Construction method of intracellular ATP content sensor for real-time monitoring and application thereof

Abstract

The application discloses a kind of construction methods of real-time monitoring intracellular ATP content sensor and application thereof, belong to biochemical detection technical field.It is mainly related to a kind of monitoring intracellular ATP content recombination plasmid, recombination plasmid includes hDndB and DN-luc, the hDndB and DN-luc are connected by IRES sequence.The application is by hDndB and DN-luc co-expression, and independent translation is realized by IRES connector, to avoid forming fusion protein mutual influence function;Using the ATP content detection characteristics of hDndB, make intracellular ATP content and DN-luc content produce positive correlation, to judge intracellular ATP content by detecting cell supernatant double luciferase content.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of biochemical detection, and particularly relates to a construction method of a real-time monitoring intracellular ATP content sensor and application thereof. BACKGROUND

[0002] Adenine nucleotide triphosphate (ATP for short) has a chemical formula of C 10 H 16 N5O 13 P3, a molecular weight of 507.18, is an unstable high-energy compound composed of 1 molecule of adenine, 1 molecule of ribose and 3 molecules of phosphate groups.

[0003] ATP, as the energy "currency" in cells, is involved in almost all life activities of cells, including cell growth, replication, aging, carcinogenesis and stress. In cell energy metabolism, ATP, as the product or raw material of energy metabolism, directly reflects the direction of cell energy metabolism through dynamic changes in its content. In addition, in many cell metabolic activities, many kinases act as important regulatory enzymes of metabolic reactions. For example, in the GPCR signaling pathway, PKA, as a key enzyme in the pathway, promotes the transmission of intracellular second messenger signaling pathways to the nucleus after activation. Cells directly up-regulate or inhibit the activity of kinases by adjusting the real-time ATP content in cells, thereby realizing the regulation of intracellular signaling pathways and other metabolic activities. In the medical field, there is also a need for real-time monitoring of intracellular ATP content. In the detection and treatment of diabetes, drug activation of AMPK is a major research direction, and the normal activity of AMPK in cells is directly regulated by the dynamic changes in intracellular AMP / ATP content. Therefore, the real-time content of ATP can be used as a direct proof of the efficacy of AMPK drugs. In addition, at present, the intracellular drug efficacy detection methods for diabetes research and drugs almost only include the expression content of target proteins or the expression content of their transcripts, while the real-time ATP content in cells can not only be used as an indicator of cell state after drug treatment, but also be used as a direct indicator of drug efficacy in drug development targeting cell energy metabolism.

[0004] Currently, there are many ways to detect ATP, such as NADPH method and luciferase method, and many ATP detection kits have also been developed. Among them, the ATP detection kits of Biyun Tian, Yeasen, MCE, Biosharp and Thermofisher Biotech Company are based on the luciferase method, the principle of which is that ATP reacts with the substrate luciferin under the action of luciferase to produce fluorescence, and when luciferase and substrate luciferin are in excess, the fluorescence intensity is proportional to the ATP concentration within a certain concentration range, so that the ATP concentration in the sample is detected by measuring the fluorescence intensity. Some biotech companies, such as Shengwo, use NADPH method to make ATP detection kit, the principle of which is that Hexo Kinase catalyzes glucose and ATP to synthesize 6-phosphoglucose, and 6-phosphoglucose dehydrogenase further catalyzes 6-phosphoglucose to generate NADPH, which has a characteristic absorption peak at 340 nm, and the content of NADPH is proportional to the content of ATP.

[0005] Currently, there are many ways to detect ATP, and many ATP detection kits have also been developed, but the common detection kits on the market all need to break the cells, and different kits use different reagents in the process of cell breaking due to the difference in principle, so there is a problem of complicated operation, which also increases the possible variables in the experimental process, and the above kits all detect the ATP content in the cell breaking liquid, which makes the detection result lag behind the intracellular ATP content, and also affects the experimental precision. With the continuous deepening of research in the biological field, the demand for a technology that can detect the intracellular ATP content in real time will increase, and there is no detection method that can reflect the intracellular ATP content in real time. SUMMARY

[0006] To solve the above technical problems, the purpose of the present application is to provide a construction method of a real-time monitoring intracellular ATP content sensor. The present application can detect the intracellular ATP content in real time without breaking the cells, has wide universality and is convenient to operate; in addition, based on real-time detection, the present technology can also provide real-time energy indicators for cell physiological state detection.

[0007] To achieve the above purpose, the technical scheme adopted by the present application is as follows:

[0008] A recombinant plasmid for monitoring intracellular ATP content, the plasmid comprising hDndB and DN-luc, which are simultaneously controlled by a common promoter.

[0009] The hDndB is obtained by codon optimization of DndB protein, and the optimized nucleotide sequence is shown in SEQ ID NO. 1.

[0010] Further, the DN-luc is Gaussia secreted luciferase; the sequence of the DN-luc is shown as SEQ ID NO. 2.

[0011] Further, the hDndB and the DN-luc are connected through an IRES sequence.

[0012] Further, the IRES sequence is shown as SEQ ID NO. 3.

[0013] The sequence of the hDndB and the DN-luc connected through the IRES sequence is shown as SEQ ID NO. 4.

[0014] The application further provides an application of the recombinant plasmid in preparing a product for monitoring intracellular ATP content.

[0015] Further, the product is a kit.

[0016] The use method of the product is: the recombinant plasmid is transfected into cells for culture, and the intracellular ATP content can be determined after 12-48 hours of transfection.

[0017] Further, the transfection time is 24 hours.

[0018] The prokaryotic DndB and its promoter sequence are found, and the DndB is codon-optimized and named as hDndB. Because in the prokaryote, the DndB can combine with the self promoter to inhibit the self transcription, the ATP can combine the DndB on the promoter, thereby relieving the inhibition of the DndB on the self transcription, so that the DndB protein can be expressed. When the ATP content is extremely low, the DndB is in the inhibition state, and the expression content is low, when the ATP content increases, the expression of the DndB also increases, that is, the ATP content and the DndB protein content are positively correlated.

[0019] The hDndB and DN-luc co-expression plasmid is constructed. The DN-luc is a secreted luciferase reporter gene, the DN-luc is connected with the hDndB through an IRES sequence, so that the hDndB and the DN-luc become a shared promoter but the proteins can play a role respectively, that is, the expression of the DN-luc is proportional to the expression of the hDndB. The luciferase in the supernatant is detected, so that the hDndB protein content, that is, the ATP content can be known.

[0020] The above recombinant plasmid is transfected into 293T cells for verification. The standard curve between the ATP content and the luciferase content is established by detecting the ATP content and the luciferase content.

[0021] Compared with the prior art, the application has the following beneficial effects:

[0022] The present invention co-expresses hDndB and DN-luc and realizes independent translation through an IRES linker, thereby avoiding the mutual influence of the formed fusion proteins; utilizing the ATP content detection characteristics of hDndB, the intracellular ATP content is positively correlated with the DN-luc content, and the intracellular ATP content is determined by detecting the luciferase content in the cell supernatant.

[0023] The present invention does not require cell disruption, can detect intracellular ATP content in real time, has wide versatility, and is easy to operate; in addition, based on real-time detection, this technology can also provide real-time energy indicators for cell physiological status detection. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 Schematic diagram of the DNdBpro+hDndB-Flag-IRES-DN-Luc (hDndB-Luc) plasmid in Example 1;

[0025] Figure 2 Schematic diagram of the detection of hDndB expression and DN-luc in transfected cells in Example 2 (Figure a shows the results of measuring DndB protein expression in different experimental groups, and Figure b shows the results of measuring DN-luc fluorescence values ​​in different experimental groups);

[0026] Figure 3 This is a schematic diagram for verifying the positive correlation between hDndB expression level and intracellular ATP content in Example 2;

[0027] Figure 4 Schematic diagram for verifying the linear positive correlation between the luciferase content in the supernatant of transfected cells and the intracellular ATP content in Example 2 (Figure a is a graph showing the results of measuring the intracellular ATP content using the ATP detection kit, Figure b is a graph showing the results of measuring the luciferase value in the supernatant, and Figure c is a graph showing the linear relationship between the two);

[0028] Figure 5 Graph showing real-time detection of ATP content in the supernatant of transfected cells by luciferase in Example 2 (Figure a shows the results of measuring intracellular ATP content at different stimulation times, and Figure b shows the results of measuring luciferase values ​​in the supernatant at different stimulation times); DETAILED DESCRIPTION

[0029] To better illustrate the present invention, the following embodiments are listed. Obviously, the embodiments described are only part of the present invention, not all of the embodiments. Based on the embodiments of the present invention, other embodiments obtained by those skilled in the art without making any creative efforts are also within the scope of protection of the present invention.

[0030] The technical solution of the present invention will be further described below with reference to the accompanying drawings and embodiments.

[0031] SEQ ID NO. 1:

[0032]

[0033] SEQ ID NO.2:

[0034] ATGCTAGCCAAGCCCACCGAGAACAACGAGGACTTCAACATCGTGGCCGTGGCCAGCAACTTCGCCACCACCGACCTGGACGCCGACCGCGGCAAGCTGCCCGGCAAGAAGCTGCCCCTGGAGGTGCTGAAGGAGATGGAGGCCAACGCCCGCAAGGCCGGCTGCACCCGCGGCTGCCTGATCTGCCTGAGCCACATCAAGTGCACCCCCAAGATGAAGAAGTTCATCCCCGGCCGCTGCCACACCTACGAGGGCGACAAGGAGAGCGCCCAGGGCGGCATCGGCGAGGCCATCGTGGACATCCCCGAGATCCCCGGCTTCAAGGACCTGGAGCCTATGGAGCAGTTCATCGCCCAGGTGGACCTGTGCGTGGACTGCACCACCGGCTGCCTGAAGGGCCTGGCCAACGTGCAGTGCAGCGACCTGCTGAAGAAGTGGCTGCCCCAGCGCTGCGCCACCTTCGCCAGCAAGATCCAGGGCCAGGTGGACAAGATCAAGGGCGCCGGCGGCGACCTGTACAAGTAA;

[0035] SEQ ID NO.3:

[0036] CCCCTCTCCCTCCCCCCCCCCTAACGTTACTGGCCGAAGCCGCTTGGAATAAGGCCGGTGTGCGTTTGTCTATATGTTATTTTCCACCATATTGCCGTCTTTTGGCAATGTGAGGGCCCGGAAACCTGGCCCTGTCTTCTTGACGAGCATTCCTAGGGGTCTTTCCCCTCTCGCCAAAGGAATGCAAGGTCTGTTGAATGTCGTGAAGGAAGCAGTTCCTCTGGAAGCTTCTTGAAGACAAACAACGTCTGTAGCGACCCTTTGCAGGCAGCGGAACCCCCCACCTGGCGACAGGTGCCTCTGCGGCCAAAAGCCACGTGTATAAGATACACCTGCAAAGGCGGCACAACCCCAGTGCCACGTTGTGAGTTGGATAGTTGTGGAAAGAGTCAAATGGCTCTCCTCAAGCGTATTCAACAAGGGGCTGAAGGATGCCCAGAAGGTACCCCATTGTATGGGATCTGATCTGGGGCCTCGGTGCACATGCTTTACATGTGTTTAGTCGAGGTTAAAAAAACGTCTAGGCCCCCCGAACCACGGGGACGTGGTTTTCCTTTGAAAAACACGATAATAA;

[0037] SEQ ID NO. 4:

[0038]

[0039] Example 1 Design of cell real-time energy sensor

[0040] 1. Confirmation of DndB and its promoter sequence

[0041] The DndB and its promoter sequence of Streptomyces avermitilis MA-4680 (Gene ID: 41540015) were searched on NCBI, and then based on the parameters such as "GC content value, CIS element, repeat element, RNA splicing site, ribosome binding sequence, minimum free energy of mRNA", and combined with computer language algorithms such as "maximization coordination index, maximization codon background index and minimization outlier index", the final optimized sequence was obtained by comprehensive evaluation and optimization design of codon, and was named as hDndB, and the sequence of the hDndB is shown as SEQ ID NO. 1.

[0042] 2. Synthesis of hDndB sequence

[0043] The codon-optimized hDndB was synthesized by Beijing GenScript Biotech Co., Ltd.

[0044] 3. Construction of hDndB and DN-luc co-expression plasmid

[0045] The codon-optimized hDndB and DN-luc were connected together through an IRSE sequence. The sequence of the DN-luc is shown as SEQ ID NO. 2, the sequence of the IRSE is shown as SEQ ID NO. 3, and the sequence of the hDndB and DN-luc connected through the IRES sequence is shown as SEQ ID NO. 4, and the connection mode is shown as Figure 1 .

[0046] The specific method is as follows:

[0047] 3.1 Primer design

[0048] Firstly, according to the HCMV Towne library and human-derived EZH2 sequence searched from genebank, the related PCR primers were designed by using PrimerPrimier 5.0, and the designed primer sequences were synthesized by Guangzhou GenScript. The sequences of the designed primer groups are shown in Table 1. Among them, the underlined part is the endonuclease site.

[0049] Table 1 Primer group sequence table

[0050]

[0051] 3.2 PCR reaction

[0052] PCR reactions were performed using the optimized synthetic hDndB, as well as DN-luc, IRSE sequences as templates, and the reaction system and reaction conditions are as follows in Table 2 and Table 3:

[0053] Table 2 PCR reaction system

[0054]

[0055] Table 3 PCR reaction conditions

[0056]

[0057] 3.3 PCR product nucleic acid gel electrophoresis recovery

[0058] 3.3.1 Preparation of 1% agarose gel: weigh 0.6g of agarose powder, add 60ml of 1x TAE electrophoresis buffer, cover the bottle opening with a weighing paper to prevent water evaporation; transfer to a microwave oven and heat for 2-3min, and it is completely dissolved when there is no obvious flocculent floating. When the gel solution is cooled to 50-60℃, add 0.6μl of Gel-Red nucleic acid dye at a dilution of 1:10000, shake well and quickly pour into the mold slot, insert the corresponding number of combs, and wait for 30min at room temperature. Before running the gel, carefully pull out the comb, and transfer the gel to an electrophoresis tank filled with fresh 1x TAE electrophoresis buffer.

[0059] 3.3.2 Sample loading: take 2μl of PCR product and 2μl of 10x DNA Loading buffer, mix well and load into the well with a micropipette, and add 2000bp or 5000bp DNA marker beside the sample for observation.

[0060] 3.3.3 Electrophoresis and observation of results: set the electrophoresis voltage to 100V for 30min, and pay attention to the placement of the positive and negative electrodes. After electrophoresis, analyze and store the results using a gel imaging system.

[0061] 3.3.4 PCR product recovery

[0062] Use Gel Extraction kit to recover the DNA fragments. The steps are as follows:

[0063] (1) In the gel imaging instrument, turn on the ultraviolet lamp, quickly cut the gel block of the target band, transfer to a 1.5ml EP tube, weigh without skin, add an equal volume of XP2 liquid to the gel, and heat to melt at 55℃ for 7min, and mix the sample up and down every 2min during the heating.

[0064] (2) After completely thawing, the sample was transferred into the recovery sleeve, centrifuged at 10000 rpm for 1 min, and the filtrate was discarded; 500 μl of XP2 solution was added into the inner sleeve, and after centrifugation, the filtrate was discarded.

[0065] (3) 700 μl of SPW washing solution was added into the inner sleeve, centrifuged at 12000 rpm for 1 min, and the filtrate was discarded; and this step was repeated once.

[0066] (4) The sleeve was idled at 12000 rpm for 2 min to remove residual ethanol.

[0067] (5) The inner sleeve was transferred into a new EP tube, 50 μl of ddH2O warmed in a water bath was carefully added to the center of the membrane, and after standing at room temperature for 2 min, the inner sleeve was centrifuged at 12000 rpm for 1 min to obtain the target DNA.

[0068] (6) The concentration of the recovered target DNA was determined by using NanoDrop 2000 software, and the sample was stored at -20°C.

[0069] 3.4 Using overlapping PCR technology, hDndB-F and DN-luc-R were used as upstream and downstream primers, and the hDndB, IRSE and DN-Luc obtained by amplification were used as templates to perform overlapping PCR reaction again, and the reaction conditions were as shown in 3.1-3.2 above. The hDndB-IRSE-DN-luc ligation product was obtained by amplification.

[0070] 3.5 Double enzyme digestion of target gene and vector

[0071] 3.5 Double enzyme digestion of target gene and vector

[0072] Table 4 Enzyme digestion reaction system

[0073]

[0074] The reaction system was placed in a 37°C incubator for double enzyme digestion, and the enzyme digestion time was 1 h.

[0075] After double enzyme digestion, the product was recovered and the concentration was determined in the manner described in 3.3 above.

[0076] 3.6 Ligation of target gene and vector

[0077] According to the concentration ratio of target gene: vector = 6:1-10:1, the enzyme ligation reaction of recombinant plasmid was carried out, and the enzyme ligation reaction system was as shown in Table 5:

[0078] Table 5 Enzyme ligation reaction system

[0079]

[0080] Incubate at 22°C for 2h. Prepare for transformation after reaction is complete.

[0081] 3.7 Transformation of recombinant plasmid

[0082] (1) In a clean bench, take 50 μl competent cells DH5a, put on ice to thaw (thawed cells have the highest transformation efficiency; avoid repeated freezing and thawing; avoid blowing and sucking with a pipette; the whole operation process should be gentle), add 1 / 10 of the plasmid or ligation product, mix gently, ice bath for 30 min.

[0083] (2) After ice bath, immediately transfer to a 42°C constant temperature water bath for 90 s, then move the competent cells to ice for 2 min, do not shake the centrifuge tube during this process.

[0084] (3) Add 700 μl of LB liquid medium without ampicillin A+ to a 1.5 ml EP tube, put it in a constant temperature incubator shaker at 37°C, 220 rpm, shake the bacteria for 45 min to recover the bacterial strain.

[0085] (4) After shaking, centrifuge at 5000 rpm for 7 min at room temperature, discard the supernatant, resuspend the bacterial cells, and spread on LB solid medium containing A+ and evenly smear with a spreader or glass beads.

[0086] (5) Place in a constant temperature incubator, after the spread liquid is absorbed, invert the plate, and incubate at 37°C for ≥ 13 h, then pick single colonies and shake them. The bacteria shaken out are sent for sequencing, and after correct sequencing, the constructed plasmid hDndBpro+DndB is obtained.

[0087] -Flag-IRES-DN-Luc.

[0088] Example 2 Verification of cell ATP real-time energy sensor

[0089] 1. hDndB, DN-luc expression and content detection

[0090] 1.1 Cells and plasmids

[0091] 293T cells were purchased from the American Type Culture Collection (ATCC) and preserved by the laboratory. The plasmid hDndBpro+DndB-Flag-IRES-DN-Luc (named hDndB-Luc) containing hDndB and DN-luc was constructed by the applicant.

[0092] 1.2 Reagents

[0093] DMEM medium was purchased from GIBCO; Lipo2000 was purchased from Invitrogen; Oligomycin A was purchased from Biyun Tian Biotechnology Co., Ltd.; Metformin hydrochloride was purchased from selleck.

[0094] 1.3 Experimental methods and results

[0095] The plasmid hDndB-Luc (1 μg) was transfected into 293T cells using Lipo2000, respectively.

[0096] The method is as follows:

[0097] HEK-293 T cells (1.5 x 10 5 cells) or Hela cells (1.2 x 10 5 cells) were inoculated in a 12-well plate, and the transfection was started the next day when the cell confluence rate reached 60%-70%.

[0098] The plasmid hDndB-Luc (1 μg) or empty vector expression plasmid was dissolved in 100 μL of culture medium (DMEM culture medium without double antibody and serum), and gently mixed; the transfection reagent was added to the above-mentioned culture medium at a ratio of DNA: transfection reagent = 1:2, and immediately gently mixed, incubated at room temperature for 15 min; the above-mentioned transfection reagent / DNA complex was added to the corresponding cell well, gently shaken and placed in the incubator for culture; 6 h later, the DMEM culture medium with double antibody and serum was replaced.

[0099] After 24 h of transfection, 4 mumol / L of Oligomycin A was used as an ATP inhibitor, and 1 ng / ml of metformin hydrochloride was used as an ATP activator to detect the expression of hDndB and DN-luc in the transfected cells.

[0100] hDndB has a Flag tag, and the protein expression of hDndB is detected by western blot experiment. DN-luc can be secreted outside the cell, and the cell supernatant is collected, then reacted with luciferin substrate to be detected.

[0101] The experimental results are shown in Figure 2 : The expression of hDndB and DN-luc exists in the transfected cells.

[0102] 2. hDndB expression content is positively correlated with ATP content

[0103] 2.1 Cells and plasmids

[0104] 293T cells were purchased from the American Type Culture Collection (ATCC) and preserved by the laboratory. The plasmid hDndB-Luc with hDndB and DN-luc was constructed by the applicant.

[0105] 2.2 Reagents

[0106] DMEM medium was purchased from GIBCO; Lipo2000 was purchased from Invitrogen; ATP assay kit was purchased from Biyun Tian Biotechnology Co., Ltd.; Renilla luciferase reporter gene assay kit was purchased from Biyun Tian Biotechnology Co., Ltd.; Metformin hydrochloride was purchased from selleck.

[0107] 2.3 Experimental methods and results

[0108] The plasmid hDndB-Luc (1 μg) was transfected into 293T cells using Lipo2000. The transfection method was the same as above 1.3.

[0109] After 24 hours of transfection, metformin hydrochloride was used as an ATP activator, and 0, 2 mM, 4 mM, 6 mM, 8 mM, 10 mM were used for 1 h, 37 °C incubation for 24 h; ATP kit was used as a control to detect the expression of hDndB in transfected cells.

[0110] The experimental results are shown in Figure 3 It is shown that the expression of hDndB in transfected cells has a significant positive correlation with cell treatment, and is consistent with the results of ATP kit, that is, with the increase of ATP content, the expression of hDndB increases.

[0111] 3. Supernatant luciferase of transfected cells has a linear positive correlation with ATP content

[0112] 3.1 Cells and plasmids

[0113] 293T cells were purchased from American Type Culture Collection (ATCC) and preserved by the laboratory. The plasmid hDndB-Luc with hDndB and DN-luc was constructed by the applicant.

[0114] 3.2 Reagents

[0115] DMEM medium was purchased from GIBCO; Lipo2000 was purchased from Invitrogen; ATP assay kit was purchased from Biyun Tian Biotechnology Co., Ltd.; Renilla luciferase reporter gene assay kit was purchased from Biyun Tian Biotechnology Co., Ltd.; Oligomycin A was purchased from Biyun Tian Biotechnology Co., Ltd., and metformin hydrochloride was purchased from selleck.

[0116] 3.3 Experimental methods and results

[0117] The plasmid hDndB-Luc (1 μg) was transfected into 293T cells using Lipo2000. The transfection method was the same as above 1.3.

[0118] After 24 hours of transfection, 0, 2 mM, 4 mM, 6 mM, 8 mM, 10 mM of metformin hydrochloride was used as ATP activator to treat for 1 hour, and then incubated for 24 hours at 37℃; ATP kit was used as control to detect the ATP content of transfected cells, and luciferase content in supernatant was also detected.

[0119] The experimental results are shown in Table 1. Figure 4 It can be seen that the luciferase content in the supernatant of transfected cells has a linear relationship with the ATP content, and the linear equation is y = 3438x + 32287, and R 2 = 0.9904, which has a good correlation.

[0120] 4. Luciferase in the supernatant of transfected cells can be used to detect the intracellular ATP content in real time

[0121] 4.1 Cells and plasmids

[0122] 293T cells were purchased from the American Type Culture Collection (ATCC) and preserved by the laboratory. The plasmid hDndB-Luc with hDndB and DN-luc was constructed by the applicant.

[0123] 4.2 Reagents

[0124] DMEM medium was purchased from GIBCO company; Lipo2000 was purchased from Invitrogen; ATP detection kit was purchased from Biyun Tian Biotechnology Co., Ltd.; Gaos luciferase reporter gene detection kit was purchased from Biyun Tian Biotechnology Co., Ltd.; metformin hydrochloride was purchased from Selleck.

[0125] 4.3 Experimental methods and results

[0126] Lipo2000 was used to transfect 293T cells with plasmid hDndB-Luc (1 μg) respectively. The transfection method is the same as above 1.3.

[0127] After 24 hours of transfection, 10 mM of metformin hydrochloride was used as ATP activator to treat for 1 hour, and then incubated for 24 hours at 37℃; ATP kit was used as control to detect the ATP content of transfected cells, and luciferase content in supernatant was also detected.

[0128] The experimental results are shown in Table 1. Figure 5 It can be seen that the luciferase content in the supernatant of transfected cells has a linear relationship with the ATP content, and the linear equation is y = 3438x + 32287, and R

[0129] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art should fall within the scope of protection defined by the claims of the present invention.

Claims

1. Use of a recombinant plasmid in preparing a product for monitoring ATP content in HEK-293T cells, characterized in that: The recombinant plasmid contains hDndB and DN-luc, and their expression is simultaneously controlled by a common promoter; the hDndB is obtained by codon optimization of the DndB protein, and the optimized nucleotide sequence is shown in SEQ ID NO.1; the DN-luc is a Gaussia secretory luciferase; the hDndB and DN-luc are connected by an IRES sequence.

2. The use according to claim 1, characterized in that The sequence of the DN-luc is shown in SEQ ID NO.

2.

3. The use according to claim 2, characterized in that The IRES sequence is shown in SEQ ID NO.

3.

4. The use according to claim 3, characterized in that The sequence of hDndB and DN-luc connected via the IRES sequence is shown in SEQ ID NO.

4.

5. The use according to claim 4, characterized in that The product is a test kit.

6. The use according to claim 5, characterized in that The method of using the product is: transfect the recombinant plasmid into cells for culture, and the intracellular ATP content can be measured 12-48 hours after transfection.

7. The use according to claim 6, characterized in that The transfection time is 24 hours.

Images