DNA aptamer specifically recognizing natural crp and application thereof

DNA aptamers that specifically recognize natural CRP were screened through SELEX technology, which solved the problems of high cost and insufficient sensitivity of existing antibody methods, and achieved low-cost and efficient nCRP detection and purification, which has important biomedical application value.

CN119286868BActive Publication Date: 2025-10-10SOUTHERN UNIVERSITY OF SCIENCE AND TECHNOLOGY
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411309484.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-09-19
Publication Date
2025-10-10
Estimated Expiration
2044-09-19

AI Technical Summary

Technical Problem

The existing technology for detecting natural C-reactive protein (nCRP) mainly relies on high-cost and insensitive antibody methods, which cannot meet the needs of efficient and simple detection.

Method used

Provided are DNA aptamers that specifically recognize natural CRP. DNA sequences and their derivatives that can highly specifically bind to nCRP are screened using SELEX technology, including the nucleic acid sequences shown in SEQ ID NO: 1 and SEQ ID NO: 2 and their functional derivatives, and are modified to enhance stability and functionality.

Benefits of technology

It achieves efficient, low-cost, and non-immunogenic nCRP detection, purification, in vivo imaging, and drug delivery in complex biological samples, provides a new biological detection method, and improves the accuracy and sensitivity of detection.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119286868B_ABST
    Figure CN119286868B_ABST
Patent Text Reader

Abstract

The present application relates to the technical field of biomolecular engineering, and particularly relates to a DNA aptamer capable of specifically recognizing natural CRP and application, the DNA aptamer capable of specifically recognizing natural CRP contains at least one of the following sequences: (1) a nucleic acid sequence shown in SEQ ID NO:1 and a functional derivative thereof; (2) a nucleic acid sequence shown in SEQ ID NO:2 and a functional derivative thereof.The DNA aptamer provided by the present application can be highly specific to bind natural CRP in complex biological samples, thereby providing a new type of biological detection method; in addition, compared with the traditional antibody method, the DNA aptamer has the advantages of low cost, no immunogenicity, high in-vivo stability and the like, and is suitable for capturing nCRP in a complex system to realize accurate detection, purification, in-vivo imaging, diagnosis and drug delivery of nCRP.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of biomolecular engineering, and in particular to a DNA aptamer specifically recognizing natural CRP and its application. Background Art

[0002] Aptamers are a unique class of single-stranded oligonucleotides (DNA or RNA) that can specifically bind to target molecules (targets) through a specific three-dimensional conformation; the screening of aptamers is mainly achieved through the systematic evolution of ligands by exponential enrichment (SELEX) technology. Compared with traditional antibodies, aptamers have many advantages, such as simple screening process, chemical synthesis, easy modification, relatively low cost, good biocompatibility, and high long-term storage stability. The targets of aptamers are wide-ranging, including but not limited to metal ions, small molecules, peptides, proteins, etc., and can even be complete viral particles or cells. With these characteristics, aptamers have shown great application potential in target detection and purification, disease diagnosis, imaging, and drug delivery.

[0003] C-reactive protein (CRP) is an acute phase protein composed of five identical subunits covalently linked to form a disc-shaped pentameric structure. It is primarily synthesized in the liver. Plasma CRP concentrations can rapidly increase from a baseline level of approximately 1 μg / mL to over 1000-fold within 48 hours following inflammation or tissue damage. Due to its association with inflammation, CRP is often used as a biomarker for infection, tissue damage, and the progression of certain inflammatory diseases, particularly in the prediction and assessment of cardiovascular disease. Furthermore, CRP is not only a biomarker but also plays a role in the regulation of innate and adaptive immunity, implicated in the pathogenesis of inflammation-related diseases such as cardiovascular disease, autoimmune diseases, infection, tissue damage, and neurological disorders. After synthesis in the liver, CRP exists in the blood as a pentameric form, known as native CRP (nCRP). In the context of inflammation, nCRP can irreversibly dissociate into monomeric CRP (mCRP). Existing studies have demonstrated that the conversion of nCRP to mCRP is crucial for the regulation of CRP function, and this allosteric process plays a precise regulatory role in the inflammatory response. Currently, the detection of nCRP mainly relies on high-cost antibody methods, which are not sensitive or convenient enough.

[0004] Therefore, the existing technology still needs to be improved and developed. Summary of the Invention

[0005] In view of the deficiencies of the prior art, the present application aims to provide a DNA aptamer specifically recognizing natural CRP and application, aiming to solve the problems of high cost, insufficient sensitivity and inconvenience of the existing antibody method for detecting nCRP.

[0006] The technical scheme of the present application is as follows:

[0007] A DNA aptamer specifically recognizing natural CRP, the DNA aptamer containing at least one of the following sequences:

[0008] (1) the nucleic acid sequence shown in SEQ ID NO: 1 and its functional derivative;

[0009] (2) the nucleic acid sequence shown in SEQ ID NO: 2 and its functional derivative.

[0010] The DNA aptamer specifically recognizing natural CRP, wherein the functional derivative comprises at least one of the following:

[0011] The derivative obtained by modifying at least one base in the nucleic acid sequence shown in SEQ ID NO: 1;

[0012] The derivative obtained by modifying at least one base in the nucleic acid sequence shown in SEQ ID NO: 2;

[0013] The sequence having more than 60% homology with the nucleic acid sequence shown in SEQ ID NO: 1;

[0014] The sequence having more than 60% homology with the nucleic acid sequence shown in SEQ ID NO: 2;

[0015] The sequence capable of hybridizing with the nucleic acid sequence shown in SEQ ID NO: 1 under stringent conditions;

[0016] The sequence capable of hybridizing with the nucleic acid sequence shown in SEQ ID NO: 2 under stringent conditions;

[0017] The phosphorothioate backbone sequence derived from the nucleic acid sequence shown in SEQ ID NO: 1;

[0018] The phosphorothioate backbone sequence derived from the nucleic acid sequence shown in SEQ ID NO: 2;

[0019] The peptide nucleic acid transformed from the nucleic acid sequence shown in SEQ ID NO: 1;

[0020] The peptide nucleic acid transformed from the nucleic acid sequence shown in SEQ ID NO: 2;

[0021] The functional derivative maintains the specific recognition function of natural CRP.

[0022] The DNA aptamer that specifically recognizes natural CRP, wherein the modification includes one or more of phosphorylation, methylation, amination, sulfhydrylation, and isotope labeling.

[0023] The DNA aptamer that specifically recognizes natural CRP, wherein the functional group in the functional derivative is selected from at least one of a fluorescent group, a radioactive group, a therapeutic drug, biotin, digoxin, a nanoluminescent material, a nucleic acid substance, and an enzyme marker.

[0024] Application of a DNA aptamer that specifically recognizes natural CRP in detecting or purifying nCRP.

[0025] Application of a DNA aptamer that specifically recognizes natural CRP in the preparation of an in vivo imaging contrast agent for nCRP-related diseases.

[0026] The application of the DNA aptamer that specifically recognizes natural CRP, wherein the nCRP-related diseases include at least one of cardiovascular disease, autoimmune disease, infection, tissue damage, and nervous system disease.

[0027] A DNA aptamer that specifically recognizes natural CRP is used in the preparation of diagnostic or therapeutic drugs for nCRP-related diseases.

[0028] The application of the DNA aptamer that specifically recognizes natural CRP, wherein the nCRP-related diseases include at least one of cardiovascular disease, autoimmune disease, infection, tissue damage, and nervous system disease.

[0029] A product for identifying nCRP, comprising the DNA aptamer that specifically recognizes natural CRP.

[0030] Beneficial effects: The present invention provides a DNA aptamer and application that specifically recognizes natural CRP. The DNA aptamer that specifically recognizes natural CRP contains at least one of the following sequences: (1) the nucleic acid sequence shown in SEQ ID NO: 1 and its functional derivatives; (2) the nucleic acid sequence shown in SEQ ID NO: 2 and its functional derivatives. The DNA aptamer provided by the present invention can bind to natural CRP with high specificity in complex biological samples, thereby providing a new biological detection method; in addition, compared with traditional antibody methods, the use of DNA aptamers to identify natural CRP has the advantages of low cost, no immunogenicity, and high in vivo stability. It is suitable for capturing nCRP in complex systems to achieve accurate detection, purification, in vivo imaging, diagnosis and drug delivery of nCRP. Therefore, the DNA aptamer has important application value for the detection, purification, in vivo imaging, diagnosis and as a drug delivery system of nCRP. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 Schematic diagram of the SELEX screening process for DNA aptamers that specifically recognize nCRP in Example 1 of the present invention;

[0032] Figure 2 Schematic diagram of the predicted secondary structure of ApnCRP1 in Example 1;

[0033] Figure 3 Schematic diagram of the predicted secondary structure of ApnCRP2 in Example 1;

[0034] Figure 4 This is a comparison of the binding effects of the DNA library enriched by SELEX with nCRP and mCRP in Example 1;

[0035] Figure 5 3 is a comparison of the binding effects of nCRP and mCRP with the DNA library enriched by SELEX in Example 1;

[0036] Figure 6 This is a comparison of the binding effects of the specific DNA aptamers screened in Example 1 with nCRP and mCRP;

[0037] Figure 7 3 is a comparison chart of the binding effects of nCRP and mCRP with the specific DNA aptamers screened in Example 1. DETAILED DESCRIPTION

[0038] The present invention provides a DNA aptamer that specifically recognizes natural CRP and its application. To make the objectives, technical solutions, and effects of the present invention more clear and specific, the present invention is further described in detail below. It should be understood that the specific embodiments described herein are merely illustrative of the present invention and are not intended to limit the present invention.

[0039] It will be understood by those skilled in the art that, unless otherwise defined, all terms (including technical and scientific terms) used herein have the same meaning as commonly understood by those skilled in the art in the art to which the present invention belongs. It should also be understood that terms such as those defined in common dictionaries should be understood to have meanings consistent with their meanings in the context of the prior art and will not be interpreted in an idealized or overly formal sense unless specifically defined as herein.

[0040] The present invention provides a DNA aptamer that specifically recognizes natural CRP, wherein the DNA aptamer contains at least one of the following sequences:

[0041] (1) The nucleic acid sequence shown in SEQ ID NO: 1 and its functional derivatives;

[0042] (2) The nucleic acid sequence shown in SEQ ID NO: 2 and its functional derivatives.

[0043] Specifically, the nucleic acid sequences of SEQ ID NO: 1 and SEQ ID NO: 2 are as follows:

[0044] SEQ ID NO:1:GTCCGACATTGGGAAGGCTTAATGGGCTGG

[0045] SEQ ID NO:2:AGCCGGTGCTATGGTAGCTGCTTGGCTCGG

[0046] In this embodiment, the provided DNA aptamer can bind to natural CRP with high specificity in complex biological samples, thereby providing a new biological detection method; in addition, compared with traditional antibody methods, the use of DNA aptamers to identify natural CRP has the advantages of low cost (aptamers can be synthesized in vitro in a solid phase, which is a very mature and standardized method), non-immunogenicity (does not stimulate immune cells to produce anti-antibodies), high in vivo stability (DNA aptamers can resist serum degradation compared to RNA aptamers), etc., and is suitable for capturing nCRP in complex systems to achieve accurate detection, purification, in vivo imaging, diagnosis and drug delivery of nCRP. Therefore, the DNA aptamer has important application value for the detection, purification, in vivo imaging, diagnosis and as a drug delivery system of nCRP.

[0047] In some embodiments, the functional derivative includes but is not limited to at least one of the following:

[0048] 1) A derivative obtained by modifying at least one base in the nucleic acid sequence shown in SEQ ID NO: 1;

[0049] 2) a derivative obtained by modifying at least one base in the nucleic acid sequence shown in SEQ ID NO: 2;

[0050] 3) a sequence having a homology of more than 60% with the nucleic acid sequence shown in SEQ ID NO: 1;

[0051] 4) a sequence having a homology of more than 60% with the nucleic acid sequence shown in SEQ ID NO: 2;

[0052] 5) a sequence that can hybridize with the nucleic acid sequence shown in SEQ ID NO: 1 under stringent conditions;

[0053] 6) a sequence that can hybridize with the nucleic acid sequence shown in SEQ ID NO: 2 under stringent conditions;

[0054] 7) a phosphorothioate backbone sequence derived from the nucleic acid sequence shown in SEQ ID NO: 1;

[0055] 8) a phosphorothioate backbone sequence derived from the nucleic acid sequence shown in SEQ ID NO: 2;

[0056] 9) a peptide nucleic acid converted from the nucleic acid sequence shown in SEQ ID NO: 1;

[0057] 10) a peptide nucleic acid converted from the nucleic acid sequence shown in SEQ ID NO: 2;

[0058] Wherein, the functional derivatives all maintain the specific recognition function of natural CRP.

[0059] Specifically, sequences having at least 60% homology to the nucleic acid sequence shown in SEQ ID NO: 1 may include DNA sequences having 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% homology that can specifically recognize nCRP. Similarly, sequences having at least 60% homology to the nucleic acid sequence shown in SEQ ID NO: 2 may include DNA sequences having 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% homology that can specifically recognize nCRP.

[0060] Further, the stability and nuclease resistance of the oligonucleotide aptamer are improved by using phosphorothioate modification; peptide nucleic acid (PNA) is a kind of nucleic acid analogue with neutral peptide chain amide bond instead of sugar phosphate backbone in DNA, and the peptide nucleic acid has high sequence recognition ability and is not easy to be hydrolyzed by nuclease and protease, and can be used for effectively recognizing and binding DNA or RNA sequence to form a stable double helix structure. In the present application, the phosphorothioate backbone sequence and the peptide nucleic acid can be prepared according to the conventional method.

[0061] In some embodiments, the modification comprises one or more of phosphorylation, methylation, amination, sulfhydrylation, and isotopic labeling.

[0062] In some embodiments, the functional group in the functional derivative is selected from at least one of a fluorescent group, a radioactive group, a therapeutic drug, biotin, digoxin, a nanoluminescent material, a nucleic acid substance, and an enzyme label.

[0063] Specifically, the modification of the nucleic acid sequence shown in SEQ ID NO: 1 and SEQ ID NO: 2 and the connection of the functional group can be carried out by any known method, as long as these changes do not affect the basic function of the sequence, i.e., specific recognition of nCRP. For example, the 3' end or 5' end of the sequence shown in SEQ ID NO: 1 and SEQ ID NO: 2 can be modified or connected with a functional group. These modifications or functional groups can be used to improve the stability of the aptamer, provide a detection signal, or be used to connect the aptamer to other substances to form a complex.

[0064] In addition, the present application also provides an application of the DNA aptamer which specifically recognizes native CRP in detecting or purifying nCRP.

[0065] In addition, the present application also provides an application of the DNA aptamer which specifically recognizes native CRP in preparing an in vivo imaging contrast agent for nCRP related diseases.

[0066] In some embodiments, the nCRP related diseases include at least one of cardiovascular disease, autoimmune disease, infection, tissue damage, and nervous system disease.

[0067] In addition, the present application also provides an application of the DNA aptamer which specifically recognizes native CRP in preparing a diagnostic or therapeutic drug for nCRP related diseases.

[0068] In addition, the present application also provides a product for recognizing nCRP, comprising the DNA aptamer which specifically recognizes native CRP.

[0069] In this embodiment, the DNA aptamers screened by SELEX technology have the advantages of low cost, non-immunogenicity, and high in vivo stability compared to traditional antibodies. They are suitable for capturing nCRP in complex systems to achieve biomedical applications such as accurate detection, purification, in vivo imaging, diagnosis and drug delivery of nCRP.

[0070] In some embodiments, the product for identifying nCRP includes but is not limited to a kit, a detection chip, and the like.

[0071] In this embodiment, DNA aptamers that can specifically recognize nCRP are screened using SELEX technology. The process includes: first, synthesizing an initial DNA library containing 30 random nucleotides, and using nCRP as the target protein and mCRP as the control protein for SELEX screening. The core steps of the screening process design include binding of the aptamer to the protein, magnetic bead separation, PCR amplification, etc. After 16 rounds of screening, two aptamers, ApnCRP1 and ApnCRP2, were obtained. The secondary structures of the two aptamers were predicted using RNAstructure software, and it was found that the two aptamers formed unique stem-loop structures and hairpin structures, respectively.

[0072] The present invention will be described in detail with reference to the following examples. It should also be understood that the following examples are only intended to further illustrate the present invention and are not to be construed as limiting the scope of protection of the present invention. Any non-essential improvements and adjustments made by those skilled in the art based on the above disclosure of the present invention fall within the scope of protection of the present invention.

[0073] Example 1

[0074] This example uses SELEX to screen DNA aptamers that specifically recognize nCRP, specifically including:

[0075] The initial random single-stranded DNA library chemically synthesized has the sequence shown in SEQ ID NO: 3, which is as follows:

[0076] TAGGGAAGAGAAGGACATTGAT-N(30)-TTGACTAGTACATGACC ACTTGA

[0077] Wherein, N(30) represents a region consisting of 30 random nucleotides.

[0078] Primer P1: 5′-TAGGGAAGAGAAGGACATATGAT-3′

[0079] Primer P2: 5'-phosphorylation-TCAAGTGGTCATGTACTAGTCAA-3'

[0080] In the Filter step, do the following:

[0081] 1. Heat 1 nmol of random single-stranded DNA library at 95°C for 5 minutes, then quickly cool in an ice bath for 10 minutes to ensure complete denaturation of the DNA library.

[0082] 2. Add 50 pmol of nCRP protein containing a 6×His tag to the treated DNA library and incubate at 25°C for 1 hour to allow the DNA aptamer to bind to the target protein.

[0083] 3. Then, introduce 50 μl of Mag-Beads His-Tag protein purification magnetic beads and incubate again at 25°C for 30 minutes. This step aims to capture the complex through the His tag of the affinity magnetic beads.

[0084] 4. Wash the magnetic beads three times with 1 ml of washing buffer (phosphate-buffered saline (PBS) containing 5 mM MgCl2, 5 mM imidazole, and 0.02% Tween-20).

[0085] 5. Add 50 μl of 500 mM imidazole solution to the washed magnetic beads, let it stand at room temperature for 1 minute, and then collect the supernatant of the magnetic beads, which contains the target aptamer DNA.

[0086] 6. Pre-amplify the adapter DNA in the supernatant in a 500 μl PCR reaction system for 6 cycles.

[0087] 7. To determine the optimal number of amplification cycles, a cycle gradient experiment was performed. Part of the pre-amplified product was used as a template and amplified for 6, 9, 12, and 15 cycles in four sets of 50 μl PCR reaction systems, respectively.

[0088] 8. Separate the PCR products by gel electrophoresis and select the optimal cycle number for subsequent aptamer screening and double-stranded DNA preparation.

[0089] 9. Purify the amplified product and perform quantitative analysis using a Nanodrop photometer.

[0090] 10. For every 2 μg of amplified product, add 5 μl of 10× digestion buffer and 1 μl of lambda exonuclease to make up to 50 μl. Then, digest at 37°C for 30 minutes to obtain single-stranded DNA.

[0091] 11. For negative screening, heat 1 nmol of single-stranded DNA at 95°C for 5 minutes and then place on ice for 10 minutes. Then add 100 pmol of mCRP protein containing a 6× His tag and 50 μl of Mag-Beads His-Tag protein purification magnetic beads. Incubate at 25°C for 30 minutes and remove the supernatant.

[0092] 12. Repeat the above PCR amplification steps, select the most appropriate number of cycles, amplify, purify, quantify and prepare single-stranded DNA of the screening product.

[0093] 13. Perform 16 rounds of screening and clone and sequence the PCR products from the last round, as shown in Figure 1 shown.

[0094] 14. The secondary structures of ApnCRP1 and ApnCRP2 obtained by screening were predicted using RNAstructure software, such as Figure 2 and Figure 3 As shown, ApnCRP1 and ApnCRP2 formed specific stem-loop and hairpin structures, respectively.

[0095] In this advanced optimization example, multiple modification strategies were proposed for the successfully screened nCRP-specific DNA aptamers, ApnCRP1 and ApnCRP2, to enhance their functionality and applicability. These modifications include, but are not limited to, phosphorylation, methylation, amination, sulfhydrylation, or isotopization of at least one base of the aptamer to produce a series of derivative forms.

[0096] In addition, this embodiment also includes a method for attaching functional groups to ApnCRP1 and ApnCRP2. These functional groups can be fluorescent labels, radioisotopes, therapeutic drugs, biotin, digoxin, nanoscale luminescent materials, nucleic acid molecules, or enzyme labels. For example, a multifunctional drug delivery system can be constructed by introducing different chemical groups at the ends of ApnCRP1 and ApnCRP2 and combining them with drug carriers. Such systems may include combinations with polymers, inorganic nanoparticles, dendrimers, liposomes, or micelles. At the same time, ApnCRP1 and ApnCRP2 can also be used to attach markers for use in the detection and identification of sample cells, tissues, or biomacromolecules. By attaching markers to the 5' or 3' ends of ApnCRP1 and ApnCRP2 and introducing them into the sample to be tested, the binding of the aptamer to the sample can be evaluated using various detection methods such as flow cytometry, confocal microscopy, or immunochemiluminescence. In addition, a simple and effective method for targeted drug delivery can be achieved by directly embedding drug molecules into ApnCRP1 or ApnCRP2, or by chemically modifying the drug to form a stable ester, amine, or disulfide bond on the aptamer, or by covalently linking it through a linker.

[0097] This embodiment also allows the generation of DNA sequences with at least 60% homology to ApnCRP1 and ApnCRP2, which are also capable of specifically recognizing nCRPs. These homologous sequences can hybridize with ApnCRP1 and ApnCRP2 under stringent experimental conditions. Furthermore, the present invention also encompasses methods for modifying the backbones of ApnCRP1 and ApnCRP2 to phosphorothioate backbones or peptide nucleic acids.

[0098] Here, those skilled in the art should realize that, based on ApnCRP1 and ApnCRP2, any known method can be used to obtain their derivatives, and all of these derivatives are within the scope of protection of the present invention.

[0099] Example 2

[0100] Verification that the DNA library enriched by SELEX in Example 1 can specifically bind to nCRP was performed, specifically including:

[0101] In this example, 100 pmol of each DNA library enriched in rounds 4, 6, 8, and 16 was taken and heated at 95°C for 5 minutes to melt the DNA, followed by immediate placement in an ice bath for 10 minutes to cool rapidly. Subsequently, 25 pmol of 6×His-tagged nCRP and mCRP proteins were added to each sample and incubated at 25°C for 1 hour to promote DNA-protein binding. Next, 25 μl of Mag-Beads His-Tag protein purification magnetic beads were added to each sample and incubated at 25°C for another 30 minutes to capture the DNA library bound to the target protein through the His tag of the magnetic beads.

[0102] The magnetic beads were then washed three times with 1 ml of a wash buffer containing PBS, 5 mM MgCl2, 5 mM imidazole, and 0.02% Tween-20. After washing, 25 μl of a 500 mM imidazole solution was added to the magnetic beads and allowed to stand at room temperature for 1 minute to elute the bound DNA, and the supernatant was then collected.

[0103] For PCR amplification, the following specific primers were used:

[0104] Primer P1: 5′-TAGGGAAGAGAAGGACATATGAT-3′

[0105] Primer P3: 5'-TCAAGTGGTCATGTACTAGTCAA-3'

[0106] After PCR amplification, the products were analyzed by nucleic acid electrophoresis, and the brightness of the electrophoresis bands was quantitatively analyzed using Quantity One software. The experimental results showed that as the number of screening rounds increased, the binding ability of the DNA library to nCRP increased, while the binding to mCRP did not show a significant increase (e.g. Figure 4 shown).

[0107] Furthermore, in order to obtain biotin-labeled single-stranded DNA, PCR amplification was performed on the DNA libraries enriched in rounds 4, 6, 8, and 16. The amplification primers are as follows:

[0108] Primer P4: 5′-biotin-TAGGGAAGAGAAGGACATATGAT-3′

[0109] Primer P2: 5'-phosphorylation-TCAAGTGGTCATGTACTAGTCAA-3'

[0110] After the amplified product was purified and quantified by Nanodrop, 5 μl of 10× enzyme digestion buffer and 1 μl of lambda exonuclease were added to every 2 μg of DNA, and the volume was made up to 50 μl with water. The product was digested at 37°C for 30 minutes.

[0111] Subsequently, 200 pmol of biotin-labeled single-stranded DNA was taken, and the aforementioned heating and ice bath steps were repeated, and incubated with 50 pmol of nCRP and mCRP proteins containing 6×His tags at 25°C for 1 hour. Streptavidin MagSepharose magnetic beads were used for enrichment experiments, and nCRP and mCRP proteins bound to DNA were detected by electrophoresis. The electrophoresis bands were quantitatively analyzed using Quantity One software. The results showed that as the number of screening rounds increased, the binding ability of nCRP to the enriched DNA sequences increased, while no obvious binding was observed between mCRP and these DNA sequences (such as Figure 5 shown).

[0112] Example 3

[0113] The specific binding of the DNA aptamer screened and obtained in Example 1 to nCRP was verified, specifically including:

[0114] In this experiment, 200 pmol of ApnCRP1 and ApnCRP2 aptamers were first obtained and heated at 95°C for 5 minutes to unwind the DNA double strands, followed by rapid cooling in an ice-water bath for 10 minutes. 50 pmol of 6×His-tagged nCRP and mCRP proteins were added to each sample and incubated at 25°C for 1 hour to allow the aptamers to bind to the proteins. Following incubation, 50 μl of Mag-Beads His-Tag Protein Purification Magnetic Beads were added to each mixture and incubated at 25°C for an additional 30 minutes to capture the His-tagged proteins.

[0115] Subsequently, the magnetic beads were washed three times with 1 ml of washing buffer containing PBS, 5 mM MgCl2, 5 mM imidazole and 0.02% Tween-20. After washing, 25 μl of 500 mM imidazole solution was added to the magnetic beads and allowed to stand at room temperature for 1 minute to elute the bound protein-DNA complex, and then the supernatant was collected. Subsequently, the collected samples were heated at 95°C for 10 minutes and analyzed by nucleic acid electrophoresis, and the brightness of the electrophoresis bands was quantified using Quantity One software. The experimental results showed that ApnCRP1 and ApnCRP2 could bind to nCRP, but had no obvious binding to mCRP (such as Figure 6 shown).

[0116] In another part of the experiment, 200 pmol of biotin-labeled ApnCRP1 and ApnCRP2 aptamers were obtained, and the samples were also heated at 95°C for 5 minutes and then quickly placed on ice for 10 minutes. Then, 50 pmol of nCRP and mCRP proteins with 6×His tags were added to each sample and incubated at 25°C for 1 hour. The aptamers were enriched using Streptavidin Mag Sepharose beads, and nCRP and mCRP bound to DNA were detected by protein electrophoresis. Quantity One software was also used for quantitative analysis of the electrophoresis bands. The results showed that nCRP was able to bind to biotin-labeled ApnCRP1 and ApnCRP2, while mCRP had no obvious binding to these aptamers (such as Figure 7 shown).

[0117] In summary, the present invention provides a DNA aptamer and application that specifically recognizes natural CRP. The DNA aptamer that specifically recognizes natural CRP contains at least one of the following sequences: (1) the nucleic acid sequence shown in SEQ ID NO: 1 and its functional derivatives; (2) the nucleic acid sequence shown in SEQ ID NO: 2 and its functional derivatives. The DNA aptamer provided by the present invention can bind to natural CRP with high specificity in complex biological samples, thereby providing a new type of biological detection method; in addition, the use of DNA aptamers to identify natural CRP has the advantages of low cost, no immunogenicity, and high in vivo stability compared to traditional antibody methods. It is suitable for capturing nCRP in complex systems to achieve accurate detection, purification, in vivo imaging, diagnosis and drug delivery of nCRP. Therefore, the DNA aptamer has important application value for the detection, purification, in vivo imaging, diagnosis and as a drug delivery system of nCRP.

[0118] It should be understood that the application of the present invention is not limited to the above examples. For those skilled in the art, improvements or changes can be made based on the above description. All these improvements and changes should fall within the scope of protection of the claims attached to the present invention.

Claims

1. A DNA aptamer that specifically recognizes natural CRP, characterized in that: The DNA aptamer is at least one of the following sequences: (1) the nucleic acid sequence shown in SEQ ID NO: 1; (2) the nucleic acid sequence shown in SEQ ID NO: 2; (3) A functional derivative obtained by modifying at least one base in the nucleic acid sequence shown in SEQ ID NO: 1; (4) A functional derivative obtained by modifying at least one base in the nucleic acid sequence shown in SEQ ID NO: 2; The functional derivative maintains the specific recognition function of natural CRP.

2. The DNA aptamer that specifically recognizes natural CRP according to claim 1, characterized in that The modification includes one or more of phosphorylation, methylation, amination, sulfhydrylation, and isotope labeling.

3. Use of the DNA aptamer that specifically recognizes natural CRP according to any one of claims 1 to 2 in detecting or purifying nCRP for non-disease diagnosis purposes.

4. A product for identifying nCRP, characterized in that: The method comprises the DNA aptamer that specifically recognizes natural CRP as described in any one of claims 1 to 2.

Citation Information

Patent Citations

  • C-reactive protein-binding aptamer and use of the same

    JP2010158238A

  • Aptamer and detection method for c-reactive protein

    TW201200874A