A method for inhibiting horizontal gene transfer based on tfox knockout of vibrio harveyi

Abstract

The application discloses a method for inhibiting horizontal gene transfer based on tfoX knockout of Vibrio harveyi, and relates to the fields of molecular biology and genetic engineering. The method for inhibiting horizontal gene transfer comprises the following steps: introducing a target exogenous plasmid into a conjugative transfer donor bacterium, and then conjugating with a recipient bacterium. The efficiency of the Vibrio harveyi in obtaining the exogenous plasmid through conjugative transfer is reduced by knocking out the tofX gene of the recipient bacterium, and the method has the characteristics of significant reduction in the conjugative transfer efficiency. Compared with a wild-type host cell, the efficiency of the host cell with the tfoX gene knocked out in obtaining the plasmid pMMB207 in the donor bacterium Escherichia coli through conjugative transfer is reduced by about 1000 times. The method greatly reduces the ability of the host cell in obtaining the exogenous plasmid, and has great significance in resisting microbial pathogenicity and drug resistance.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and more specifically to a method for inhibiting horizontal gene transfer based on Vibrio harveyi tfoX knockout. Background Technology

[0002] Vibrio harveyi is a significant opportunistic pathogen in marine aquaculture, posing a substantial threat to the industry. A survey of marine fish diseases along the South China coast found that approximately 70% of vibrio infections in marine fish are caused by Vibrio harveyi. Due to the limitations of other control methods such as vaccines and immune enhancers, antibiotics are considered the most effective and flexible weapon against bacterial infectious diseases and are widely used for the prevention and treatment of bacterial diseases in aquaculture. Currently, Vibrio harveyi faces a severe resistance situation, with a resistance index as high as 0.60. The urgency of effective disease control and the drug resistance induced by antibiotic treatment both indicate the urgent need to explore new disease control strategies. Attenuating virulence and reducing antibiotic resistance are fundamental requirements for disease control and are key to implementing green and healthy aquaculture.

[0003] The key to reducing virulence and resistance lies in controlling virulence and drug resistance genes. Virulence and drug resistance genes of pathogenic microorganisms can spread horizontally between different species through conjugation transfer via mobile genetic elements such as plasmids, thereby enhancing the pathogenicity and drug resistance of pathogens and increasing the complexity and variability of disease control. Therefore, reducing the efficiency of plasmid conjugation transfer between bacteria can effectively control the spread and diffusion of virulence and drug resistance genes, and is considered one of the effective strategies for controlling the spread of virulence and drug resistance in pathogenic microorganisms. Summary of the Invention

[0004] To address the problems existing in the prior art, the present invention aims to provide a method for inhibiting horizontal gene transfer. Using this method for plasmid conjugation transfer effectively reduces plasmid conjugation transfer efficiency and can effectively solve the problems of rapid spread of drug-resistant and pathogenic bacteria.

[0005] To solve the above problems, the present invention is implemented as follows:

[0006] The first objective of this invention is to provide the application of the gene tfoX, which encodes a global regulatory factor in naturally competent bacteria, in suppressing horizontal gene transfer.

[0007] Preferably, the bacteria is Vibrio harveyi, and the gene encoding the natural competent global regulatory factor tfoX is shown in SEQ ID NO. 1, 818bp-1405bp.

[0008] The tfoX gene is located on chromosome 1 of Vibrio harveyi, at positions 3334061-3334648, with an ID of CU052_16110, and consists of 588 bases. Its encoded protein, TfoX, has an ID of NP_797621.1. TfoX is a global regulator of natural competence in bacterial transformation. Activated tfoX promotes the synthesis of numerous competent organelle proteins and is crucial for the formation of transmembrane natural competence organs during bacterial transformation.

[0009] The second objective of this invention is to provide a Vibrio harveyi strain with low conjugation transfer efficiency, which is achieved by knocking out the tfoX gene, which encodes the global regulatory factor of the naturally competent state of Vibrio harveyi. The tfoX gene is shown in SEQ ID NO.1, 818bp-1405bp.

[0010] The third objective of this invention is to provide a method for constructing Vibrio harveyi with low conjugation transfer efficiency, which involves knocking out the tfoX gene, which encodes the global regulatory factor of the naturally competent state of Vibrio harveyi, to obtain Vibrio harveyi with low conjugation transfer efficiency. The tfoX gene, which encodes the global regulatory factor of the naturally competent state, is shown in SEQ ID NO.1, 818bp-1405bp.

[0011] Preferably, it includes the following steps:

[0012] Step 1: Design gene knockout primers for tfoX, the gene encoding the global regulatory factor of natural competence in Vibrio harveyi genome;

[0013] Step 2: Using Vibrio harveyi as the starting strain, knock out the tfoX gene encoding the global regulatory factor of the natural competent state, and obtain the gene-deleted strain V.harveyi 345-ΔtfoX, which is Vibrio harveyi with low conjugation transfer efficiency.

[0014] Preferably, the gene knockout primers in step one are: upstream homologous arm amplification primers: aagcttgatatcgaattcTACCA TGGTTGCGCCTAG and caatcatcgtgaaactaaagcgatCTTATATTTTTCACAGTTTAGTTGAGTAAAT TC, and downstream homologous arm amplification primers: gaatttactcaactaaactgtgaaaaatataagATCGCTTTAGTTTCACGATGATT G and ttggtaacgaatcagacGCCATCCTCAACGCGATG.

[0015] Preferably, step two, specifically including the following steps, involves knocking out the tfoX gene, which encodes the global regulatory factor of the naturally competent state:

[0016] (1) PCR amplification of the upstream and downstream homologous arms of the tfoX gene and the linearized suicide plasmid;

[0017] (2) Recombinant plasmids were obtained by isothermal assembly of upstream and downstream homologous arms and linearized suicide plasmids. The recombinant plasmids were then transformed into intermediate host E. coli GEB802 and donor E. coli GEB883, and positive clones were obtained by PCR identification.

[0018] (3) The donor bacteria E. coli GEB883 was cultured to the early logarithmic phase, and the recipient bacteria Vibrio harveyi 345 was cultured to the early logarithmic phase;

[0019] (4) The early logarithmic recipient bacteria Vibrio harveyi 345 was heat-shocked at 40℃ for 30 min and then conjugated with the early logarithmic donor bacteria E. coli GEB883.

[0020] (5) Screening and identification of single and double crossover clones, i.e. strains with tfoX gene deletion, i.e. Vibrio harveyi with low conjugation transfer efficiency.

[0021] In step (1), the suicide plasmid is pSW7848; in step (5), the screening of single-exchange clones specifically refers to screening on plates containing 34 μg / mL chloramphenicol and 0.2% D-glucose; in step (5), the screening of double-exchange clones specifically refers to screening on plates containing 0.2% L-arabinose; in step (5), the identification specifically refers to designing primer pairs: CAATTACAGAGGTCAATGGACATGAC and TCTAAACGCCTACTGAGCGTAC for PCR identification.

[0022] Furthermore, in some embodiments of the present invention, prior to the conjugation transfer step, the above method includes: a tfoX gene knockout step; the tfoX gene knockout step includes: constructing a recombinant suicide plasmid containing upstream and downstream homologous arm fragments of the targeting fragment (the tfoX gene fragment to be knocked out); introducing the recombinant suicide plasmid into the conjugation transfer donor bacterial host Escherichia coli GEB883; and conjugating the donor bacterial containing the recombinant suicide plasmid with the recipient bacterial.

[0023] It should be noted that the gene knockout method described above uses homologous recombination to knock out the tfoX gene. However, in other embodiments, other gene knockout methods may also be used to knock out the tfoX gene. Regardless of the method used to knock out the tfoX gene, such as complete knockout, partial knockout, or even inhibiting tfoX gene expression and inactivating it through RNAi interference vector, as long as the tfoX gene of the recipient bacteria does not perform its function during plasmid conjugation and transfer, it falls within the scope of protection of this invention.

[0024] A fourth objective of this invention is to provide the above-mentioned Vibrio harveyi with low conjugation transfer efficiency as a genetically engineered bacterium for gene knockout, inhibition of horizontal gene transfer, or reduction of drug-resistant pathogens.

[0025] The fifth objective of this invention is to provide a method for horizontal transfer of repressive genes based on Vibrio harveyi tfoX knockout, comprising the following steps: introducing a target exogenous plasmid into a conjugation transfer donor bacterium, and then conjugating it with the aforementioned Vibrio harveyi with low conjugation transfer efficiency.

[0026] Preferably, the exogenous plasmid is pMMB207, and the donor bacterium is Escherichia coli GEB883.

[0027] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0028] This invention is the first to discover that, compared to wild-type strains, knocking out the tfoX gene can suppress the efficiency of acquiring exogenous plasmids through conjugation transfer. Based on this finding, during conjugation transfer, mixing donor bacteria containing the target exogenous plasmid with recipient bacteria that have had the tfoX gene knocked out and performing conjugation transfer can reduce the efficiency of conjugation transfer of the target exogenous plasmid from the donor bacteria to the recipient bacteria, inhibiting horizontal transfer of exogenous genes. This is of great significance in resisting the rapid spread of drug-resistant and pathogenic microorganisms.

[0029] This invention discloses a method for inhibiting horizontal gene transfer based on tfoX knockout, which greatly reduces the host cell's ability to acquire exogenous plasmids through conjugation transfer. Compared with the originating bacteria, the conjugation transfer efficiency of V. harvestyi 345-ΔtfoX is significantly reduced. This method greatly reduces the ability of Vibrio harveyi to absorb exogenous plasmids, which is of great significance for resisting microbial pathogenicity and drug resistance.

[0030] The present invention provides a method for inhibiting horizontal gene transfer, comprising: mixing donor bacteria containing a target exogenous plasmid with recipient bacteria that have had the tfoX gene knocked out; by knocking out the tfoX gene in the recipient bacteria, conjugation transfer is reduced, thereby inhibiting horizontal gene transfer. This method has the characteristic of significantly reducing the efficiency of conjugation transfer; for example, compared with wild-type V. harvestyi 345, the efficiency of obtaining plasmid pMMB207 via conjugation transfer is reduced by approximately 1000 times in V. harvestyi 345-ΔtfoX with the tfoX gene knocked out. The method for inhibiting horizontal gene transfer provided by the present invention is of great significance in resisting the emergence of drug-resistant bacteria.

[0031] The starting strain *V. harvestyi* 345 described in this invention has been published in NCBI (CP025537, CP025538, CP025539, CP025540). The intermediate host *E. coli* GEB802, the donor strain *E. coli* GEB883, and the plasmid pSW7848 involved in this invention have been published in the following literature: Deng YQ, Su YL, Liu SL, et al. Identification of a novel small RNA srvg23535 in *Vibrio alginolyticus* ZJ-T and its characterization with phenotype microarray technology [J]. *Frontiers in Microbiology*, 2018: 2394. The inventors also possess the aforementioned microorganisms and vectors and guarantee to provide them to the public within 20 years from the date of application. Attached Figure Description

[0032] Figure 1 Construction of tfoX knockout strain, which encodes a global regulatory factor in naturally competent cells;

[0033] Lane M1: DNA Marker DL5000; Lane 1: pSW7848 linearized fragment; Lane M2: DNA Marker DL2000; Lanes 2 / 3: tfoX upstream / downstream fragments; Lane M3: DNA Marker DL10000; Lane 4: recombinant pSW7848-tfoX detection fragment; Lane M4: DNA Marker DL2000; Lane 5: tfoX gene knockout identification primer amplification results using wild-type Vibrio harveyi 345 genomic DNA as a template; Lane 6: tfoX gene knockout identification primer amplification results using tfoX candidate mutant genomic DNA as a template.

[0034] Figure 2 This is a comparison of the conjugation and transfer efficiencies of the starting strains V. harvestyi 345 and V. harvestyi 345-ΔtfoX in chloramphenicol plates.

[0035] Figure 3 This is a comparison of the relative conjugation efficiencies of the starting strains V. harvestyi 345 and V. harvestyi 345-ΔtfoX. Detailed Implementation

[0036] The technical solution of the present invention will be further described below with reference to the embodiments, but the scope of protection of the present invention is not limited thereto.

[0037] For the source of the suicide plasmid pSW7848, see the following reference: Val, ME., Skovgaard, O., Ducos-Galand, M., Bla nd, MJ, Mazel, D., 2012. Genome engineering in Vibrio cholerae: a feasible approach to a ddress biological issues. PLoS Genet. 8, e1002472.

[0038] For the source of E.coli GEB883, please refer to the literature: Nguyen, AN, Disconzi, E., Charrière, GM, Destoumi eux-Garzón, D., Bouloc, P., Le Roux, F., Jacq, A., 2018.csrB geneduplication drives the evolution of redundant regulatory pathways controlling expression of the major toxic secreted metalloproteases in Vibriotasmaniensis LGP32.mSphere.3,e00582-00518.

[0039] E. coli GEB802 is published in the literature Deng YQ, Su YL, Liu SL, et al. Identification of anovel small RNA srvg23535 in Vibrio alginolyticus ZJ-T and its characterization with phenotype microarray technology[J]. Frontiers in microbiology, 2018:2394. E. coli GEB802 is π3813 in the article.

[0040] Example 1:

[0041] I. Knockout of tfoX (CU052_16110), the gene encoding the global regulator of natural competence in the V. harvestyi 345 genome.

[0042] In the experiment, we designed corresponding gene knockout primers for the tfoX gene (Table 1).

[0043] Table 1 Primers related to gene knockout and identification

[0044]

[0045] The tfoX gene ORF and its upstream and downstream sequences (as shown in SEQ ID NO.1), with the italicized ATG and TAA being the start and stop codons of tfoX, respectively, from 818bp to 1405bp.

[0046] The genome of *V. harvestyi* 345 was extracted as a template. Using upstream homologous arm amplification primers: tfoX-U_fwd: a agcttgatatcgaattcTACCATGGTTGCGCCTAG and tfoX-U_rev: caatcatcgtgaaactaaagcgatCTTATATT TTTCACAGTTTAGTTGAGTAAATTC, and downstream homologous arm amplification primers: tfoX-D_fwd: gaatttactcaactaaact gtgaaaaatataagATCGCTTTAGTTTCACGATGATTG and tfoX-D_rev: ttggtaacgaatcagacGCCATCC TCAACGCGATG, the upstream and downstream flanking sequences of the tfoX gene were obtained by PCR amplification. Using the suicide plasmid pSW7848 as a template, the linearized plasmid pSW7848 was obtained by PCR amplification using primers pSW7848-F and pSW7848-R. Using the ClonExpress MultiS One Step Cloning Kit (Nanjing Novizan Biotechnology Co., Ltd.), upstream and downstream flanking sequences were isothermally assembled with a linearized plasmid to obtain the recombinant plasmid pSW7848-tfoX (its sequence is shown in SEQ ID NO.2). This plasmid was subsequently transformed into the intermediate host E. coli GEB802 and the donor strain E. coli GEB883 (the preparation and transformation methods of competent E. coli GEB802 and E. coli GEB883 cells are described in Chinese patent CN 107904228A). Positive clones were screened by PCR using primers pSW7848-check-F and pSW7848-check-R. The PCR amplification system and procedure described above are based on Chinese patent CN 107904228 A.

[0047] Referring to the invention patent CN 107904228 A, a mutant strain V. harvestyi 345-ΔtfoX was constructed. The recipient bacterium, Vibrio harveyi 345, was cultured to the early logarithmic growth phase (OD2). 600nm =0.3~0.7), and after heat shock treatment at 40℃ for 30 min, cultured to the early logarithmic growth stage (OD). 600nmConjugation transfer was performed on E. coli GEB883 containing the recombinant plasmid pSW7848-tfoX (p=0.3–0.7). The recombinant plasmid pSW7848-tfoX from E. coli GEB883 was transferred into Vibrio harveyi 345 via bacterial gene conjugation transfer. Since the pSW7848 plasmid cannot self-replicate in Vibrio harveyi 345, it can only replicate along with the genome after integrating into the Vibrio harveyi 345 genome through homologous recombination. The integration of the plasmid confers chloramphenicol resistance to *V. harvestyi* 345, while D-glucose inhibits the expression of the toxic gene ccdB in the suicide plasmid pSW7848. Single-crossover clones were obtained through screening on plates containing 34 μg / mL chloramphenicol and 0.2% D-glucose. Double-crossover clones were then screened on plates containing 0.2% L-arabinose (which induces ccdB expression). Further screening of candidate mutants involved simultaneously plating clones on plates containing 0.2% L-arabinose and plates containing 34 μg / mL chloramphenicol and 0.2% L-arabinose. Clones lacking chloramphenicol resistance were identified by PCR (del tfoX-check-F and del tfoX-check-R), yielding clones with successful gene knockout, which were identified as the mutant strain *V. harvestyi* 345-ΔtfoX. Following this procedure, tfoX was knocked out, and the gene knockout identification results met expectations. Figure 1 ).

[0048] II. Implementation Results

[0049] The starting strain *Vibrio campbellii* V. *harveyi* 345 and the obtained mutant strain V. *harveyi* 345-ΔtfoX were subjected to a heat shock at 40°C for 5 min during the early logarithmic phase, and then respectively coupled with the RP4 shuttle plasmid pMMB207 (which is chloramphenicol resistant and can self-replicate in *Vibrio campbellii* 345; construction method see Liu, JX, Zhao, Z., Deng, YQ, Shi, Y., Liu, YP, Wu, C., Luo, P., Hu, CQ, 2017. Complete genome sequence of *Vibrio campbellii* LMB29 isolated from red drum with four native... The *E. coli* donor strain pMMB207-E. coli GEB883 (megaplasmids.Front.Microbiol.8,2035.https: / / doi.org / 10.3389 / fmicb.2017.02035) was used for conjugation. After overnight conjugation, the plaques were collected using 1 mL of fresh LBS medium (containing 1% peptone, 0.5% yeast extract, and 3% sodium chloride by mass fraction). The plaques were serially diluted, and 100 μL of each dilution was spread onto LBS plates containing 34 μg / mL chloramphenicol (containing 1% peptone, 0.5% yeast extract, 3% sodium chloride, and 1.5% technical agar by mass fraction) for conjugation screening. The conjugation transfer efficiency was statistically analyzed. The results showed that ( Figure 2-3 (Table 2) Compared with the starting strain Vibrio harveyi 345, the conjugation transfer efficiency of V. harveyi 345-ΔtfoX decreased significantly by about 1000 times.

[0050] Table 2. Bonding transfer efficiency of V.harveyi 345 and V.harveyi 345-ΔtfoX

[0051]

[0052] Compared to wild-type host cells, tfoX gene knockout host cells exhibit approximately 1000-fold reduced efficiency in acquiring the pMMB207 plasmid from the donor bacterium *E. coli* via conjugative transfer. This method significantly reduces the host cell's ability to acquire exogenous plasmids, which is of great importance in combating microbial pathogenicity and drug resistance.

[0053] In summary, the results indicate that the deletion of the tfoX gene significantly reduces the efficiency of Vibrio harveyi in acquiring exogenous plasmids through conjugation transfer, inhibits horizontal gene transfer, and thus prevents or reduces the ability of microorganisms to absorb drug-resistant or pathogenic DNA fragments from the external environment. The method provided by this invention offers a new approach and strategy for reducing or avoiding the emergence of drug-resistant bacteria.

[0054] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

[0055] SEQ ID NO.1

[0056] TACCATGGTTGCGCCTAGCTCACGAGAAACCGCGGCACTTTTCACCAATATACTATTGCAGTCTTTAGAAAGGTTGACCGAATGCTTTAACTGTTCAATTGCTTGAGCTGTGACGATATCCCTCACTCGTAAAATGCCTAAGCGAGATACCGCTGTTGTTAGGTCATTACAGGTAATATTACGGCGATTAAAAATCACGGAATTCGCGACGCGAACCACAACCGCAGCAAGACTAGGATCTTCTAGTAACGCATTTGC GACGTCGGAAATCGTGGTGTTTTCTTCTGTGCAGAGTTGCTGGATTTTAAGTACGACATCAGGGATAGGAGGAAGGGAGATTTTCCCGGTAGAAATTGATTGTTCTACTAGGTGAGCGAACTCAGATTCGAGTGCTTTTATAAGCTTATCTTTATTATTTGGTAGGCCAAAAAAATGATAGATGTTCCATTATGACGTTGTGCTAGAGAGCTTTCGTACAGTGTACCTCCACACTATGTTG CTTATCAATTAAATACCTATTTCACGTTCGCAATTGCCGCATTTATCACCATGATGTTTGATTTTTGGCAGTTGCTGTGTCAAAAAAACATCGCTTAAGGATGAGTAAATGTGAAACTAATCACGTATGTGGAATTTGTAGTTCGGCAACTGTGACATAGATCCTAACTTATTTTTCAACGTTAAGTATGATTAAGACAGTTGGTGAGCGCAATTCACAAAAATATCGCCAACATATCGACAATTTATAATTCGCTATAAGCTGCTGTTCATCTGGTGACATCGCTAATCGGGGTAATTTATTCCAATTACAGAGGTCAATGGACATGACAGACCAAGCTTTTTTTAACTATGTAAGCAATTTTAGTGAGTACCAAAAACGTTCAATGTTTGGCGGGATTGGTTTATTCAGCAACGACGCAATGTTCGCACTAGTAAGTAACGACTGTTGTTATTTACGTGGTGGTAACGGGTTAGATGAA G AATTTACTCAACTAAACTGTGAAAAATATAAGCACGTCAAAAAACAAACGACGGCAACCGTTAACTACTATGATGTAACCGATCTATTTGACTCAGGTTTTGCGGGTCTAGACGCGTTGTTACAAAAATCGATTGAATGTTCTATTAAGGAACGTAAATACCAAAAGTCTTCAGCCAGTAGACGTTTGCGTGACCTACCAAATATGCAGTTGACGCTAGAGCGTATGGTCAAAAAAGCAGGTATTGATGACGTAGAAACGTTTTTGGAACTAGGACCAGTAGAAGTATTTAATAAAGTAAGAGTGACATACGGTAGTGATGTTGATGTGAAGCTTCTATGGAAGTTTGCTGGCGCCACTGATGGTATTCACTGGAAGCTGCTCCAAGAACCAC GCAAGAAACAACTGCTGGCAATGTGTGAATAA ATCGCTTTAGTTTCACGATGATTGACTCGTTTAGGATGAAGTTAGCGAGTCATAAAAGGTGAGTGTTGAAAGCGACAAAAGGAAGTTGATGCTTTTGGCCACTTCATTTGAGTTAGTCATTGCAACAAGACAGTTTGTAGATACAAAAAAACCGAGGTAAATGCCTCGGTTTTTTAGTTCATACTTTAAGAAAGTACGCTCAGTAGGCGTTTAGAACTTAAAGCGAGTAGTGAACATTACTTGATCACCGTAGAAGTCGTTGATACGCGCTTCAGCACCCAGAGAGAATAGCTCTGTAGAGTGGAAACGAGCGTAAACAGAACCGATCCAATCGTCATCGTTGTCGATAGAAACGTAACCCGCTTTACCACCAACTTCTAGTTGAGGACCAAGCCATTGGCGCACGCCTAAGTTAAGTTCCATACCAACGTCAGTGCTGCTTGAGTTTGACGGTTGTACAACGCGCATTAGCATTGCACCCGTTAGGTCAGCCCAGTTGTTTAGTGGTGAGTGGAAACCAAAACCCGCTGCTGAATCGAAATCACCATCAAACTCAGAGTCGATGCGCGCGATTACGTGTGCATTTGGGTGGATTGATTTGCTGAAACCAGCACCGAACGTTACTGGGCTAGCACCAATGCGAGCTTCCATGTAGTCGTAGCTAAAGTTGCTCATTGTTGCTGGAGCGTTGTAGTCGTTCGCAGCTAGAGCTTGGCTTGATGCCAACAAAAGGGCAGCGGCTAATAGTGTTTTACGCATAACTAACGATAAACCTTGTCTTATAGTTCCATGGATCCAAGTAACCACTTGAACCGTAATCTGATTTGTTCGACATCATAATAAAAACGAAGGTCTACGACCAACAAAAATGTGTCGATGTTTTGTCAAATGACTCATTGTGCCGTTTTATCAGCAAAAAACGCGCCATGTTGATGACGAATATGACTTGTTTTTCTATCCCAGTACTCATTCACCAAAGCTTGCACGTCGTTGTGC CATCGCGTTGAGGATGGC SEQID NO.2

[0057]

Claims

1. Knockout of genes encoding global regulatory factors in naturally competent bacteria tfoX Its application in inhibiting horizontal gene transfer is characterized by, The bacteria mentioned are Vibrio harveyi, and the gene encoding the natural competent global regulatory factor is... tfoX As shown in SEQ ID NO.1, 818 bp-1405 bp.

2. A type of Vibrio harveyi with low conjugation transfer efficiency, characterized in that, It is the gene encoding the natural competence global regulatory factor of Vibrio harveyi. tfoX Knockout, the gene encoding the global regulatory factor of the natural competent state. tfoX As shown in SEQ ID NO.1, 818 bp-1405 bp.

3. A method for constructing Vibrio harveyi with low conjugation transfer efficiency, characterized in that, It is the gene encoding the natural competence global regulatory factor of Vibrio harveyi. tfoX Knockout yielded Vibrio harveyi with low conjugation transfer efficiency, the gene encoding the global regulatory factor of the naturally competent state. tfoX As shown in SEQ ID NO.1, 818 bp-1405 bp.

4. The construction method according to claim 3, characterized in that, Includes the following steps: Step 1: Identify genes encoding natural competence global regulatory factors in the Vibrio harveyi genome. tfoX Design gene knockout primers; Step 2: Using Vibrio harveyi as the starting strain, knock out the gene encoding the global regulatory factor of the natural competent state. tfoX Correspondingly, gene-deleted strains were obtained. V. harveyi 345-Δ tfoX This refers to Vibrio harveyi, which has low conjugation transfer efficiency.

5. The construction method according to claim 4, characterized in that, The gene knockout primers mentioned in step one are: upstream homologous arm amplification primers: aagcttgatatcgaattcTACCATGGTTGCGCCTAG and caatcatcgtgaaactaaagcgatCTTATATTTTTCACAGTTTAGTTGAGTAAATTC; downstream homologous arm amplification primers: gaatttactcaactaaactgtgaaaaatataagATCGCTTTAGTTTCACGATGATTG and ttggtaacgaatcagacGCCATCCTCAACGCGATG.

6. The construction method according to claim 4, characterized in that, In step two, the gene encoding the global regulatory factor of the naturally competent state is knocked out. tfoX Specifically, the steps include the following: (1) PCR amplification of the above tfoX Upstream and downstream homologous arms of genes and linearized suicide plasmids; (2) Recombinant plasmids were obtained by isothermal assembly of upstream and downstream homologous arms and linearized suicide plasmids, and the recombinant plasmids were successively transformed into intermediate hosts. E. coli GEB802 and donor bacteria E. coli In GEB883, positive clones were obtained by PCR identification; (3) Donor bacteria E. coli GEB883 cultured to the early logarithmic phase, recipient bacterium Vibrio harveyi V. harveyi 345 cultured to early logarithmic growth stage; (4) Early logarithmic recipient bacteria Vibrio harveyi V. harveyi 345 was heat-shocked at 40°C for 30 min and then treated with logarithmic early donor bacteria. E. coli GEB883 was used for bonding and transfer experiments; (5) Screening and identification of single-crossover clones and double-crossover clones, thus obtaining tfoX Strains with gene deletions are Vibrio harveyi with low conjugation transfer efficiency. In step (1), the suicide plasmid is pSW7848; in step (5), the screening of single-exchange clones specifically refers to screening on plates containing 34 μg / mL chloramphenicol and 0.2% D-glucose; in step (5), the screening of double-exchange clones specifically refers to screening on plates containing 0.2% L-arabinose; in step (5), the identification specifically refers to designing primer pairs: CAATTACAGAGGTCAATGGACATGAC and TCTAAACGCCTACTGAGCGTAC for PCR identification.

7. A method based on Vibrio harveyi tfoX The method for knockout to suppress horizontal gene transfer is characterized by, The procedure includes the following steps: introducing the target exogenous plasmid into the conjugation transfer donor bacteria, and then conjugating it with Vibrio harveyi, which has low conjugation transfer efficiency, as described in claim 2.

8. The method according to claim 7, characterized in that, The exogenous plasmid is pMMB207, and the donor bacterium is Escherichia coli GEB883.

Images