penicillin G as a raw material, adds the mutant according to claim 1 or 2, or the culture or fermentation liquid of the recombinant host cell according to claim 5 into the reaction system, and reacts for 1.5-2 hours.

Citation Information

Patent Citations

  • Modified deacetoxycephalosporin c synthase (DAOCS) and x-ray structure

    CA2316401A1

  • Penicillin expandase mutant, DNA encoding mutant, kit containing mutant and application thereof

    CN107304418A