A wheat negative regulator TaEDR2 and its application in improving wheat resistance to stripe rust

Knocking out the negative regulator of wheat TaEDR2 through CRISPR/Cas9 gene editing technology has solved the problem of widespread outbreak of wheat stripe rust and achieved a broad-spectrum and long-lasting resistance of wheat to stripe rust.

CN119286883BActive Publication Date: 2025-07-11NORTHWEST A & F UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202411596722.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-11-11
Publication Date
2025-07-11
Estimated Expiration
2044-11-11

AI Technical Summary

Technical Problem

The existing wheat varieties have been overcome by a single disease resistance gene, resulting in toxicity mutation of stripe rust bacteria, leading to a large-scale outbreak of wheat stripe rust, and lack of broad-spectrum and long-lasting disease-resistant materials.

Method used

By mining the negative regulator of wheat TaEDR2, the TaEDR2 gene was knocked out or edited by CRISPR/Cas9 gene editing technology to enhance wheat's resistance to stripe rust, and the negative regulatory effect of TaEDR2 was expressed in wheat plants by Agrobacterium-mediated genetic transformation technology.

Benefits of technology

After knocking out the TaEDR2 gene in wheat plants, it significantly enhances its resistance to stripe rust and provides broad-spectrum, long-lasting disease protection.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119286883B_ABST
    Figure CN119286883B_ABST
Patent Text Reader

Abstract

The present invention belongs to the field of bio-agriculture, and particularly relates to a wheat negative regulator TaEDR2 and its application. The amino acid sequence of the protein encoded by the wheat negative regulator provided by the present invention is shown in SEQ ID NO: 1, and the nucleotide sequence of the wheat negative regulator TaEDR2 is shown in SEQ ID NO: 2. The present invention performs gene editing in the Fielder wild-type material to obtain TaEDR2 gene-edited plants that show resistance to the stripe rust fungus CYR32. The present invention determines that the TaEDR2 gene plays a negative regulatory role in wheat resistance to stripe rust, and uses this negative regulator to create wheat materials resistant to stripe rust, providing new genes and germplasm resources for wheat breeding for resistance to stripe rust.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of bio-agriculture, and particularly relates to a wheat negative regulator TaEDR2 and its application in improving wheat resistance to stripe rust. Background Art

[0002] Wheat stripe rust is one of the main diseases of wheat and an important biological disaster affecting the safe production of wheat. Wheat stripe rust is caused by Puccinia striiformis f. sp. Tritici, and has the characteristics of strong epidemicity, wide harm range and strong destructiveness. In the past 50 years, due to the extensive cultivation of disease-resistant varieties with similar genotypes and the same resistance sources, a single disease-resistant gene has exerted great selection pressure on Puccinia striiformis f. sp. Tritici, and the virulence of the pathogen has rapidly mutated. Once the virulence of the pathogen population mutates, the resistance of existing varieties will be overcome, leading to a large-scale outbreak of the disease. Therefore, exploring wheat disease-resistant gene resources and creating broad-spectrum and durable disease-resistant materials are the fundamental ways to control wheat stripe rust at present.

[0003] The wheat negative regulator (TaEDR2) is located on chromosome 4. The TaEDR2 protein consists of 718 amino acids, including a PH domain (Pleckstrin Homology), a START domain (Steroidogenic Acute Regulatory protein-related lipid transfer) and a DUF1336 domain (PFAM accession nos PF00169, PF01852 and PF07059, respectively). Among them, the DUF1336 domain is about 250 amino acids and is a plant-specific domain. The conservation of this region suggests that TaEDR2 may play an important role in regulating plant disease responses. At present, there is no literature report on the resistance of TaEDR2 to stripe rust. Whether disease-resistant materials with broad-spectrum and durable resistance to wheat stripe rust can be created through the TaEDR2 gene cannot be predicted by those skilled in the art without a large number of screening and verification tests. Summary of the Invention

[0004] To solve the above technical problems, the present invention provides a wheat negative regulator TaEDR2 and its application. The present invention aims to further explore the immune defense mechanism of wheat, excavate genes that play a negative regulatory role in the defense response of wheat against the invasion of Puccinia striiformis f. sp. Tritici, and provide a new path for creating broad-spectrum and durable wheat stripe rust disease-resistant materials by conducting gene function research.

[0005] To completely and unambiguously understand the technical solution of the present invention, it should be supplemented that the coding gene of the wheat negative regulator TaEDR2 of the present invention is represented by the italicized font "TaEDR2", and the protein encoded by the wheat negative regulator TaEDR2 is represented by the non-italicized font "TaEDR2". Of course, those of ordinary skill in the art can clearly and completely understand the meanings and expressions of the relevant genes and their encoded proteins according to the description of the present invention.

[0006] On the one hand, the present invention provides a wheat negative regulator TaEDR2, and the nucleotide sequence of the wheat negative regulator TaEDR2 is as shown in SEQ ID NO: 2. The specific sequence of SEQ ID NO: 2 is as follows:

[0007]

[0008] On the other hand, the present invention provides a protein encoded by the wheat negative regulator TaEDR2, and the protein encoded by the wheat negative regulator TaEDR2 is obtained by encoding with the nucleotide sequence of the provided wheat negative regulator TaEDR2.

[0009] Furthermore, the amino acid sequence of the protein encoded by the wheat negative regulator TaEDR2 is as shown in SEQ ID NO: 1. The specific sequence of SEQ ID NO: 1 is as follows:

[0010] MAATTAQPPSPLPPAGEVIEVENSEPGSPDVGSRSSGSGRSSSEYSGWVYHLGVNSIGHEYCHLRFLVIRGKCVAMYKRDPHDNPGLEPIRKGFVSHTLVVEEVGRKKVNHGDVYVLRLYSRLDQTKKGEIACATPGEAQKWTEAFEQAKQQAEYDLTRGANWNRLQSENEFNLDGHRRRVRRGLGKLVRIGKGPEMLLRQSSDLQSHERVNTNFGGDTGDALEAHEWRFVRTLNGIRIFEDIANSKGGKGILLKSIGVVGANPDTVFEMVLSRDKHKRHEWDMLISDLELVETIDGYCDVVYGTYEPKYLNWWKSKKDFVFSRQWFRGQDGAYNILQSPASHKQKPPRHGYERTHINPTTWEIKRLNTSESTPKCIVTRMVEISPCFWDRWRRRTSSNFERSIPFALLSQVAGLREYFAANPAITPDLPSTVVKSKVSESLIIQSELEYSEPNDEFYDALVRGESFEGDSDDDDNDDDDDDDDVTTPKAGKVKLKNVSWAIAGLAMKRTKASLERSELVTNSIPIAIDSSHFHGTVRQAKSEDDPNSWSSPGGEKFMIRGKTYLTDYAKIAGGDPLLKLIAVDWFKVNERFDSVALHPKSLVQSEAAKKIPFILVVNLQVPAKPNYNLVMYYAAEKPVNKDSLLGRFIDGTDAFRDARFKLIPSIVEGYWMVKRAVGTRACLLGKAVTCNYLRQDNFLEIDVDIGSSSVARSIIGLVLGYVTSIVVDLAILVEAKEEKELPEYILGTVRLNRVNPEAAVPI.

[0011] On the other hand, the present invention provides a gene knockout or editing vector for knocking out or editing the wheat negative regulator TaEDR2.

[0012] On the other hand, the wheat negative regulator TaEDR2, or the protein encoded by the wheat negative regulator TaEDR2, or the gene knockout or editing vector is applied to the cultivation of wheat varieties resistant to stripe rust.

[0013] Furthermore, the nucleotide sequence of the wheat negative regulator TaEDR2 is expressed by Agrobacterium-mediated genetic transformation and has a negative regulatory effect in the interaction between wheat and stripe rust. Knocking out the wheat negative regulator TaEDR2 enhances the resistance of wheat to stripe rust pathogens.

[0014] In addition, the present invention provides a method for cultivating wheat varieties resistant to stripe rust, which is to knock out the wheat negative regulator TaEDR2 in the plant to obtain a TaEDR2 gene-edited plant variety.

[0015] Furthermore, the plant is a monocotyledonous plant, the monocotyledonous plant is a cereal crop, and the cereal crop is wheat.

[0016] Compared with the prior art, the technical solution provided by the present invention has at least the following beneficial effects or advantages:

[0017] (1) Compared with traditional disease-resistant breeding techniques, plant disease-resistant genetic engineering techniques can break through the reproductive isolation between species and the incompatibility of distant hybridization, and achieve the directional improvement of target traits in a relatively short time, providing more comprehensive, continuous, and broad-spectrum protection for crops. Through gene function research, the present invention finds that the wheat negative regulator TaEDR2 plays a negative regulatory role in the defense response of stripe rust invading wheat, that is, knocking out the nucleotide sequence of the wheat negative regulator TaEDR2 can improve the ability of wheat to resist stripe rust. Reducing the expression of the protein encoded by the wheat negative regulator TaEDR2 in plants can endow the plants with certain disease resistance.

[0018] (2) The present invention provides a method for cultivating wheat varieties resistant to stripe rust. This method uses the CRISPR / Cas9 gene editing technology to knock out the wheat negative regulator TaEDR2 in wheat plants, enhancing the resistance of wheat to stripe rust pathogens. It has been verified that the TaEDR2 gene-edited wheat obtained by the method of the present invention shows resistance to the main prevalent races of stripe rust. The present invention provides a new technical idea for cultivating wheat varieties resistant to stripe rust from the perspective of molecular biology and effectively solves the technical problems of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1Schematic diagram of the expression profile analysis of the wheat negative regulator TaEDR2 in Example 1.

[0020] Figure 2 Schematic diagram of gene editing of TaEDR2 gene-edited plants.

[0021] Figure 3 Schematic diagram of the phenotypic results of TaEDR2 gene-edited plants inoculated with Puccinia striiformis f. sp. tritici CYR32 in Example 2. Fielder is a wild-type wheat variety and serves as the control group; TaEDR2KO#L4 and TaEDR2KO#L5 represent the T1 generation lines Line4 and Line5 of TaEDR2 gene-edited plants respectively. Detailed implementation manners

[0022] Next, the technical solutions of the present invention will be described in conjunction with the embodiments. However, the present invention is not limited to the following embodiments.

[0023] In order to enable those skilled in the art to better understand and implement the technical solutions of the present invention, the present invention will be further described below in conjunction with specific embodiments and drawings. However, the examples given are not intended to limit the present invention.

[0024] Unless otherwise specified, the experimental methods and detection methods described in the following embodiments are all conventional methods; unless otherwise specified, the reagents and materials can be purchased on the market.

[0025] Example 1

[0026] This example is a functional analysis experiment of the wheat negative regulator TaEDR2.

[0027] Collect Fielder wheat leaves at different time points (0, 24, 48, 72, 96, 120 h) after inoculation with Puccinia striiformis f. sp. tritici CYR23 (incompatible) and CYR32 (compatible). Extract RNA using an RNA extraction kit (purchased from Beijing Huayueyang Biotechnology Co., Ltd.), perform reverse transcription using reverse transcriptase M-MLV (purchased from Thermo Fisher), and detect the expression level of the TaEDR2 gene by real-time quantitative PCR. Use specific primers for TaEDR2 for real-time quantitative PCR, and use the elongation factor gene TaEF1-α as an internal reference based on qRT-PCR. The reaction conditions are: run at 95°C for 10 minutes; run at 95°C for 10 seconds; run at 60°C for 30 seconds; run at 72°C for 30 seconds; 40 cycles.

[0028] TaEDR2 primers:

[0029] EDR2-qRT-F: CTTTGACTCGGTTGCCTTGC;

[0030] EDR2-qRT-R: ACTGCACGCTTTACCATCCA。

[0031] Reference gene TaEF1-α primers:

[0032] TaEF1-α-F: TGGTGTCATCAAGCCTGGTATGGT;

[0033] TaEF1-α-R: ACTCATGGTGCATCTCAACGGACT。

[0034] The 2 -△△CT method was used to calculate the relative expression level of TaEDR2, and the measurement results were as Figure 1 shown: The expression level of the TaEDR2 gene reached the highest at 24 h after the infection of Puccinia striiformis f. sp. tritici in the compatible system (inoculated with CYR32), indicating that the resistance of TaEDR2 gene knockout plants to stripe rust was improved, suggesting that the TaEDR2 gene plays a negative regulatory role in wheat's response to the infection of Puccinia striiformis f. sp. tritici.

[0035] Example 2

[0036] This example provides the application of the wheat negative regulator TaEDR2 in the improvement of wheat rust-resistant varieties.

[0037] The plant of the present invention is preferably a monocotyledonous plant, a cereal crop that can be successfully infected and colonized by Puccinia striiformis f. sp. tritici, and wheat is particularly preferred.

[0038] The nucleotide sequence of the wheat negative regulator TaEDR2 in this example is shown in SEQ ID NO: 2.

[0039] The amino acid sequence of the protein encoded by the wheat negative regulator TaEDR2 in this example is shown in SEQ ID NO: 1.

[0040] The application of the wheat negative regulator TaEDR2 provided in this example in the improvement of wheat rust-resistant varieties includes creating TaEDR2 gene-edited plants using the CRISPR / Cas9 gene editing technology.

[0041] Screen two specific targets of the TaEDR2 gene, design forward and reverse primers according to the screened targets, synthesize the designed primers, and separately synthesize target-1 primers and target-2 primers; use the BtgZI endonuclease to perform single digestion on the intermediate vector sgRNA, use the T4 ligase to ligate the digested vector with the target-1 primers, and transform the ligated product into Escherichia coli. Pick single colonies for testing, detect positive colonies, and wait for the correct sequencing results. Then pick single colonies for shaking culture and extract the plasmid sgRNA-target-1; use the BsaI enzyme to digest sgRNA-target-1, use the T4 ligase to ligate the digested vector with target-2, transform the obtained ligation product into Escherichia coli, pick single colonies for testing, detect positive colonies, and wait for the correct sequencing results. Then pick single colonies for shaking culture and extract the plasmid. Use the LR reaction to ligate sgRNA-target-1-target-2 with the final vector Cas9, pick positive colonies for shaking culture and extract the plasmid, and use Agrobacterium-mediated transformation to introduce the prepared plasmid into Fielder wheat to obtain TaEDR2 gene-edited plants. The gene schematic diagrams of wild-type wheat (Fielder) and gene-edited wheat (TaEDR2KO) are as shown in Figure 2 shown.

[0042] Target primer - target-1:

[0043] EDR2-SgRNA1-F: ACTCAGTTGGTGGAAACAATTGAT;

[0044] EDR2-SgRNA1-R: AAAC ATCAATTGTTTCCACCAACT.

[0045] Target primer - target-2:

[0046] EDR2-SgRNA2-F: ACTTGAAGTGCATTGTTACTCGCA;

[0047] EDR2-SgRNA2-R: AAACTGCGAGTAACAATGCACTTC.

[0048] The application of the wheat negative regulator TaEDR2 in improving wheat rust-resistant varieties provided in this example also includes a verification method for the application of the wheat negative regulator TaEDR2 in cultivating and improving wheat rust-resistant varieties, specifically including:

[0049] S101: Obtain TaEDR2 gene-edited wheat, and perform Hi-TOM gene editing sequencing on the obtained TaEDR2 gene-edited wheat

[0050] S102: Inoculate the TaEDR2 gene-edited plants of the T1 generation with the main prevalent races of stripe rust fungi, identify the resistance of the gene-edited plants to the prevalent races of stripe rust fungi, and determine the stripe rust resistance characteristics of the wheat varieties with TaEDR2 gene editing.

[0051] Use the Hi-TOM gene editing sequencing technology to detect the TaEDR2 gene-edited plants. The results are as Figure 2 shown.

[0052] The application of the wheat negative regulator TaEDR2 in the improvement of wheat rust-resistant varieties provided in this example. Select the plants of the L4 line and the L5 line of the TaEDR2 gene-edited plants of the T1 generation. When they grow to the "two-leaf and one-heart" stage, inoculate CYR32 of stripe rust fungi on the second leaf of wheat, and inoculate CYR32 of stripe rust fungi on the wild wheat (Fielder) as a control group. Observe the growth of spore heaps on the wheat leaves 14 days after inoculation. The results are as Figure 3 shown: The number of spore heaps of the TaEDR2 gene-edited plants (TaEDR2KO#L4 and TaEDR2KO#L5) is significantly less than that of the control wild wheat (Fielder), indicating that the TaEDR2 gene-edited plants enhance the stripe rust resistance of wheat, suggesting that the TaEDR2 gene plays a negative regulatory role in wheat stripe rust resistance.

[0053] In summary, for the application of the wheat negative regulator TaEDR2 in the improvement of wheat rust-resistant varieties provided in the embodiments of the present invention, the CRISPR / Cas9 gene editing technology is used to construct a gene editing vector for the wheat negative regulator TaEDR2, and the gene editing vector is delivered into the recipient wheat Fielder through the Agrobacterium-mediated wheat genetic transformation technology. The obtained gene-edited plants are identified as positive plants. Two lines, L4 and L5, of the T1 generation of positive plants are selected to inoculate the prevalent race CYR32. After 14 days of observation, it is found that the gene-edited plants of the wheat negative regulator TaEDR2 produce fewer spores compared with Fielder, showing enhanced resistance.

[0054] The above are only the preferred embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent replacements, and improvements made within the spirit and principles of the present invention shall be included in the protection scope of the present invention.

Claims

1. Application of wheat negative regulator TaEDR2 gene editing vector in cultivation of wheat varieties resistant to stripe rust, characterized in that, Cultivating wheat varieties resistant to stripe rust by gene editing or gene knockout of the wheat negative regulator TaEDR2; cultivating wheat varieties resistant to stripe rust by reducing the expression or biological activity of the protein encoded by the wheat negative regulator TaEDR2; cultivating wheat varieties resistant to stripe rust by introducing a gene editing vector of the wheat negative regulator TaEDR2 into wheat cells; the nucleotide sequence of the wheat negative regulator TaEDR2 is as shown in SEQ ID NO: 2, and the amino acid sequence of the protein encoded by the wheat negative regulator TaEDR2 is as shown in SEQ ID NO:

1.

2. The application according to claim 1, characterized in that The nucleotide sequence of the wheat negative regulator TaEDR2 is expressed by Agrobacterium-mediated genetic transformation and has a negative regulatory role in the interaction between wheat and stripe rust.

3. The application according to claim 1, wherein Knocking out the wheat negative regulator TaEDR2 enhances the resistance of wheat to stripe rust pathogens.

4. A method for cultivating wheat varieties resistant to stripe rust, characterized in that, Knock out the wheat negative regulator TaEDR2 described in claim 1 in the plant to obtain a TaEDR2 gene-edited plant variety.

5. The method for cultivating wheat varieties resistant to stripe rust according to claim 4, characterized in that, Including: Construct the gene editing vector described in claim 1; transform the immature embryos of the plant by the method of Agrobacterium-mediated genetic transformation to obtain a TaEDR2 gene-edited plant variety.