An SNP locus, related molecular marker and their application related to the length trait of pig carcass
By detecting the genotype of the SNP site at position 17980764 of pig chromosome 17, pigs with longer carcasses were identified and screened, the problem of difficulty in increasing pig carcass length in the prior art was solved, and the effective improvement of pig carcass length was achieved.
Patent Information
- Application Number
- CN202411691883.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-25
- Publication Date
- 2025-06-10
- Estimated Expiration
- 2044-11-25
AI Technical Summary
The prior art is difficult to effectively increase the carcass length of pigs, affecting the yield and quality of pork.
By detecting the polymorphism or genotype of the SNP site located at position 17980764 in the pig genome, the differences in the AA, AG or GG genotypes of the SNP site are used for identification, screening and breeding, and individuals of the AA genotype are preferred for propagation.
Effective identification and screening of pig carcass length is achieved, and the pig carcass length is improved by increasing the frequency of dominant alleles generation by generation, and the yield and quality of pork are improved.
Smart Images

Figure BDA0005151175030000021 
Figure BDA0005151175030000022 
Figure BDA0005151175030000023
Abstract
Description
Technical Field
[0001] The present invention belongs to the fields of molecular biotechnology and molecular marker technology. Specifically, the present invention relates to an SNP locus related to the carcass length trait of pigs, a related molecular marker, and their applications. Background Art
[0002] The carcass length trait is a very important direction in pig genetic breeding. Especially in the production of meat pigs, the carcass length is directly related to the yield and quality of pork. The carcass length is not only affected by genes, but also by the feeding environment and management level, among which genetic factors have a greater impact. Through genetic breeding methods, the carcass length of pigs can be effectively improved, thereby enhancing their production performance and economic benefits. Summary of the Invention
[0003] In order to overcome the deficiencies of the prior art, the purpose of the present invention is to provide an SNP locus related to the carcass length of pigs and an SNP molecular marker related to this locus.
[0004] The purpose of the present invention also lies in: providing the application of a substance for detecting the polymorphism or genotype of the SNP locus in the pig genome in any of the following: (1) identifying or assisting in identifying the carcass length of pigs; (2) screening or improving the carcass length trait of pigs; (3) pig breeding.
[0005] Another purpose of the present invention is to provide a primer composition and a kit for identifying the above SNP molecular marker.
[0006] The purpose of the present invention also lies in: providing the application of the above primer pair and kit, and providing a genetic improvement method for molecular marker-assisted breeding to improve the carcass traits of pigs.
[0007] The present invention is implemented as follows:
[0008] The application of a reagent for detecting an SNP locus related to the carcass length trait of pigs in identifying the carcass length of pigs. The SNP locus corresponds to the 17980764th bp on chromosome 17 of the international pig reference genome version 11.1 and is located within the PLCB4 gene; the polymorphism of the bases at this locus affects the carcass length of pigs; the carcass length of pigs with the AA genotype at the SNP locus is longer than that of pigs with the AG genotype and the GG genotype; the carcass length of pigs with the AG genotype at the SNP locus is longer than that of pigs with the GG genotype.
[0009] The application of a reagent for detecting an SNP locus related to the carcass trait of pigs in screening pigs with a longer carcass. The SNP locus corresponds to the 17980764th bp on chromosome 17 of the international pig reference genome version 11.1 and is located within the PLCB4 gene; the polymorphism of the bases at this locus affects the carcass length of pigs;
[0010] The carcass length of pigs with the AA genotype at the described SNP locus is longer than that of pigs with the AG genotype and the GG genotype; the carcass length of pigs with the AG genotype at the described SNP locus is longer than that of pigs with the GG genotype.
[0011] Use of a reagent for detecting an SNP locus related to the carcass length trait of pigs in improving the genetic breeding of the carcass length trait of pigs, wherein the SNP locus corresponds to the 17980764th bp on chromosome 17 of the international pig reference genome version 11.1 and is located within the PLCB4 gene; the polymorphism of the bases at this locus affects the carcass length of pigs;
[0012] The carcass length of pigs with the AA genotype at the described SNP locus is longer than that of pigs with the AG genotype and the GG genotype; the carcass length of pigs with the AG genotype at the described SNP locus is longer than that of pigs with the GG genotype.
[0013] Use of a reagent for detecting an SNP molecular marker related to the carcass trait of pigs in identifying the carcass length trait of pigs, characterized in that: the nucleotide sequence of the SNP molecular marker is
[0014] This SNP locus is named the (A\G) locus, the nucleotide type of the (A\G) locus can be A or G, and the genotype can be AA, AG or GG; the carcass length of pigs with the AA genotype is longer than that of pigs with the AG genotype and the GG genotype; the carcass length of pigs with the AG genotype is longer than that of pigs with the GG genotype.
[0015] Use of a reagent for detecting an SNP molecular marker related to the carcass length trait of pigs in screening pigs with a longer carcass length trait, wherein the nucleotide sequence of the SNP molecular marker is
[0016]
[0017] This SNP locus is named the (A\G) locus, the nucleotide type of the (A\G) locus can be A or G, and the genotype can be AA, AG or GG; the carcass length of pigs with the AA genotype is longer than that of pigs with the AG genotype and the GG genotype; the carcass length of pigs with the AG genotype is longer than that of pigs with the GG genotype.
[0018] Use of a reagent for detecting an SNP molecular marker related to the carcass length trait of pigs in improving the genetic breeding of the carcass length trait of pigs, wherein the nucleotide sequence of the SNP molecular marker is
[0019]
[0020] This SNP locus is named the (A\G) locus. The nucleotide type of the (A\G) locus can be A or G, and the genotypes can be AA, AG, or GG; The carcass length of pigs with the AA genotype is longer than that of pigs with the AG genotype and pigs with the GG genotype; The carcass length of pigs with the AG genotype is longer than that of pigs with the GG genotype.
[0021] A method for detecting pig carcass traits, comprising the following steps: Detecting the SNP locus in pigs located at position 17980764bp on chromosome 17 of the international pig reference genome version 11.1, within the PLCB4 gene; Identifying whether the single nucleotide of the said SNP locus is A or G; Determining the genotype of the tested pig; Analyzing and judging that the carcass length of pigs with the AA genotype at the said SNP locus is longer than that of pigs with the AG genotype and pigs with the GG genotype; The carcass length of pigs with the AG genotype is longer than that of pigs with the GG genotype.
[0022] A primer composition for identifying an SNP locus associated with pig carcass traits, comprising an upstream primer and a downstream primer, and their nucleotide sequences are as follows:
[0023] Upstream primer: 5’-AGCTGATAGTTTGGAGTGAGAAGGA-3’;
[0024] Downstream primer: 5’-ACGGCAATGCCTGATCCTTA-3’;
[0025] The said SNP locus corresponds to position 17980764bp on chromosome 17 of the international pig reference genome version 11.1, within the PLCB4 gene. The carcass length of pigs with the AA genotype at this SNP locus is longer than that of pigs with the AG genotype and pigs with the GG genotype; The carcass length of pigs with the AG genotype is longer than that of pigs with the GG genotype.
[0026] The application of the foregoing primer composition in identifying the carcass length trait of pigs.
[0027] The application of the foregoing primer composition in screening pigs with longer carcass lengths.
[0028] The application of the foregoing primer composition in improving genetic assistant breeding of pig carcass length traits.
[0029] A kit for identifying an SNP locus associated with pig carcass length traits, the said kit comprising the foregoing primer composition.
[0030] Preferably, the foregoing kit further comprises at least one of PCR reaction buffer, Taq DNA polymerase, and dNTPs.
[0031] We found through experiments that the A\G locus at position 17980764 on chromosome 17 of pigs has a significant effect on pig carcass length. The nucleotide sequence of this locus is:
[0032]
[0033]
[0034] This SNP locus is named the (A / G) locus. The nucleotide type of the (A / G) locus can be G or A, and the genotypes can be GG, AA, or AG. The GG genotype is a homozygote with the nucleotide at the (A / G) locus being G. The AA genotype is a homozygote with the nucleotide at the (A / G) locus being A. The AG genotype is a heterozygote with the nucleotides at the (A / G) locus being G and A.
[0035] Based on this SNP locus, the present invention provides a method for identifying or assisting in the identification of the carcass length of pigs, and the present invention provides a method for screening pigs with a longer carcass length.
[0036] Identifying or assisting in the identification and screening of the carcass length of pigs according to the genotype includes at least one of the following:
[0037] (1) The carcass length of pigs with the AA genotype at the SNP locus is greater than the carcass length of the pigs to be tested with the AG or GG genotype at the SNP locus.
[0038] (2) The carcass length of pigs with the AG genotype at the SNP locus is greater than the carcass length of pigs with the GG genotype at the SNP locus.
[0039] The present invention can be used in pig breeding to select breeding pigs with a longer carcass. By PCR amplifying the gene fragment and sequencing the deoxyribonucleotide type at the 17980764th position on chromosome 17, the genotype of the SNP locus in the genome of the pigs to be tested is detected. Select pigs with the AA genotype at the SNP locus in the pig genome as parents for breeding to obtain offspring pigs with a longer carcass.
[0040] The present invention provides a primer composition for detecting the polymorphism or genotype of the SNP locus located at the 17980764th position on chromosome 17 in the pig genome, and also provides a kit including the foregoing primer composition. This primer composition can be used for:
[0041] (1) Products for identifying or assisting in the identification of the carcass length of pigs;
[0042] (2) Products for improving the carcass length trait of pigs;
[0043] (3) Products for pig breeding.
[0044] The present invention uses molecular breeding means to solve the problem of increasing the carcass length of pigs. By preferentially selecting the advantageous alleles of the above SNPs, the frequency of the advantageous alleles can be increased generation by generation, the carcass length of pigs can be increased, the genetic improvement and breeding of pigs can be accelerated, and the economic benefits of pig farms can be improved. Specific Embodiments
[0045] The present invention will be further described in detail below in conjunction with specific embodiments. The embodiments given are only for clarifying the present invention, rather than limiting the scope of the present invention. The following embodiments provided can be used as a guide for those of ordinary skill in the art to make further improvements, and do not limit the present invention in any way.
[0046] The experimental methods in the embodiments are all conventional methods unless otherwise specified, and are carried out according to the techniques or conditions described in the literature in this field or according to the product instructions. The materials, reagents, etc. used in the embodiments can be obtained from commercial channels unless otherwise specified.
[0047] In the embodiment, 526 Beijing Black pigs are from the laboratory Beijing Black pig meat quality trait measurement population.
[0048] The carcass length of the pigs in the embodiment is the carcass length of the pigs at 210 days of age.
[0049] In order to establish a method for assisting in the identification of pig carcass length, the following experiments were carried out.
[0050] I. Screening of the SNP locus at position 17980764 of chromosome 17 in pigs
[0051] Muscle tissues were collected from 526 Beijing Black pigs respectively, and genomic DNA was extracted. The upstream primer of sequence 3 was used: 5’-AGCTGATAGTTTGGAGTGAGAAGGA-3’
[0052] The downstream primer of sequence 4: 5’-ACGGCAATGCCTGATCCTTA-3’;
[0053] As amplification primers, PCR amplification was carried out using the genomic DNA of the pigs to be tested as the template DNA to obtain PCR products, and sequencing was performed. Alignment was carried out using Seqman software to obtain a differential locus, named the (A\G) locus. This locus is located at position 17980764 of chromosome 17 in pigs. The nucleotide type of the (A\G) locus is A or G, and the genotypes are AA, AG or GG. The AA genotype is a homozygote with the nucleotide of the (A\G) locus being A. The GG genotype is a homozygote with the nucleotide of the (A\G) locus being G. The AG genotype is a heterozygote with the nucleotides of the (A\G) locus being A and G.
[0054] II. Correlation analysis between the (A\G) locus at position 17980764 of chromosome 17 in pigs and pig carcass length
[0055] To determine whether the A / G locus at position 17980764 on Sus scrofa chromosome 17 is related to the carcass length of pigs, 526 Beijing Black pigs were individually amplified using upstream and downstream primers according to the above experimental method, and then sequenced after amplifying the pig genome to determine whether the (A / G) locus of each individual was AA genotype, AG genotype or GG genotype. The carcass length of each pig was measured, and correlation analysis was performed.
[0056] 1. Genotype
[0057] The AA genotype is a homozygote with nucleotide A at position 17980764 on Sus scrofa chromosome 17;
[0058] The GG genotype is a homozygote with nucleotide G at position 17980764 on Sus scrofa chromosome 17;
[0059] The AG genotype is a heterozygote with nucleotides A and G at position 17980764 on Sus scrofa chromosome 17.
[0060] Containing the nucleotide sequence at position 17980764 on Sus scrofa chromosome 17 is
[0061]
[0062] This SNP locus is named the (A / G) locus. The nucleotide type of the (A / G) locus can be A (see Sequence 1) or G (see Sequence 2), and the genotype can be AA, AG or GG. The AA genotype is a homozygote with nucleotide A at the (A / G) locus. The GG genotype is a homozygote with nucleotide G at the (A / G) locus. The AG genotype is a heterozygote with nucleotides A and G at the (A / G) locus.
[0063] The genotype detection results of the (A / G) locus of 526 Beijing Black pigs showed that 5 were AA genotype, 69 were AG genotype, and 452 were GG genotype. The genotype frequencies and allele frequencies of the pig (A / G) locus in the detected pig population are shown in Table 1:
[0064] Table 1. Genotype frequencies and allele frequencies of the pig (A / G) locus in the detected pig population
[0065]
[0066] It can be seen from Table 1 that the genotype frequency of the GG homozygous type is significantly higher than that of the AA homozygous type and the AG heterozygous type, and the G allele is the dominant gene.
[0067] 2. Correlation analysis between pig genotype and pig carcass length
[0068] Use a flexible ruler to measure the straight-line length from the anterior edge of the pubic symphysis of the carcass to the anterior edge of the first cervical vertebra, in cm. The measured data are shown in Table 2.
[0069] Table 2. Genotypes of individual Beijing Black pigs at the (A\G) locus and pig carcass length (cm) of 526 pigs
[0070]
[0071]
[0072] The SAS software was used for the association analysis between genotypes and phenotypes, and Duncan's multiple test was used for significance testing (P < 0.05). The data were expressed as mean ± standard error, and a significant difference was determined when P < 0.05. The results are shown in Table 3. The SNP (A\G) locus had a significant effect on pig carcass length. The carcass length of pigs with the AA genotype was significantly greater than that of pigs with the AG genotype, and the carcass length of pigs with the AG genotype was greater than that of pigs with the GG genotype. Therefore, in actual pig breeding, pigs with the AA genotype have longer carcasses.
[0073] Table 3. Single nucleotide polymorphism at position 17980764 on chromosome 17 of pigs and pig carcass length
[0074]
[0075] Note: Different lowercase letters in the table indicate significant differences (P < 0.05), and the same letters indicate no significant differences (P > 0.05). The values are expressed as mean ± standard error.
[0076] In summary, by determining the genotype of the (A\G) locus at position 17980764 on chromosome 17 of pigs, we can assist in identifying pig carcass length: the carcass length of pigs with the AA genotype is greater than that of pigs with the AG or GG genotype, and the carcass length of pigs with the AG genotype is greater than that of pigs with the GG genotype.
[0077] III. A method for assisting in identifying pig carcass length
[0078] Collect muscle tissue from the pigs to be tested and extract genomic DNA. Using the genomic DNA of the pigs to be tested as a template, perform PCR amplification with the upstream primer: 5’-AGCTGATAGTTTGGAGTGAGAAGGA-3’ and the downstream primer: 5’-ACGGCAATGCCTGATCCTTA-3’ to obtain a PCR product, and sequence the PCR product to obtain the genotype of the SNP (A\G) locus of the pigs to be tested.
[0079] The carcass length of the pigs to be tested with the AA genotype is greater than or is assisted to be greater than that of the pigs to be tested with the AG or GG genotype. The carcass length of the pigs to be tested with the AG genotype is greater than that of the pigs to be tested with the GG genotype.
[0080] IV. The present invention provides an SNP molecular marker that can effectively increase the carcass length of pigs. By using this SNP molecular marker for marker-assisted selection, the breeding process of related excellent traits can be accelerated. If all individuals with AG genotype and GG genotype in pigs are selected and bred into AA-type individuals, the carcass length trait of pigs will be improved. Among the SNP molecular marker individuals, the dominant allele AA of this SNP in the pig population can increase the carcass length of pigs, thereby increasing the benefits of enterprises.
[0081] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications made without departing from the spirit and principle of the present invention shall be regarded as equivalent replacement methods and are all included in the protection scope of the present invention.
Claims
1. Use of a reagent for detecting a SNP site associated with the Beijing black pig carcass length trait in identifying the Beijing black pig carcass length, characterized in that: The SNP site corresponds to the 17980764bp position of chromosome 17 of the international pig reference genome version 11.1, and is located in the PLCB4 gene; the polymorphism of the bases at this site affects the carcass length of the pig; The carcass length of the AA genotype pigs at the SNP site is longer than that of the AG genotype pigs and the GG genotype pigs; The carcass length of pigs with the AG genotype at the SNP site is longer than that of pigs with the GG genotype.
2. Use of a reagent for detecting SNP loci associated with the Beijing black pig carcass length trait in screening Beijing black pigs with longer carcasses, characterized in that: The SNP site corresponds to the 17980764bp position of chromosome 17 of the international pig reference genome version 11.1, and is located in the PLCB4 gene; the polymorphism of the bases at this site affects the carcass length of the pig; The carcass length of the AA genotype pigs at the SNP site is longer than that of the AG genotype pigs and the GG genotype pigs; The carcass length of pigs with the AG genotype at the SNP site is longer than that of pigs with the GG genotype.
3. Application of a reagent for detecting SNP loci associated with the Beijing black pig carcass length trait in improving the genetic breeding of Beijing black pig carcass length, characterized in that: The SNP site corresponds to the 17980764bp position of chromosome 17 of the international pig reference genome version 11.1, and is located in the PLCB4 gene; the polymorphism of the bases at this site affects the carcass length of the pig; The carcass length of the AA genotype pigs at the SNP site is longer than that of the AG genotype pigs and the GG genotype pigs; The carcass length of pigs with the AG genotype at the SNP site is longer than that of pigs with the GG genotype.
4. Use of a reagent for detecting SNP molecular markers associated with the Beijing black pig carcass length trait in identifying the Beijing black pig carcass length, characterized in that: The nucleotide sequence of the SNP molecular marker is: AGCTGATAGTTTGGAGTGAGAAGGATGGAAAATTGGAACTATTTAAATGTGCTTTTTCTTCATAGGCCACTCAGTGAAGCTGCAGTCTCTCATAATGTGTATTCTGTATTACCCGTGTAGCATTAGTTTTGAACAATGTTTGCCTTTTCAAAACCTGTGCACTTTATTTTTTTAACATTTTTGAATTTTTAAAAATTTTGGCCATGCCTGTAGCATGCAGAAGTTCCCAGA CCAGGGATAGAACCTGCAGAGCAGCAGTGACCTGAACCATAGCAGTGACAATGCCAGACCTTAACTGCTAGGCCACCA(A\G)GGAACTTCCAAACCTGTGCACTTCAAAAATAGTTACTCTACGGGAGTTCCTTTCGTGGCTCATTGGAAACGAATCTGACTAGTATCCCTGAGGATGCAGGTTCAATCCCTGGCCTTGTTCAGTGGGTTAAGGATCAGGCATTGCCGT The SNP site associated with the carcass length trait of Beijing black pigs is named (A\G) site. The nucleotide type of the (A\G) site is A or G, and the genotype is AA, AG or GG. The carcass length of AA genotype pigs is longer than that of AG genotype pigs and GG genotype pigs; the carcass length of AG genotype pigs is longer than that of GG genotype pigs.
5. Use of a reagent for detecting SNP molecular markers associated with the Beijing black pig carcass length trait in screening Beijing black pigs with longer carcass length, characterized in that: The nucleotide sequence of the SNP molecular marker is: AGCTGATAGTTTGGAGTGAGAAGGATGGAAAATTGGAACTATTTAAATGTGCTTTTTCTTCATAGGCCACTCAGTGAAGCTGCAGTCTCTCATAATGTGTATTCTGTATTACCCGTGTAGCATTAGTTTTGAACAATGTTTGCCTTTTCAAAACCTGTGCACTTTATTTTTTTAACATTTTTGAATTTTTAAAAATTTTGGCCATGCCTGTAGCATGCAGAAGTTCCCAGA CCAGGGATAGAACCTGCAGAGCAGCAGTGACCTGAACCATAGCAGTGACAATGCCAGACCTTAACTGCTAGGCCACCA(A\G)GGAACTTCCAAACCTGTGCACTTCAAAAATAGTTACTCTACGGGAGTTCCTTTCGTGGCTCATTGGAAACGAATCTGACTAGTATCCCTGAGGATGCAGGTTCAATCCCTGGCCTTGTTCAGTGGGTTAAGGATCAGGCATTGCCGT The SNP site associated with the carcass length trait of Beijing black pigs is named (A\G) site. The nucleotide type of the (A\G) site is A or G, and the genotype is AA, AG or GG. The carcass length of AA genotype pigs is longer than that of AG genotype pigs and GG genotype pigs; the carcass length of AG genotype pigs is longer than that of GG genotype pigs.
6. Use of a reagent for detecting SNP molecular markers associated with the Beijing black pig carcass length trait in improving the genetic breeding of Beijing black pig carcass length, characterized in that: The nucleotide sequence of the SNP molecular marker is: AGCTGATAGTTTGGAGTGAGAAGGATGGAAAATTGGAACTATTTAAATGTGCTTTTTCTTCATAGGCCACTCAGTGAAGCTGCAGTCTCTCATAATGTGTATTCTGTATTACCCGTGTAGCATTAGTTTTGAACAATGTTTGCCTTTTCAAAACCTGTGCACTTTATTTTTTTAACATTTTTGAATTTTTAAAAATTTTGGCCATGCCTGTAGCATGCAGAAGTTCCCAGA CCAGGGATAGAACCTGCAGAGCAGCAGTGACCTGAACCATAGCAGTGACAATGCCAGACCTTAACTGCTAGGCCACCA(A\G)GGAACTTCCAAACCTGTGCACTTCAAAAATAGTTACTCTACGGGAGTTCCTTTCGTGGCTCATTGGAAACGAATCTGACTAGTATCCCTGAGGATGCAGGTTCAATCCCTGGCCTTGTTCAGTGGGTTAAGGATCAGGCATTGCCGT The SNP site associated with the carcass length trait of Beijing black pigs is named (A\G) site. The nucleotide type of the (A\G) site is A or G, and the genotype is AA, AG or GG. The carcass length of AA genotype pigs is longer than that of AG genotype pigs and GG genotype pigs; the carcass length of AG genotype pigs is longer than that of GG genotype pigs.
7. A method for detecting the length trait of Beijing black pig carcass, characterized in that: The method comprises the following steps: detecting a SNP site located at 17980764bp of chromosome 17 of the international pig reference genome version 11.1 and located in the PLCB4 gene; identifying whether the single nucleotide at the SNP site is A or G; determining the genotype of the tested pig; analyzing and judging that the carcass length of the AA genotype pig at the SNP site is longer than that of the AG genotype pig and the GG genotype pig; The carcass length of AG genotype pigs was longer than that of GG genotype pigs.
8. Use of a primer composition for identifying a SNP site associated with the Beijing black pig carcass length trait in identifying the Beijing black pig carcass length trait, characterized in that: The primer composition comprises an upstream primer and a downstream primer, and the nucleotide sequence thereof is as follows: Upstream primer: 5′-AGCTGATAGTTTGGAGTGAGAAGGA-3′; Downstream primer: 5′-ACGGCAATGCCTGATCCTTA-3′; The SNP site corresponds to the 17980764bp position of chromosome 17 of the international pig reference genome version 11.1, and is located in the PLCB4 gene. The carcass length of AA genotype pigs at the SNP site is longer than that of AG genotype pigs and GG genotype pigs; the carcass length of AG genotype pigs is longer than that of GG genotype pigs.
9. Use of a primer combination for identifying SNP sites associated with the Beijing black pig carcass length trait in screening Beijing black pigs with longer carcass length, characterized in that: The primer composition comprises an upstream primer and a downstream primer, and the nucleotide sequence thereof is as follows: Upstream primer: 5′-AGCTGATAGTTTGGAGTGAGAAGGA-3′; Downstream primer: 5′-ACGGCAATGCCTGATCCTTA-3′; The SNP site corresponds to the 17980764bp position of chromosome 17 of the international pig reference genome version 11.1, and is located in the PLCB4 gene. The carcass length of AA genotype pigs at the SNP site is longer than that of AG genotype pigs and GG genotype pigs; the carcass length of AG genotype pigs is longer than that of GG genotype pigs.
10. Use of a primer combination for identifying SNP sites associated with the Beijing black pig carcass length trait in genetically assisted breeding to improve the Beijing black pig carcass length trait, characterized in that: The primer composition comprises an upstream primer and a downstream primer, and the nucleotide sequence thereof is as follows: Upstream primer: 5′-AGCTGATAGTTTGGAGTGAGAAGGA-3′; Downstream primer: 5′-ACGGCAATGCCTGATCCTTA-3′; The SNP site corresponds to the 17980764bp position of chromosome 17 of the international pig reference genome version 11.1, and is located in the PLCB4 gene. The carcass length of AA genotype pigs at the SNP site is longer than that of AG genotype pigs and GG genotype pigs; the carcass length of AG genotype pigs is longer than that of GG genotype pigs.