Aconitate isomerase TarA and its applications

Abstract

The present invention belongs to the field of biotechnology, and in particular to aconitate isomerase TarA and its application. The amino acid sequence of the aconitate isomerase TarA provided by the present invention is shown in SEQ ID NO.1. It has high catalytic activity and catalytic efficiency when mediating the mutual conversion between trans-aconitate (TAA) and cis-aconitate (CAA), and tends to synthesize TAA. It can be used for microbial and enzyme-catalyzed biosynthesis of TAA, and it can promote microorganisms to utilize TAA carbon sources to maintain their growth and reproduction, improve the soil colonization ability and stress resistance survival ability of microorganisms, and in addition, by expressing TarA protein in hosts such as plants and microorganisms, it is beneficial to increase the intracellular TAA content of the host, which is beneficial to enhancing the host organism's ability to resist nematodes and nematocidal activity.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, in particular to aconitate isomerase TarA and applications thereof. Background Art

[0002] Aconitic acid (C6H6O6), also known as propylene-1,2,3-tricarboxylic acid, was first discovered in the plant Aconitum napellus. It is a low-molecular-weight, unsaturated tricarboxylic acid. In nature, due to structural differences in the double bond, which cannot rotate freely, cis- and trans-aconitic acid (TAA) occur, resulting in cis-aconiticacid (CAA) and trans-aconitic acid (TAA). In vivo, CAA is an intermediate in the isomerization of citric acid to isocitrate by the enzyme aconitase, playing a vital role in cellular energy metabolism. TAA can be produced by plants and microorganisms. The interconversion between CAA and TAA occurs primarily through two pathways: enzymatic conversion mediated by aconitate isomerase (AI) and self-conversion without enzyme catalysis.

[0003] Due to its unique chemical properties, TAA has promising application prospects in many fields. TAA has long been used as an industrial chemical, such as an antioxidant and lubricant. Furthermore, due to its unsaturated double bonds and abundant carboxyl groups, it can be used as a monomer compound or synthetic precursor for polymeric materials. It has broad potential for development in the chemical industry, such as the synthesis of bio-based plasticizers such as tributyl trans-aconitate (TBA). It is expected to gradually replace traditional phthalate plasticizers, contributing to the high-quality, green, and low-carbon development of industries such as packaging, construction, and chemicals. Furthermore, because TAA has a certain inhibitory effect on aconitase, a key enzyme in the tricarboxylic acid cycle (TCA), it can interfere with the TCA cycle and affect biological activities. Therefore, it shows great potential for application in biopesticides, such as nematode control, inhibition of Leishmania growth, and feeding resistance of brown planthoppers. Compared with traditional spray pesticides, it is more environmentally friendly and can better prevent the gradual development of pesticide resistance in pathogenic microorganisms.

[0004] Currently, trans-aconitic acid production processes include plant extraction, chemical synthesis, and microbial fermentation. Traditional plant extraction and chemical synthesis routes suffer from complex production processes, numerous by-products, high costs, and low yields, significantly limiting the development and application of trans-aconitic acid. Microbial fermentation is a new approach for producing trans-aconitic acid, offering advantages such as environmental friendliness and low cost. Its principle involves knocking out the aconitate decarboxylase gene in microbial cells, such as Aspergillus terreus, blocking the biosynthesis of itaconic acid from CAA, leading to the accumulation of CAA within the cells. Subsequently, to reduce the amount of CAA consumed in the TCA cycle, CAA is converted to TAA through efficient expression of aconitate isomerase, resulting in a high-yield TAA cell factory, enabling the microbial synthesis and green biomanufacturing of trans-aconitic acid. However, there is currently little research on aconitate isomerase. The aconitate isomerase gene TbrA was only cloned in Bacillus thuringiensis in recent years. The available biological resources for efficient synthesis of TAA are still relatively scarce. Therefore, exploring new genetic resources related to TAA synthesis is of great significance for the biosynthesis of TAA. Summary of the Invention

[0005] In response to the above-mentioned technical problems in the prior art, the present invention provides an aconitate isomerase TarA and its encoding gene. TarA has high catalytic activity and catalytic efficiency when mediating the mutual conversion between trans-aconitate (TAA) and cis-aconitate (CAA), and tends to synthesize TAA, which can be used for the microbial and enzyme-catalyzed biosynthesis of TAA, and it can promote microorganisms to utilize TAA carbon sources to maintain their growth and reproduction, and enhance the soil colonization ability and stress resistance of microorganisms. In addition, by expressing TarA protein in hosts such as plants and microorganisms, it is beneficial to increase the host's intracellular TAA content, which is beneficial to enhancing the host's ability to resist nematodes and nematode-killing activity. Therefore, the present invention further provides the application of aconitate isomerase TarA and its encoding gene in the aforementioned fields. The present invention is specifically implemented through the following scheme:

[0006] In a first aspect, the present invention provides an aconitate isomerase TarA, the amino acid sequence of which is shown in SEQ ID NO.1.

[0007] The second aspect of the present invention provides a coding gene, which encodes the aconitate isomerase TarA as described above.

[0008] Furthermore, the nucleotide sequence of the gene is shown in SEQ ID NO.2.

[0009] The third aspect of the present invention provides the use of the aconitate isomerase TarA or its encoding gene as described above in the biosynthesis of trans-aconitate.

[0010] Furthermore, the biosynthesis of trans-aconitate comprises the following steps: adding cis-aconitate and the aconitate isomerase TarA described above to a buffer solution, and reacting at pH 6.5-10.0, and more preferably at pH 6.5.

[0011] Furthermore, the buffer comprises 10-50 mM Mg 2+ and 10-200 mM NaCl. Further, the buffer comprises 20 mM Mg 2+ and 10 mM NaCl.

[0012] A fourth aspect of the present invention provides the use of the aconitate isomerase TarA or its encoding gene as described above in promoting the colonization ability of microorganisms in soil.

[0013] Furthermore, the microorganism is a bacterium; furthermore, it is Bacillus velezensis.

[0014] A fifth aspect of the present invention provides the use of the aconitate isomerase TarA or its encoding gene as described above in biological control of nematodes.

[0015] The advantages and positive effects of the present invention are:

[0016] 1. The aconitate isomerase TarA provided by the present invention has high catalytic activity and catalytic efficiency when mediating the mutual conversion between trans-aconitate (TAA) and cis-aconitate (CAA), and tends to synthesize TAA. It can be used in the field of microbial and enzyme-catalyzed biosynthesis of TAA. It has the advantages of mild reaction conditions and a wide adaptability to temperature and pH. It provides a feasible biochemical synthesis pathway for efficient, green, environmentally friendly and large-scale production of TAA, and has good application value.

[0017] 2. The aconitate isomerase TarA provided by the present invention can promote microorganisms to utilize TAA carbon sources to maintain their growth and reproduction. By expressing this protein in heterologous microorganisms, it is beneficial to enhance their ability to synthesize, accumulate and assimilate TAA, thereby improving the soil colonization ability and stress resistance of microorganisms, providing new ideas for the development of more efficient and stable probiotic fertilizers.

[0018] 3. TAA has good nematicidal activity. By expressing the aconitate isomerase TarA of the present invention in plants, microorganisms, etc., it is beneficial to increase the TAA content in the host cells, enhance the host organism's ability to resist nematodes and nematicidal activity, and has certain application potential in the field of biological nematode control. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the following briefly introduces the drawings used in describing the embodiments.

[0020] Figure 1 This is an SDS-PAGE gel electrophoresis diagram of the TarA protein purified in Example 1 of the present invention;

[0021] Figure 2 This is a graph showing the relative enzyme activity of aconitate isomerase TarA at different pH values in Example 2 of the present invention;

[0022] Figure 3 This is a bar graph of the relative enzyme activity of aconitate isomerase TarA under different metal ions in Example 2 of the present invention;

[0023] Figure 4 This is a graph showing the relative enzyme activity of aconitate isomerase TarA at different magnesium ion concentrations in Example 2 of the present invention;

[0024] Figure 5 This is a curve diagram of the relative enzyme activity of aconitate isomerase TarA at different NaCl concentrations in Example 2 of the present invention;

[0025] Figure 6 The enzymatic kinetic fitting curves of aconitate isomerase TarA under different substrates in Example 2 of the present invention are shown. From left to right, the substrates are cis-aconitate and trans-aconitate.

[0026] Figure 7 Graphs showing the colonization ability of the wild-type Bacillus velezensis strain FZB42 and the mutant strain ΔtarA in the separate colonization experiment of Example 3 of the present invention, wherein Figures AB are the growth curves in soil environments without TAA and with TAA carbon source, respectively;

[0027] Figure 8 These are colonization ability test graphs of the wild strain FZB42 and mutant strain ΔtarA of Bacillus velezensis in the mixed colonization experiment of Example 3 of the present invention, wherein Figures AB are growth curves in soil environments with and without TAA carbon sources, respectively, and Figure C is the ratio of the biomass of the wild strain FZB42 and the mutant strain ΔtarA. DETAILED DESCRIPTION

[0028] In order to make the purpose, technical solutions and advantages of the present invention more clearly understood, the present invention is further described in detail below with reference to the embodiments. The embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0029] Given the information contained herein, it will be readily apparent to those skilled in the art that various modifications may be made to the precise description of the present invention without departing from the spirit and scope of the appended claims. It should be understood that the scope of the present invention is not limited to the processes, properties, or components defined herein, as these embodiments and other descriptions are intended only to illustrate specific aspects of the present invention. Indeed, various modifications to the embodiments of the present invention that are apparent to those skilled in the art or related fields are intended to be within the scope of the appended claims.

[0030] For a better understanding of the present invention and not to limit the scope of the present invention, all numbers used in the present invention to express amounts, percentages and other numerical values should be understood as modified by the word "approximately" in all cases. The term "approximately" has its usual meaning, used to indicate that a value includes the inherent variation of the error of the device or method used to determine the value, or includes a value close to the value, for example, within 10% of the value (or range of values). Therefore, unless otherwise indicated, the numerical parameters listed in the specification and the appended claims are approximate values, which may vary depending on the different ideal properties sought to be obtained.

[0031] In addition, it should be noted that the terms "including," "comprising," "containing," "having," and similar expressions are non-restrictive, meaning that other steps and other components that do not affect the result may be added. The term "and / or" should be considered as a specific disclosure of each of the two specified features or components with or without the other. For example, "A and / or B" will be considered to include the following situations: (i) A, (ii) B, and (iii) A and B.

[0032] In order to make the above-mentioned objects, features and advantages of the present invention more obvious and easy to understand, specific embodiments of the present invention are described in detail below with reference to the accompanying drawings.

[0033] Trans-aconitic acid (TAA) is a small molecule widely distributed in nature with diverse biological activities. Plants and microorganisms also produce and accumulate this cellular metabolite. However, few genes related to TAA biosynthesis have been reported. The first aconitate isomerase gene (TbrA) was discovered in Bacillus thuringiensis in recent years. The protein it encodes catalyzes the isomerization of cis-aconitate to trans-aconitate and has been used in TAA biosynthesis. However, this enzyme suffers from low activity and poor reaction efficiency.

[0034] This study used Bacillus velezensis FZB42, which can efficiently assimilate and utilize trans-aconitic acid (TAA), as the research object. A gene encoding aconitate isomerase was isolated from its genome and named tarA (TAA assimilation-related gene A). The protein it encoded was named TarA. The tarA gene from Bacillus velezensis was heterologously expressed in Escherichia coli and the TarA protein was obtained by affinity purification. The enzymatic properties of the TarA protein were then investigated to explore the effects of pH and ionic strength on the enzyme activity of the enzyme catalyzed reaction, and its kinetic parameters were determined. The results showed that the optimal pH and Mg content of the TarA protein were closely related to the activity of the enzyme. 2+ The ionic strength and NaCl concentration were pH 6.5, 20 mM and 10 mM, respectively. Under the optimal conditions, the enzymatic kinetic parameter of the isomerization forward reaction of CAA to TAA was K m =27.08mM, v max =32.2μM / s, k cat =79.03s -1 and k cat / K m =2.92s -1 mM -1 , and the enzymatic reaction kinetic parameter K for the isomerization reverse reaction of CAA with TAA as substrate is m =171.45mM, v max =48.2μM / s, k cat =59.17s -1 and k cat / K m =0.345s -1 mM -1 The above results confirm that the aconitate isomerase TarA of the present invention can exhibit high activity under mild physical and chemical conditions and is more inclined to synthesize TAA, which provides an early reference for understanding the process of bacterial assimilation of TAA from the perspective of protein function, and also provides a theoretical basis for the application of aconitate isomerase in the biosynthesis of TAA.

[0035] Trans-aconitic acid (TAA) is a widely existing plant carbon source that can be utilized by microorganisms, and its metabolic pathway plays an important role in the colonization of probiotics. The present invention found in the study that Bacillus velezini FZB42 can use TAA as the sole carbon source to maintain its growth and reproduction. Therefore, the present invention further explored the effect of the tarA gene on the growth of Bacillus velezini in soil habitats at the molecular level. By comparing the ability of the wild strain FZB42 and the tarA gene deletion mutant ΔtarA to colonize alone and in mixed colonization in soils containing TAA and those not containing TAA, it was found that whether it was colonized alone or in mixed colonization, when there was no TAA carbon source, there was no significant difference in the growth of the FZB42 strain and the ΔtarA strain; on the contrary, when there was a TAA carbon source, the FZB42 strain had a more significant growth advantage than the ΔtarA strain, and the maximum biomass of the two differed by 4.5 times. The present invention confirms that the presence of the tarA gene can endow bacteria with the ecological function of obtaining more energy and enhancing growth competitive advantage in a TAA carbon source environment, providing technical support for improving the soil colonization ability of probiotics and developing more efficient biofertilizers.

[0036] Based on this, one embodiment of the present invention provides an aconitate isomerase TarA, the amino acid sequence of the aconitate isomerase TarA is shown in SEQ ID NO.1.

[0037] Another embodiment of the present invention provides a gene encoding the aconitate isomerase TarA as described above.

[0038] Specifically, the nucleotide sequence of the gene is shown in SEQ ID NO.2.

[0039] The aconitate isomerase TarA provided by the present invention has high catalytic activity and catalytic efficiency. Compared with the aconitate isomerase TbrA of Bacillus thuringiensis that has been isolated and identified, the maximum enzymatic reaction rate of the TarA-mediated conversion of CAA to TAA is v max , catalytic constant k cat and catalytic efficiency k cat / K m The results show that the aconitate isomerase TarA of the present invention is significantly improved, with advantages such as higher enzyme catalytic efficiency and better catalytic activity, and has good application advantages in the field of TAA biosynthesis. Specifically, the aconitate isomerase TarA encoding gene of the present invention can be expressed in a heterologous microorganism to promote the conversion of CAA to TAA through microbial fermentation, thereby enhancing the accumulation of TAA in cells, or the aconitate isomerase TarA of the present invention can be directly used to synthesize TAA through enzymatic catalysis in vitro. The present invention provides a feasible biochemical synthesis pathway for the efficient, green, environmentally friendly, and large-scale production of trans-aconitate, and has good application value.

[0040] Therefore, another embodiment of the present invention provides the use of the aconitate isomerase TarA or its encoding gene as described above in the biosynthesis of trans-aconitate.

[0041] In a preferred embodiment, the biosynthesis of trans-aconitate comprises the following steps: adding cis-aconitate and the aconitate isomerase TarA described above to a buffer solution, and reacting at pH 6.5-10.0, preferably at pH 6.5.

[0042] The enzymatic reaction of aconitate isomerase TarA can be carried out at room temperature, which varies according to the seasonal ambient temperature and is not particularly limited in the present invention. Generally, TarA protein has good enzymatic activity within 20-40°C, preferably 25-37°C.

[0043] Preferably, the buffer comprises 10-50 mM Mg 2+ and 10-200mM NaCl. The aforementioned metal ions have a promoting effect on enzyme activity. The salt solution containing metal ions can be chloride, sulfate, nitrate or acetate. More preferably, the buffer solution includes 20mM Mg 2+ and 10 mM NaCl.

[0044] As is well known, the stronger the ability of microorganisms to utilize carbon sources in the environment, the more conducive it is to the colonization of microorganisms in the natural environment. The present invention analyzes the impact of the aconitate isomerase TarA encoding gene tarA on the colonization of Bacillus velez using the TAA carbon source in nature. The results show that the presence of the tarA gene is conducive to its obtaining more energy by assimilation of TAA, which plays a very important role in occupying the soil niche for Bacillus velez. Therefore, the aconitate isomerase TarA of the present invention or its encoding gene can be applied to other bacterial strains by using genetic engineering means. By expressing the TarA protein of the present invention in probiotics, it is conducive to enhancing its ability to synthesize, accumulate and assimilate TAA, thereby improving the soil colonization ability and stress resistance survival ability of probiotics, and providing a new idea for developing more efficient and stable probiotic fertilizers.

[0045] Therefore, another embodiment of the present invention provides the use of the aconitate isomerase TarA or its encoding gene as described above in promoting the colonization ability of microorganisms in soil.

[0046] Optionally, the above-mentioned microorganisms or probiotics are preferably bacteria, such as Bacillus Velezii.

[0047] Existing studies have shown that TAA has good nematicidal activity, and the endogenous TAA content of plants is proportional to the plant's resistance to nematodes. By expressing the aconitate isomerase of the present invention in plants, microorganisms, etc., increasing their intracellular TAA content, it is beneficial to enhance the host organism's ability to resist nematodes and nematicidal activity, and has certain application potential in the field of biological nematode control.

[0048] Therefore, the embodiments of the present invention also provide the use of the aconitate isomerase TarA or its encoding gene in biological control of nematodes. Specifically, the aconitate isomerase TarA enhances the nematode-killing ability of organisms by promoting the accumulation of TAA in biological cells.

[0049] The present invention is further described below with reference to specific examples. Experimental methods in the following examples where specific conditions are not specified are generally performed under conventional conditions, such as those described in the Molecular Cloning Laboratory Manual (4th Edition) published by Cold Spring Harbor Laboratory, or conditions recommended by manufacturers.

[0050] Reagents: Molecular biology enzyme reagents were purchased from Takara Biotechnology Co., Ltd. TAA standards were purchased from TCI (Shanghai). CAA standards were purchased from Sigma-Aldrich. A bacterial genomic DNA extraction kit (spin column type) was purchased from Tiangen Biochemical Technology Co., Ltd. DNA gel excision recovery kit, plasmid miniprep kit, and PCR clean-up kit were purchased from Beijing Biotech Biotechnology Co., Ltd. Protein concentration assay kit was purchased from Nanjing Jiancheng Bioengineering Institute.

[0051] Main culture media: (1) LB medium: 10 g / L NaCl, 5 g / L yeast extract, and 10 g / L peptone, pH 7.0-7.5; (2) ACO medium: 7.5 g / L TAA, 2 g / L (NH4)2SO4, 1 g / L K2HPO4, 0.5 g / L MgSO4, and 0.1 g / L FeCl3·6H2O, pH 7.0. (3) SPI medium includes: 0.19% (NH4)2SO4, 1.36% K2HPO4·3H2O, 0.58% KH2PO4, 0.10% Trisodium citrate dihydrate, 202 μL 5% MgSO4·7H2O, 202 μL 50% glucose, and 202 μL 1% CAYE. (4) SPII Medium consists of: 19.60 mL SPI, 200 μL 50 mM CaCl₂, and 200 μL 250 mM MgCl₂. The final concentrations of CaCl₂ in the medium are 0.5 mM and 2.5 mM, respectively. Percentages are by weight to volume (w / v) unless otherwise specified. For solid medium, add 1.6%-1.8% agar powder.

[0052] Example 1 Expression and purification of TarA protein

[0053] The amino acid sequence of the TarA protein and the nucleotide sequence of the tarA gene are shown in Table 1 .

[0054] Table 1 TarA protein and tarA gene sequence information of the present invention

[0055]

[0056] 1.1. Construction of TarA protein expression vector pET32a-TarA and host bacterial transformation

[0057] Genomic DNA was extracted from Bacillus velezensis (B. velezensis) FZB42 using a bacterial genomic DNA extraction kit. The FZB42 genome (genomic sequence, see NCBI accession number NC_009725.2) was used as a template and PCR amplified using the tarA-F and tarA-R primer pairs to obtain the target gene expressing the TarA protein. NcoI and XhoI restriction sites were introduced at both ends of the gene, respectively. The nucleotide sequences of tarA-F and tarA-R are shown below:

[0058] tarA-F: TGCACCATGGAAAAAGTTCCTGTAACCG (see SEQ ID NO. 3);

[0059] tarA-R: GCCTCGAGACCAATGTGATTCAGCGTATT (see SEQ ID NO. 4).

[0060] The PCR system was as follows: 1 μL DNA template, 2 μL each of upstream and downstream primers, 1 μL high-fidelity PCR polymerase, 20 μL 5× buffer, 2 μL dNTPs, and ddH₂O added to 100 μL. The PCR program was as follows: 94°C initial denaturation for 5 min, 94°C denaturation for 30 s, 50°C annealing for 40 s, and 72°C extension for 1 min, for 30 cycles. The PCR product was subjected to agarose gel electrophoresis and the heterologously expressed TarA protein fragment was recovered from the gel.

[0061] The target fragment and the pET32a vector were then double-digested with NcoI and XhoI, respectively. After double digestion, the double-digestion products were recovered using a rapid agarose gel DNA recovery kit and then analyzed by electrophoresis. The digestion products were then ligated using T4 DNA ligase, and the ligation product was named pET32a-TarA.

[0062] The ligation product pET32a-TarA was transformed into Escherichia coli Rostta (DE3) by heat shock transformation, cultured at 37°C, 200 rpm for 1 h, and then centrifuged at 6000 rpm for 1 min. 100 μL of the supernatant was taken and the resuspended bacteria were spread on LB solid plates containing chloramphenicol (34 μg / mL) and ampicillin (100 μg / mL), and cultured overnight at 37°C. The transformants were verified by colony PCR, and the positive transformants verified by colony PCR were sent to Beijing Qingke Xinye Biotechnology Co., Ltd. for gene sequencing to check for mutations. TarA recombinant expression strains without mutations and correctly expressing TarA protein were selected.

[0063] 1.2. TarA protein induction expression

[0064] The TarA recombinant expression strain was inoculated into LB medium and cultured overnight at 37°C and 200 rpm for activation. The activated bacterial solution was transferred to new LB medium and cultured at 37°C and 200 rpm until OD 600=0.8, isopropyl-β-d-thiogalactopyranoside (IPTG) was added to a final concentration of 0.2 mM, and the cells were induced at 16°C, 200 rpm for 20 h. The induced bacterial solution was centrifuged at 4°C, 12,000 rpm for 5 min to collect the cells, and then 30 mL of Binding Buffer (comprising 20 mM Tris-HCl, 0.5 M NaCl, and 5 mM imidazole, pH 8.0) was added to resuspend the cells. The cells were disrupted by ultrasonication (disruption time: 30 min, 1 s on, 1.5 s off), and then centrifuged at 4°C, 12,000 rpm for 10 min to obtain the supernatant, which was used for subsequent TarA protein purification experiments.

[0065] 1.3. TarA protein affinity purification

[0066] Ni-NTA affinity purification was performed. The Ni column was washed with deionized H2O (to remove ethanol), and 10× column volumes of Charge Buffer (50mM NiSO4) and 10× column volumes of deionized H2O were added for charging and washing, respectively. Finally, 10× column volumes of Binding Buffer (20mM Tris-HCl, 0.5M NaCl, 5mM imidazole, pH 8.0) were added to equilibrate the Ni column. The supernatant was added to the Ni column and incubated for 5-10 minutes to allow the target protein to bind to the Ni column. 2+ After sufficient binding, the column was washed with 20× column volumes of Wash Buffer (20 mM Tris-HCl, 0.5 M NaCl, 60 mM imidazole, pH 8.0) until no impurity proteins were detected, and then eluted with Elution Buffer (20 mM Tris-HCl, 0.5 M NaCl, 500 mM imidazole, pH 8.0). The eluate was collected to obtain TarA protein.

[0067] The TarA protein eluate was placed in a dialysis bag and dialyzed twice in 1 L of protein dialysis solution (20 mM Tris-HCl, 10% (w / v) glycerol, 1 mM EDTA, 0.1 mM DTT) in an ice bath for 3 h each time. After dialysis, the protein was aliquoted into 1.5 mL centrifuge tubes and stored at -80°C.

[0068] The TarA protein purified by Ni column was analyzed by SDS-PAGE gel electrophoresis. Figure 1 As shown, lane M represents protein marker, and lane TarA represents purified TarA protein. 2+ The TarA protein obtained by column purification has high purity and can be used for subsequent enzymatic property research experiments.

[0069] Example 2 TarA enzyme catalyzed reaction conditions and kinetic characteristics

[0070] Generally, aconitate isomerase can catalyze the forward (from CAA to TAA) and reverse (from TAA to CAA) isomerization reactions. In this example, unless otherwise specified, the reverse reaction of CAA biosynthesis was selected to determine the optimal conditions for TarA catalysis. The enzyme catalytic reaction system includes: 100 μM substrate TAA, 100 mM 2-morpholinoethanesulfonic acid (MES) buffer (pH 6.5), 20 mM MgCl2 2+ , 10 mM NaCl and 1 μM TarA in a total volume of 100 μL.

[0071] The reaction was carried out in a 37°C water bath for 0.5 h. After the reaction was completed, 4 μL of 6 M HCl was added to terminate the reaction. The sample was filtered with a 0.22 μm filter and then subjected to HPLC detection. HPLC detection conditions: The liquid chromatography model was UltiMate 3000; an Agilent 5TC-C18 (2) analytical column (4.6 mm × 250 mm, 5 μm) was used. The mobile phase was 89.9% (v / v) ddH2O + 10% (v / v) methanol + 0.1% (v / v) formic acid; the HPLC-UV parameters were set as follows: column oven 25°C, injection volume 10 μL, flow rate 1 mL / min, detection wavelength 260 nm, and analysis time 10 min.

[0072] 2.1 Effect of pH on the catalytic activity of TarA enzyme

[0073] 0.5 M 2-morpholinoethanesulfonic acid (MES) buffer (pH 5.5, 6.0, 6.5), 0.5 M 4-hydroxyethylpiperazineethanesulfonic acid (HEPES) buffer (pH 7.0, 7.5, 8.0), and 0.5 M 2-cyclohexylaminoethanesulfonic acid (CHES) buffer (pH 8.5, 9.0, 9.5, 10.0) were prepared respectively, and 10 pH gradients were set. Each reaction group had a control group (self-reaction control, without TarA protein) and three experimental groups. The reaction was carried out at 37°C for 0.5 h. The control group was used to subtract the background value of the non-enzyme-catalyzed reaction to ensure that the CAA product detected in the reaction system was produced by enzyme catalysis.

[0074] Figure 2 The effect of pH on the catalytic activity of the TarA protein is shown, with temperature plotted on the horizontal axis and relative enzyme activity plotted on the vertical axis, with pH 6.5 considered 100% enzyme activity. The figure shows that the enzyme activity reaches its maximum at pH 6.5, then gradually decreases. It exhibits good tolerance to alkaline pH, with relatively high activity between pH 6.5 and 10.0, and an optimal reaction pH of 6.5.

[0075] 2.2 Effects of metal ions on the catalytic activity of TarA enzyme

[0076] Prepare 10mM Mg 2+ 、10mM Mn 2+ 、10mM Ca 2+ 、10mM Zn 2+ 、10mM Fe 2+ 、10mM Cu 2+ Six groups of chloride salt solutions containing different ions were prepared, and one experimental group without any metal ions was set up. Each reaction group was set up with a control group (self-reaction control, without TarA protein) and three experimental groups, and the reaction was carried out at 37°C for 0.5h.

[0077] TarA protein was treated with different metal ions at the same concentration. Figure 3 It can be seen that (with 10mM Mg 2+ 100% enzyme activity), Mg 2+ The most significant effect on promoting enzyme activity is Ca 2+ , and Cu 2+ 、Zn 2+ Has a significant inhibitory effect, so Mg 2+ The best metal ion.

[0078] Further detection of Mg 2+ Effect of ion concentrations of 0-100 mM on TarA enzyme activity, determination of Mg 2+ The optimal concentration is as follows Figure 4 As shown, 20 mM Mg 2+ The enzyme activity is 100%. It can be seen that the enzyme activity is relatively high at 10-50mM. 2+ The enzyme activity reached the highest when the concentration reached 20 mM.

[0079] 2.3 Effect of ionic strength on TarA protein activity

[0080] NaCl solutions with concentrations of 0mM, 10mM, 20mM, 50mM, 100mM, 200mM, 300mM, 400mM, and 500mM were prepared respectively. A total of 36 samples were subjected to 9 groups of reactions. Each group of reactions had a control group (self-reaction control, not containing TarA protein) and three experimental groups, and the reactions were carried out at 37°C for 0.5h.

[0081] Figure 5The figure shows the effect of NaCl concentration on the catalytic activity of TarA protein. It can be seen that the enzyme activity reaches the maximum when the NaCl ion concentration is 20mM. When it exceeds 20mM, the enzyme activity weakens with the increase of ionic strength. The ionic strength within the appropriate range (10-200mM) is conducive to the TarA catalytic reaction.

[0082] 2.4 Kinetic parameter K m 、v max 、k cat Value determination

[0083] At 37°C, pH 6.5, 20 mM Mg 2+ The product formation rate of TarA protein at different substrate concentrations (1-500 mM) was measured by changing the concentrations of TAA and CAA in MES buffer containing 10 mM NaCl, and the K was calculated by double reciprocal plotting. m and maximum reaction speed v max , k is calculated based on the enzyme concentration cat , and finally calculate k cat With K m The ratio of , thus knowing the catalytic efficiency of TarA enzyme for the two substrates. Figure 6 It can be seen that the forward and reverse reactions mediated by aconitate isomerase are well distributed in a linear relationship. The kinetic parameters with cis-aconitate (CAA) and trans-aconitate (TAA) as substrates are shown in Table 2.

[0084] Table 2 Kinetic parameters of TarA protein catalysis with CAA and TAA as substrates

[0085]

[0086] According to the above results, the enzymatic parameter K of the forward reaction of the aconitate isomerase catalyzed by the present invention with CAA as substrate is m =27.08mM, v max =32.2 μM·s -1 , k cat =79.03s -1 , k cat / K m =2.92s -1 mM -1 , and the enzymatic parameter for the reverse isomerization reaction with TAA as substrate is K m =171.45mM, v max =48.2μM·s -1 , k cat =59.17s -1 , k cat / K m =0.345s-1 mM -1 , indicating that aconitate isomerase protein TarA is more inclined to synthesize TAA. And compared with the isolated TbrA protein, its positive reaction K of isomerizing CAA to TAA is m 、v max 、k cat 、k cat / K m The values were 6.25mM and 1.39μM·s -1 , 4.08s -1 , 0.65s -1 mM -1 The newly obtained isomerase protein TarA of the present invention has higher catalytic activity and enzyme catalytic efficiency.

[0087] Example 3 Analysis of the ability of the tarA gene to promote soil colonization of Bacillus velezensis

[0088] From the above results, it can be seen that aconitate isomerase mediates the mutual conversion between CAA and TAA, so it can isomerize trans-aconitate to cis-aconitate, which enters the cellular energy metabolism pathway as an intermediate metabolite of the tricarboxylic acid cycle. Therefore, this example aims to explore the effect of the tarA gene on the growth of Bacillus velezensis in soil habitats, and whether it can use trans-aconitate as a carbon source to promote the soil colonization ability of Bacillus velezensis, giving it a growth advantage in the natural environment.

[0089] 3.1 Construction of the tarA gene deletion mutant of Bacillus velezinis ΔtarA

[0090] Using the genome of Bacillus velezensis FZB42 and the chloramphenicol resistance gene (artificially synthesized based on the chloramphenicol resistance gene information on the cloning vector pAgR-gCBE4, the GenBank accession number of the cloning vector is MW344269.1) as templates, PCR technology was used to obtain the tarA gene upstream homology arm fragment, the tarA gene downstream homology arm fragment and the chloramphenicol resistance gene fragment, respectively.

[0091] The two primers for the upstream homology arm of the tarA gene are tarA-UF and tarA-UR, and the nucleotide sequences are as follows:

[0092] tarA-UF:TATGGATCCGTCCTCACTGTTGATTTCAG (see SEQ ID NO.5);

[0093] tarA-UR: TCAATTTTATTAAAGTTCATGCTGTCTCATCCTTACATCA (see SEQ ID NO. 6).

[0094] The two primers for the downstream homology arm of the tarA gene are tarA-DF and tarA-DR, and their nucleotide sequences are shown below:

[0095] tarA-DF: CTAATGACTGGCTTTTAATACCAGTCTTCAGACAAGTC (see SEQ ID NO.7);

[0096] tarA-DR: GCCGAGCTCGCTGGTTCAGGCAGTTCACC (see SEQ ID NO. 8).

[0097] The two primers for amplifying the chloramphenicol resistance gene fragment are Cm-F and Cm-R, and the nucleotide sequences are shown below:

[0098] Cm-F: TGATGTAAGGATGAGACAGCATGAACTTTAATAAAATTGA (see SEQ ID NO. 9);

[0099] Cm-R: GACTTGTCTGAAGACTGGTATTATAAAAGCCAGTCATTAG (see SEQ ID NO. 10).

[0100] The PCR system consisted of 1 μL of DNA template, 2 μL each of upstream and downstream primers, 1 μL of high-fidelity PCR polymerase, 20 μL of 5× buffer, 2 μL of dNTPs, and ddH₂O to 100 μL. The PCR protocol was as follows: 94°C initial denaturation for 5 min, 94°C denaturation for 30 s, 50°C annealing for 40 s, and 72°C extension for 1 min, for 30 cycles. The PCR products were subjected to agarose gel electrophoresis, and the target bands were recovered by gel electrophoresis to obtain the upstream homology arm tarA-U, the downstream homology arm tarA-D, and the chloramphenicol resistance gene fragment Cm.

[0101] Cross-over PCR was used to fuse the upstream homology arm fragment tarA-U of the tarA gene with the chloramphenicol resistance gene fragment Cm to generate the tarA-U-Cm fragment. The PCR system was as follows: 0.5 μL of the upstream homology arm fragment tarA-U, 0.5 μL of the chloramphenicol resistance gene fragment Cm, 2 μL of primers tarA-UF, 2 μL of primers Cm-R, 1 μL of high-fidelity PCR polymerase, 20 μL of 5× buffer, 2 μL of dNTPs, and ddH2O to 100 μL. The PCR program was as follows: 94°C initial denaturation for 5 min, 94°C denaturation for 30 s, 50°C annealing for 40 s, and 72°C extension for 1.5 min, for 30 cycles. The PCR product was subjected to agarose gel electrophoresis and purified to obtain the tarA-U-Cm fusion fragment.

[0102] Next, the tarA-U-Cm fragment was fused to the downstream homology arm of the tarA gene, tarA-D, using cross-over PCR to generate the tarA-U-Cm-tarA-D fragment. The PCR system consisted of: 0.5 μL of the tarA-U-Cm fragment, 0.5 μL of the downstream homology arm of the tarA gene, 2 μL of primers tarA-UF and 2 μL of primers tarA-DR, 1 μL of high-fidelity PCR polymerase, 20 μL of 5× buffer, 2 μL of dNTPs, and ddH2O to 100 μL. The PCR program was as follows: 94°C initial denaturation for 5 min, 94°C denaturation for 30 s, 50°C annealing for 40 s, and 72°C extension for 2.5 min, for 30 cycles. The PCR product was subjected to agarose gel electrophoresis and purified to obtain the tarA-U-Cm-tarA-D fusion fragment.

[0103] The tarA-U-Cm-tarA-D fusion fragment was ligated into a T-vector using TA cloning. After sequencing confirmed the successful construction of the vector, it was digested with BamHI to obtain a linearized recombinant plasmid. This linearized recombinant plasmid was then transformed into Bacillus velezensis FZB42.

[0104] Use an inoculation loop to inoculate Bacillus velezensis FZB42 into 20 mL LB liquid medium, shake and culture at 200 rpm and 37 ° C overnight; take 500 μL of overnight culture solution and inoculate it into 20 mL SPI medium, culture at 200 rpm and 37 ° C. 600When the p-value reaches 1.4-1.5, inoculate 2.5 mL of culture medium into 20 mL of SPII medium and incubate at 37°C, 100 rpm, with shaking for 1.5 hours. Add 250 μL of 10 mM EGTA (pH 8.0) solution and continue incubating at 37°C, 100 rpm for 10 minutes. Aliquot into 1.5 mL centrifuge tubes, each containing 500 μL. Add 15 μL of the linearized recombinant plasmid to each tube, mix thoroughly, and incubate at 37°C, 100 rpm, for 50 minutes. Add 800 μL of LB medium to each tube and continue incubating at 37°C, 200 rpm, with shaking for 2 hours. Spread onto LB plates containing chloramphenicol and incubate at 37°C for 24 hours. The resulting transformants are the tarA gene deletion mutant ΔtarA.

[0105] 3.2 Analysis of soil colonization ability of the wild-type Bacillus velezensis strain FZB42 and the mutant strain ΔtarA

[0106] Experimental soil samples were collected from a vegetable plot at Hubei University of Technology in Xiaonan District, Xiaogan City, Hubei Province, at a depth of 5–10 cm. After collection, the samples were placed in sterile plastic bags and centrifuge tubes and stored at 4°C until further use. Soil physiological and biochemical parameters were as follows: pH 7.23 ± 0.03, organic matter content 17.90 ± 0.32 g / kg, total nitrogen content 1.15 ± 0.05 g / kg, total phosphorus content 0.81 ± 0.01 g / kg, total potassium content 11.98 ± 0.27 g / kg, available nitrogen content 88.65 ± 1.74 mg / kg, available phosphorus content 54.31 ± 1.14 mg / kg, and available potassium content 213.36 ± 5.19 mg / kg.

[0107] (1) Single colonization experiment

[0108] The soil sample was thoroughly crushed in a mortar and passed through a 40-mesh sieve. The crushed soil sample was then sterilized at 121°C for 1 hour in a high-pressure steam sterilizer. 20 g of sterile soil was weighed using an electronic balance and added to a sterile culture medium. 0.1 mg of TAA was added (the pH value was adjusted to 7.0 with NaOH) to ensure that the TAA concentration was 100 mg / kg. This was used as the experimental group, while the soil without TAA was used as the control group. FZB42 or ΔtarA was inoculated into LB culture medium at 37°C for 9 hours. After centrifugation, the bacteria were washed and resuspended with sterile water to control the cell density of the FZB42 and ΔtarA bacterial suspensions to be equal. 10 cells were inoculated into the experimental and control groups, respectively. 7cfu / g of FZB42 and ΔtarA strains. All soil components were thoroughly mixed and incubated at 25°C with a relative humidity of 40%. Every 1–5 days, 1 gram of soil sample was taken and shaken in 9 mL of sterile water at 25°C and 200 rpm for 20 minutes to separate bacterial cells from soil particles. The bacterial supernatant was serially diluted 10-fold, plated onto LB agar plates, incubated at 30°C, and counted.

[0109] (2) Mixed colonization experiment

[0110] The culture medium of FZB42 or ΔtarA strain was measured by turbidity, and the cell density was 10 7 cfu / mL, and the two culture solutions were mixed in equal amounts, and then the mixed bacteria were inoculated into 20g of sterile soil mixed with 100mg / kg TAA component (as the experimental group) and another 20g of sterile soil without TAA added (as the control group), and the two soils were controlled at 25°C and 40% relative humidity. The steps of soil sampling, gradient dilution and colony culture on LB medium are the same as above. The total colony count was determined by counting the colonies on the LB plate in the first round, and then the number of colonies with chloramphenicol resistance was verified and determined on the chloramphenicol resistance plate (5μg / mL), that is, the number of ΔtarA individuals. The number of FZB42 individuals is equal to the difference between the total population and the number of ΔtarA individuals.

[0111] Figure 7 Figure 1 shows the growth of the wild-type strain FZB42 and the mutant strain ΔtarA in separate colonization experiments. Panel A shows the growth of the strain FZB42 in a soil environment without TAA, while panel B shows the growth of the strain ΔtarA in a soil environment with TAA. The results show that when TAA was not added to the soil, the growth curves of the strain FZB42 and the strain ΔtarA were essentially identical. However, when TAA was added, the strain FZB42 produced a greater biomass, confirming that the tarA gene promotes the use of TAA as a carbon source in B. velezensis, giving it a growth advantage.

[0112] Figure 8Figure 2 shows the growth of wild-type strain FZB42 and the mutant strain ΔtarA in a mixed colonization experiment. Figure A shows a soil environment without TAA, Figure B shows a soil environment with TAA, and Figure C shows the ratio of FZB42 biomass to ΔtarA biomass. The test group represents the soil environment with TAA, and the control group represents the soil environment without TAA. The mixed colonization experiment showed the same conclusions as the individual colonization experiments. In the absence of TAA, the growth curves of the FZB42 and ΔtarA strains were essentially identical; however, in the presence of TAA, the FZB42 strain grew more rapidly. This confirms that the tarA gene promotes Bacillus velezensis to utilize TAA as a carbon source to sustain its growth. The biomass was significantly higher than that of the tarA gene-deficient mutant ΔtarA, giving it a growth advantage. This confirms that the tarA gene confers the ability of Bacillus velezensis to utilize TAA as a carbon source in nature, thereby obtaining more energy, promoting its colonization in soil environments, and enhancing its adaptability and stress resistance in habitats containing TAA carbon sources.

[0113] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. Use of aconitate isomerase TarA or its encoding gene in the biosynthesis of trans-aconitate, characterized in that: The amino acid sequence of the aconitate isomerase TarA is shown in SEQ ID NO.1, or the nucleotide sequence of the gene encoding the aconitate isomerase TarA is shown in SEQ ID NO.2; Wherein, the biosynthesis of trans-aconitic acid comprises the following steps: Cis-aconitate and aconitate isomerase TarA are added to a buffer solution and reacted at pH 6.5-10.

0.

2. The use of aconitate isomerase TarA or its encoding gene in biosynthesis of trans-aconitate according to claim 1, characterized in that: The buffer contains 10-50 mM Mg 2+ and 10-200 mM NaCl.

3. Use of aconitate isomerase TarA or its encoding gene in biosynthesis of trans-aconitate according to claim 2, characterized in that: The buffer included 20 mM Mg 2+ and 10 mM NaCl at 37°C, pH 6.5.

Images