SgRNA sequence for targeting knock-out of capsular gene cluster of klebsiella pneumoniae and application thereof

Abstract

This invention discloses an sgRNA sequence for targeted knockout of the Klebsiella pneumoniae capsular gene cluster and its application. The sgRNA sequence for targeted knockout of the Klebsiella pneumoniae capsular gene cluster includes cps-sgRNA-F as shown in SEQ ID NO.1 and cps-sgRNA-R as shown in SEQ ID NO.2. The sgRNA sequence for targeted knockout of the KL47 capsular gene cluster provided by this invention can specifically target the capsular gene cluster. When constructed into a CRISPR / Cas9 vector system and combined with the λRed homologous recombination system, it can specifically target and knock out the Klebsiella pneumoniae capsular gene cluster, obtaining strains with the capsular gene cluster knocked out. This is beneficial for elucidating important pathogenic factors of Klebsiella pneumoniae and demonstrating the specific function of the KL47 capsular type. The CRISPR / Cas9 system for targeted knockout of the KL47 capsular gene cluster of Klebsiella pneumoniae of this invention can effectively knock out the capsular gene cluster of strains, with high specificity, a simple method, and is easy to promote.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering, specifically relating to an sgRNA sequence for targeting and knocking out capsular gene clusters, a plasmid vector system for CRISPR / Cas9 and λRed, and their applications. Background Technology

[0002] In recent years, bacterial resistance in my country has become increasingly serious, with multidrug-resistant and even pan-drug-resistant bacteria gradually becoming a major cause of infection-related deaths. According to the CHINET China Antimicrobial Resistance Surveillance Results (January-December 2021), carbapenems, one of the frontline drugs for treating Klebsiella pneumoniae, have a resistance rate of approximately 25%. Carbapenem-resistant Klebsiella pneumoniae (CRKP) has a high morbidity and mortality rate, resulting in a heavy medical burden. Currently, ST11 is known to be the most prevalent medically relevant CRKP clone in China. This clone possesses a KL47 capsule, encoded by the KL47 capsule gene cluster. The capsule plays a crucial role in bacterial pathogenesis, but the specific function of the KL47 capsule in this CRKP clone still requires further understanding.

[0003] In 2000, researchers developed a method using the λ phage homologous recombination system to achieve recombination between exogenous linear double-stranded DNA and homologous sequences of chromosomal DNA in E. coli. In practice, the genes for three Red proteins (Gam, Exo, and Beta) are placed on an expression vector. Once the exogenous dsDNA is electroporated into the cell, there is a probability that homologous recombination will occur at the same genomic target sequence, replacing the gene to be knocked out.

[0004] The CRISPR-Cas system is an RNA-mediated adaptive immune system that provides sequence-specific protection against foreign DNA. When foreign DNA enters bacteria and attempts to invade their genome, the bacteria employ this defense mechanism to cut it off. Currently, the CRISPR / Cas system has been developed into a genome editing tool. Summary of the Invention

[0005] The purpose of this invention is to address the shortcomings of existing technologies by providing an sgRNA sequence for targeted knockout of the Klebsiella pneumoniae capsular gene cluster and its application.

[0006] An sgRNA sequence that targets and knocks out the capsular gene cluster of Klebsiella pneumoniae, comprising cps-sgRNA-F as shown in SEQ ID NO.1 and cps-sgRNA-R as shown in SEQ ID NO.2.

[0007] A plasmid vector system for targeting and knocking out capsular gene clusters using CRISPR / Cas9 and λRed, wherein the plasmid vector system is a recombinant expression plasmid vector containing the sgRNA sequence of the target capsular gene cluster, λRed, and CRISPR / Cas9 vector, and its sequence is SEQ ID NO.3.

[0008] A method for constructing a CRISPR / Cas9 and λRed plasmid vector system that targets and knocks out capsular gene clusters includes the following steps:

[0009] (1) The plasmid vector pCAS-RED was digested with BsaI to obtain the linear pCAS-RED vector after digestion;

[0010] (2) Anneal the cps-sgRNA-F and cps-sgRNA-R sequences of the sgRNA sequence of the target knockout capsule gene cluster as described above to obtain a double-stranded DNA sequence. The double-stranded DNA sequence is then ligated with the enzyme-digested pCAS-RED plasmid vector to obtain a recombinant expression plasmid vector of the sgRNA sequence of the target knockout capsule gene cluster.

[0011] The application of the CRISPR / Cas9 and λRed plasmid vector systems is used to target and knock out the KL47 capsular gene cluster of Klebsiella pneumoniae.

[0012] The beneficial effects of this invention are as follows:

[0013] The sgRNA sequence for knocking out the KL47 capsular gene cluster provided by this invention can specifically target the capsular gene cluster. When constructed into a CRISPR / Cas9 vector system and combined with the λRed homologous recombination system, it can specifically target and knock out the Klebsiella pneumoniae capsular gene cluster, thereby obtaining a strain with the capsular gene cluster knocked out. This is beneficial for elucidating important pathogenic factors of Klebsiella pneumoniae and demonstrating the specific function of the KL47 capsular type.

[0014] The CRISPR / Cas9 targeted knockout system for the KL47 capsular gene cluster of Klebsiella pneumoniae of this invention can effectively knock out the capsular gene cluster of the strain, with high specificity, simple method and easy to promote. Attached Figure Description

[0015] Figure 1 This is a plasmid map of the vector plasmid pCAS-RED used in the embodiments of the present invention.

[0016] Figure 2 This is a diagram showing the electrophoresis detection PCR results in an embodiment of the present invention.

[0017] Figure 3 This is the survival curve of mice after intraperitoneal bacterial infection in an embodiment of the present invention. Detailed Implementation

[0018] The present invention will become clearer from the following detailed description with reference to the accompanying drawings and preferred embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the scope of the invention.

[0019] The principle behind targeting and knocking out sgRNA sequences of capsular gene clusters is as follows:

[0020] The target sequence of the sgRNA on the KL47 capsular gene cluster conforms to the 5'-N(20)-NGG(PAM) sequence arrangement rule. The target sequence of the sgRNA on the capsular gene cluster is located in a conserved region of the gene, and the target site sequence of the sgRNA on the capsular gene cluster is shown in the sequence listing SEQ ID NO. 1.

[0021] A forward oligo is synthesized by adding a TAGT sequence to the 5' end of the target site sequence of sgRNA on the capsular gene cluster; a reverse oligo is synthesized by obtaining the complementary strand of the target site sequence of sgRNA on the capsular gene cluster and adding an AAAC sequence to the 5' end of the complementary strand.

[0022] The two complementary oligonucleotides synthesized were annealed and paired together to form a double-stranded sgRNA oligonucleotide that can be incorporated into a plasmid vector.

[0023] Annealed double-stranded sgRNA oligonucleotides were combined with linearized pCAS-RED vector carrying the Cas9 gene and Red genes (gam, exo, beta). Figure 1 The expression vector pCAS-RED-sgRNA plasmid carrying the corresponding target sequence sgRNA oligonucleotide was obtained by ligation, transformed into competent bacteria DH5α and inoculated onto hygromycin plates, single clones were picked and identified by sequencing, positive clones were identified, and the positive clones were shaken and plasmids were extracted.

[0024] The pCAS-RED-sgRNA plasmid, which simultaneously carries sgRNA, Cas9, and Red, and a repair template containing 500bp homologous arms linked at both ends of the capsular gene cluster, were transferred into the target bacteria. Hygromycin resistance selection was performed to select single clones. Genomic DNA was extracted, and the gene fragment containing the target sequence was amplified by PCR using the genomic DNA as a template. Whole-genome sequencing confirmed that the capsular gene cluster had been knocked out, and knockout bacteria were obtained. The specific preparation method is as follows:

[0025] S1: Prepare 10 solid plates containing 100 μg / mL of hygromycin for MHA.

[0026] S1.1: Weigh 7.6 g of Mueller-Hinton Agar (MHA) culture medium into 200 ml of distilled water, autoclave at 121°C for 20 minutes, and after autoclaving, place it in a 60°C water bath for later use.

[0027] S1.2: Accurately weigh 0.02 g of hygromycin into 1 ml of aqueous solution to obtain hygromycin solution.

[0028] S1.3: Add the hygromycin solution prepared in S1.2 to the 200ml MHA culture medium prepared in S1.1, mix well, and then pour it into sterile culture dishes with a diameter of 90mm, about 20ml per culture dish.

[0029] S1.4: Let stand at room temperature for 2 hours until the MHA medium solidifies, then air dry and store at 4°C for later use.

[0030] S2: Creating competent bacteria

[0031] S2.1: Target bacteria were inoculated by streaking in four zones on Columbia blood agar solid medium.

[0032] S2.2: Weigh 1.9g of Mueller-Hinton (MH) culture medium into 50ml of distilled water and autoclave at 121℃ for 20 minutes. After autoclaving, store in a 4℃ refrigerator until needed.

[0033] S2.3: Pick a single colony and place it in 5 ml of liquid culture medium. Amplify overnight at 220 rpm and 37°C. The next day, take 500 μL and add it to 50 ml of MH liquid culture medium. Amplify the bacteria at 220 rpm and 37°C for 2.5 h.

[0034] S2.4: Collect bacterial cells by centrifugation using a centrifuge. Set the centrifuge to 5000 rpm for 5 minutes.

[0035] S2.5: Rinse the bacteria with 15ml of pre-cooled double-distilled water (ddH2O) at 4℃ and resuspend the bacteria.

[0036] S2.6: Repeat step S2.5.

[0037] S2.7: Using the same centrifugation conditions as S2.4, centrifuge to collect bacterial cells, rinse the bacteria with 1 ml of 10% glycerol solution, and resuspend the bacteria.

[0038] S2.8: Repeat step S2.7.

[0039] S2.9: Dispense into 1.5ml EP tubes, 100μL per tube, and store at -80℃ until use.

[0040] S3: Constructing the pCAS-RED-sgRNA plasmid

[0041] S3.1: Synthesize the following two sgRNA sequences

[0042] (1) cps-sgRNA-F: TAGTGCACCGATATAGGTCACACA, SEQ ID NO.1;

[0043] (2) cps-sgRNA-R:AAACTGTGTGACCTATATCGGTGC, SEQ ID NO.2.

[0044] S3.2: Based on the synthesized concentration, dilute the two sequences to 100 μmol / L using ddH2O.

[0045] S3.3: Anneal the two sgRNA sequences to form a single double-stranded sgRNA under the following conditions.

[0046] (1) Add a, b, and c to a 0.2 ml PCR tube, heat at 95 °C for 3 minutes in a thermal cycler, and then cool the PCR tube to 25 °C at a rate of 0.5 °C / 10 s in a thermal cycler. The two sequences will automatically ligate into a double-stranded sgRNA.

[0047] a. 1 μl cps-sgRNA-F solution

[0048] b. 1 μl cps-sgRNA-R solution

[0049] c.8μl ddH2O.

[0050] (2) Place the annealed double-stranded sgRNA from (1) at 4°C for later use.

[0051] S3.4: The pCAS-RED plasmid was digested using the Bsal restriction enzyme, specifically as follows:

[0052] Prepare the following ad mixture and centrifuge at low speed (1000 rpm, 10 s) for 2 hours. Then incubate at 37°C for 2 hours. After the incubation, purify the plasmid vector using a DNA purification kit and store for later use.

[0053] a.1μl Bsal

[0054] b. 5μl 10×Cutsmart Buffer

[0055] c. 5 μl pCAS-RED (200 μg / ml)

[0056] d.39μl ddH2O.

[0057] S3.5: The digested pCAS-RED plasmid vector from S3.4 and the double-stranded sgRNA from S3.3 were ligated using T4 DNA ligase, specifically as follows:

[0058] Prepare the following ae system, mix it at low speed in a centrifuge (1000 rpm, 10 s), and then incubate it in a constant temperature water bath at 16℃ for 2 h to obtain the pCAS-RED-sgRNA plasmid (SEQ ID NO.3).

[0059] a. 0.5 μl T4 DNA ligase

[0060] b. 1 μl 10× ligase buffer

[0061] c. 2 μl linearized pCAS-RED (25 μg / ml)

[0062] d.1μl double-stranded sgRNA

[0063] e.5.5μl ddH2O.

[0064] S4: pCAS-RED-sgRNA plasmid was electroporated into Klebsiella pneumoniae.

[0065] S4.1: Prepared competent bacteria thawed on ice and stored at -80°C.

[0066] S4.2: Add 3 μL of the ligated pCAS-RED-sgRNA plasmid and mix gently. Note: Do not shake vigorously to mix the cells.

[0067] S4.3: Using a Bio-Rad electroporation instrument, the pCAS-RED-sgRNA plasmid was transferred into competent bacteria (condition: voltage 2500V).

[0068] S4.4: Quickly add 900 μL of SOC (super Optimal Broth) medium containing L-arabinose (pre-warmed at 37°C).

[0069] S4.5; incubate at 30℃ with shaking for 1 hour (200 rpm).

[0070] S4.6: Take an appropriate amount of 50 μL and spread it on an MHA solid plate medium containing 100 μg / mL of hygromycin.

[0071] S4.7: Incubate overnight at 37°C.

[0072] S5: PCR verification of the target gene knockout

[0073] S5.1: Select single colonies cultured on the MHA solid medium containing 100 micrograms / mL of hygromycin.

[0074] S5.2: PCR was used to amplify one gene, gnd, from the capsular gene cluster.

[0075] S5.3: After PCR, the PCR results are detected by agarose gel electrophoresis. Add gelred nucleic acid dye. If no band appears in the image, the PCR is negative.

[0076] S5.4: PCR-negative strains are knockout strains. Select a single colony and transfer it to a 30% (v / v) glycerol broth medium. Store at -80°C until use.

[0077] like Figure 2 The image shows the electrophoresis detection PCR results of this embodiment, where M is the marker, 1 is the original strain, and 2-7 are the knockout strains. The original strain showed a positive PCR amplification band on electrophoresis, while the knockout strains showed a negative band.

[0078] S6: Toxicity Verification

[0079] S6.1: Target bacteria were inoculated by streaking in four zones on Columbia blood agar solid medium.

[0080] S6.2: Pick a single colony from step S6.1 and add it to sterile physiological saline. Adjust the turbidity to 0.5 McFarland turbidity, dilute it 10 times, and inject 100 μL of the solution into female BA1B / c mice that are about 5 weeks old via intraperitoneal injection. Each group of bacteria contains 10 mice.

[0081] S6.3: After injection, mice were placed in a normal temperature environment and fed and watered normally. The mortality of mice was observed after 24 hours.

[0082] Figure 3 The lethality of the bacteria in mice before and after the bacterial strain was knocked out is presented. From Figure 3 The results showed that the knockout strain had a reduced mortality rate in mice, indicating that the knockout was successful.

[0083] It will be understood by those skilled in the art that the above descriptions are merely preferred examples of the invention and are not intended to limit the invention. Although the invention has been described in detail with reference to the foregoing examples, those skilled in the art can still modify the technical solutions described in the foregoing examples or make equivalent substitutions for some of the technical features. All modifications and equivalent substitutions made within the spirit and principles of the invention should be included within the scope of protection of the invention.

Claims

1. An sgRNA that targets and knocks out the capsular gene cluster of Klebsiella pneumoniae, characterized in that, Its sequences include cps-sgRNA-F as shown in SEQ ID NO.1 and cps-sgRNA-R as shown in SEQ ID NO.

2.

2. A CRISPR / Cas9 and λRed plasmid vector system for targeting and knocking out capsular gene clusters, characterized in that, The plasmid vector system is a recombinant expression plasmid vector of the sgRNA sequence, λRed and CRISPR / cas9 vector targeting the knockout of the capsule gene cluster as described in claim 1, and its sequence is: SEQ ID NO.

3.

3. A method for constructing a CRISPR / Cas9 and λRed plasmid vector system for targeting and knocking out capsular gene clusters, characterized in that, Includes the following steps: (1) The plasmid vector pCAS-RED was digested with BsaI to obtain the linear pCAS-RED vector after digestion; (2) Anneal the cps-sgRNA-F and cps-sgRNA-R sequences of the sgRNA sequence of the target knockout capsule gene cluster as described in claim 1 to obtain a double-stranded DNA sequence, and ligate the double-stranded DNA sequence with the enzyme-digested pCAS-RED plasmid vector to obtain a recombinant expression plasmid vector of the sgRNA sequence of the target knockout capsule gene cluster.

4. The application of the CRISPR / Cas9 and λRed plasmid vector system as described in claim 2 in the preparation of products targeting the knockout of capsular gene clusters, characterized in that, Used to target and knock out the KL47 capsular gene cluster of Klebsiella pneumoniae.

Images