A CCDC171 gene molecular marker primer related to egg weight trait and its application

Abstract

The present invention relates to a CCDC171 gene molecular marker primer related to egg weight trait and its application, belonging to the field of biotechnology. The CCDC171 gene molecular marker of the present invention is located at the 32551904th base of chromosome Z of the chicken reference genome GRCg7b version, the base mutation is C or T, and the genotype is C / C and T / T. The egg weight of C / C genotype chickens is higher than that of T / T genotype individuals. The present invention utilizes forward and reverse primer pairs to amplify a fragment containing the above-mentioned molecular marker site, and performs Sanger sequencing on the amplified product, which can quickly and accurately identify the genotype of the individual; the molecular marker can be used as a genetic marker for chicken breeding, and chickens with appropriate egg weight can be selected; the egg weight trait can be efficiently and accurately detected, and the uniformity of egg weight of the chicken flock can be improved, which is of great value for chicken breeding and production.

Description

Technical Field

[0001] The invention relates to a CCDC171 gene molecular marker primer related to egg weight traits and application thereof, belonging to the field of biotechnology. Background Art

[0002] From the beginning of laying, the egg weight of the chicken will increase with the increase of the laying age. After reaching a certain value, the egg weight tends to stabilize, and the egg weight is positively correlated with body weight. Egg weight is strongly correlated with egg production, hatchability, and eggshell quality. Egg weight is negatively correlated with egg production. Too high egg weight will affect the egg production of chickens. Egg weight will also affect the birth weight of chicks. The egg weight of breeding eggs is strongly positively correlated with the birth weight of chicks. In addition, too high or too low egg weight will significantly affect the fertilization rate and hatchability of breeding eggs. Egg weight will affect the quality of eggshells. Too high egg weight will reduce the thickness of the eggshell and increase the egg breakage rate. Therefore, the selection and breeding of egg weight and uniformity is conducive to improving the fertilization rate and hatchability of breeding eggs, improving the quantity and quality of eggs produced during the laying cycle, and is conducive to the production and sale of chicks. Breeding after the egg weight is stable not only has a long breeding cycle, but also generates a considerable waste of feeding costs. Therefore, the use of molecular markers to accurately identify genotypes that affect egg weight at an early stage and apply them to early breeding selection can speed up the breeding cycle and reduce time and feeding costs. The CCDC171 gene is significantly associated with cholesterol intake. Studies have shown that it can disrupt the binding activity of miRNAs to their targets in an allele-specific manner and increase human BMI values. The egg weight trait is positively correlated with the chicken body weight trait, so CCDC171 may be a key gene affecting the egg weight trait. Summary of the invention

[0003] The purpose of the present invention is to study the relationship between the CCDC171 gene and the egg weight trait in view of the defects of the prior art, and to propose a CCDC171 gene molecular marker primer related to the egg weight trait and its application to quickly detect and screen the egg weight of chickens at multiple stages.

[0004] The present invention measures the egg weight of hens, uses whole genome resequencing technology to perform SNP genotyping, and screens the CCDC171 gene molecular marker that is significantly correlated with the egg weight trait through whole genome association analysis, providing new gene and molecular marker resources for the breeding of egg weight traits in chickens at different stages.

[0005] The present invention solves the technical problem through the following technical scheme: firstly, a CCDC171 gene molecular marker primer related to the multi-stage egg weight trait of chicken is provided, the nucleotide sequence of the molecular marker primer is shown in SEQ ID NO:1 and SEQ ID NO:2, the molecular marker is located at the 32551904th base on chromosome Z of the chicken reference genome GRCg7b version, and the base is mutated to C or T. The sequence is shown in SEQ ID NO:3 or SEQ ID NO:4 at the 169th base.

[0006] The present invention further provides an application of the above molecular marker primers for detecting SNP genotypes related to egg weight traits during laying period of chickens. The detection method comprises the following steps:

[0007] The first step is to provide a chicken DNA sample to be tested, and perform PCR amplification using a molecular marker primer pair to obtain an amplification product, wherein the amplification product is 401 bp in length and contains the 32551904th base of chicken chromosome Z;

[0008] Step 2: Sanger sequencing of the PCR product;

[0009] The third step is to determine the genotype of the SNP molecular marker at base 32551904 of chicken chromosome Z based on the sequencing results of the second step.

[0010] Wherein, the deoxyribonucleotide sequence of the molecular marker primer pair described in the first step is:

[0011] Upstream primer: 5'-TGGCTGTTCTGATAGTTTCACA-3' (SEQ ID NO: 1)

[0012] Downstream primer: 5'-AAGTGCTGGAACCTGTGACC-3' (SEQ ID NO: 2)

[0013] The final concentration of the reaction system is 25 μl.

[0014] Chicken DNA to be tested 50 ng

[0015] 2 x Accurate Taq Master Mix 12.5 μl

[0016] Upstream primer 1 μl

[0017] Downstream primer 1 μl

[0018] Add sterile water to 25 μl.

[0019] The reaction conditions of the PCR amplification are: pre-denaturation at 94°C for 5 minutes; denaturation at 94°C for 30 seconds, annealing at 55°C for 30 seconds, extension at 72°C for 60 seconds, for a total of 30 cycles; extension at 72°C for 2 minutes; storage at 4°C; the nucleotide sequence of the amplified product is shown in SEQ ID NO: 3 or SEQ ID NO: 4, the amplified product is 401 bp in length, and contains the 32551904th base of chicken chromosome Z.

[0020] In the third step, the judgment criterion is that the egg weight of the chicken with C / C genotype at the SNP site is higher than that of the chicken with T / T genotype.

[0021] The present invention detects the genotype of the egg weight trait through the CCDC171 gene molecular marker, and it is concluded that the egg weight of the C / C genotype individual is higher than that of the T / T genotype individual. The genomic DNA of the chicken to be tested is used as a template, and PCR amplification is performed on it using specific primers, and then the PCR amplification product is subjected to Sanger sequencing and SNP molecular marker genotyping. The genotype based on the SNP molecular marker can realize the selection of the egg weight trait of the chicken in each period. In breeding, according to the breeding goal, the T / T genotype individuals can be eliminated and the C / C genotype individuals can be retained. The beneficial effect is that the molecular marker can be used as a genetic marker for chicken breeding to select chickens with larger and uniform egg weight; the egg weight trait of the chicken during the laying period can be efficiently and quickly identified, and the uniformity of the egg weight of the chicken flock can be improved, which provides a scientific basis for the early selection of chickens and has important value for chicken breeding. In addition, the detection method disclosed in the present invention is simple and easy to operate, and can be carried out in the laboratory. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 This is the Manhattan plot of the correlation analysis of egg weight in three periods of chickens.

[0023] Figure 2 These are the Sanger sequencing results of the PCR amplification products of the two genotypes. DETAILED DESCRIPTION

[0024] The following embodiments are applicable to chicken breeding, and the breeds of chickens cited are not limited to the following embodiments.

[0025] Example 1

[0026] In this example, the egg weight of recessive White Rock hens at 31 weeks, 37 weeks and 52 weeks of age was measured, and whole-genome SNP genotyping was performed using second-generation sequencing technology. The CCDC171 gene molecular marker significantly associated with egg weight was screened through whole-genome association analysis. The results are as follows: Figure 1 shown.

[0027] In this example, the following experiment was conducted to identify and apply the CCDC171 gene molecular marker related to the egg weight trait.

[0028] 1. Phenotypic and genotypic testing

[0029] (1) Experimental materials and egg weight phenotype determination

[0030] A total of 2291 recessive White Rock hens were selected as experimental animals and raised under the same feeding conditions with free access to feed and water throughout the process. The egg weight data were recorded at 31 weeks, 37 weeks, and 52 weeks of age.

[0031] (2) Extraction of genomic DNA

[0032] Blood was collected from the subwing vein of the individual to be tested, lysed after anticoagulation, digested with proteinase K, extracted with saturated sodium chloride method, dissolved in TE and stored at -20℃.

[0033] (3) PCR amplification

[0034] Using the genomic DNA extracted as above as a template, a fragment containing the 32551904th base of chromosome Z was amplified.

[0035] Upstream primer: 5'-TGGCTGTTCTGATAGTTTCACA-3' (SEQ ID NO: 1)

[0036] Downstream primer: 5'-AAGTGCTGGAACCTGTGACC-3' (SEQ ID NO: 2)

[0037] The final concentration of the reaction system (25 μl) is:

[0038] DNA to be tested 50 ng

[0039] 2 x Accurate Taq Master Mix 12.5 μl

[0040] Upstream primer 1 μl

[0041] Downstream primer 1 μl

[0042] Add sterile water to 25 μl.

[0043] The reaction conditions of PCR amplification are: 94℃ pre-denaturation for 5min; 94℃ denaturation for 30sec, 55℃ annealing for 30sec, 72℃ extension for 60sec, 30 cycles in total; 72℃ extension for 2min; 4℃ storage; 10μl was taken for agarose detection, and a single target band with a length of 401bp was amplified, containing the SNP molecular marker at the 32551904th base site of chicken chromosome Z. The sequence of the amplified product is as follows:

[0044] SEQ ID NO:3

[0045] TGGCTGTTCTGATAGTTTCACAGTTGTCCTTTGTTTAAGGAATAGGTCAGGGTAACATCCCAAGTGGTATACTACTGAAATGAAACTCAGAGAGGATGAGTTTAGAAGTTAATTTTTTCCCTCAAATGTGACCAATTTGCCACATATTTGTTGCCTATATATGAAGAACCTGTGTGTGTGTGTGCGCGCGCGTGCACATGCATGTGGTGTGTGTATTAGTAAATTGTAGCTTACCAATTCACATATCTTCTTAACTAAGAGTTTTCTCTTTTACACAGTTATCTTGCAGAAATTATGATCAAGTGCATGCAAACTAATATCTTGATTTTTCAGTTACTGAATTCTTTGATGGTCTAGTGATAAGTACTGTTTACATCCTAAGGTCACAGGTTCCAGCACTT

[0046] SEQ ID NO:4

[0047] TGGCTGTTCTGATAGTTTCACAGTTGTCCTTTGTTTAAGGAATAGGTCAGGGTAACATCCCAAGTGGTATACTACTGAAATGAAACTCAGAGAGGATGAGTTTAGAAGTTAATTTTTTCCCTCAAATGTGACCAATTTGCCACATATTTGTTGCCTATATATGAAGAATCTGTGTGTGTGTGTGCGCGCGCGTGCACATGCATGTGGTGTGTGTATTAGTAAATTGTAGCTTACCAATTCACATATCTTCTTAACTAAGAGTTTTCTCTTTTACACAGTTATCTTGCAGAAATTATGATCAAGTGCATGCAAACTAATATCTTGATTTTTCAGTTACTGAATTCTTTGATGGTCTAGTGATAAGTACTGTTTACATCCTAAGGTCACAGGTTCCAGCACTT

[0048] (4)Sanger Sequencing and Genotyping

[0049] The PCR products of each sample were subjected to Sanger sequencing, and the sequencing peaks of different genotypes were obtained as shown in Figure 2 shown.

[0050] 2. Correlation Analysis

[0051] Recessive White Lock hens with clear records of egg weight phenotype were selected for correlation analysis. The collected egg weight data were statistically tested using the ANOVA test function of the R 4.2 statistical drawing software, and the pairwise mean comparison mode was selected to perform statistical tests on the genotypes of the experimental chickens and the egg weight traits at each period. P<0.05 indicated significant differences, and the results are shown in Table 1. The average egg weight of C / C genotype individuals at 31 weeks of age was 52.98g, which was higher than 51.94g of T / T genotype individuals (P<0.05); the average egg weight of C / C genotype individuals at 37 weeks of age was 58.45g, which was higher than 57.45g of T / T genotype individuals (P<0.05); the average egg weight of C / C genotype individuals at 52 weeks of age was 62.86g, which was higher than 61.46g of T / T genotype individuals (P<0.05). The results showed that the chicken CCDC171 gene molecular marker was significantly correlated with the egg weight phenotype. According to the actual breeding goals, C / C genotype individuals can be selected to breed chickens with larger egg weight, thereby improving the overall egg weight and uniformity and improving the breeding efficiency.

[0052] Table 1. Association analysis between CCDC171 gene molecular markers and egg weight phenotypes at different stages

[0053]

[0054] Note: For the data in the same period and the same column, the same letters indicate no significant difference, and different letters indicate significant difference (P<0.05).

[0055] Example 2

[0056] Genotype frequencies of different varieties

[0057] 1. Blood Sample Collection

[0058] Blood samples from 12 breeds, including Bailehang laying hens, big bone chickens, Daweishan miniature chickens, Wuding chickens, Liao chickens, bearded chickens, Tibetan chickens, Camellia chickens, Fujian Hetian chickens, Liyang chickens, Xinghua chickens and Guangxi Sanhuang chickens, were collected by subwing vein blood collection and stored at -20℃ for future use.

[0059] 2. Extraction of Genomic DNA

[0060] Take the blood sample obtained in step 1 and use the Omega genomic DNA extraction kit to extract genomic DNA. The specific method refers to the standard operating procedure provided by Omega.

[0061] 3. Genotype detection

[0062] Using the genomic DNA obtained in step 2 as a template, a primer pair consisting of an F nucleotide sequence (SEQ ID NO: 1) and an R nucleotide sequence (SEQ ID NO: 2) was used for PCR amplification and Sanger sequencing to obtain the individual's T / T genotype and C / C genotype.

[0063] 4. Results Analysis

[0064] White Leghorn laying hens are a common commercial laying hen breed with high egg production rate and moderate and uniform egg weight. Big bone chicken, Daweishan miniature chicken, Wuding chicken, gourd chicken, bearded chicken, Tibetan chicken, Camellia chicken, Fujian Hetian chicken, Liyang chicken, Xinghua chicken and Guangxi Sanhuang chicken are well-known local chicken breeds in China. This locus is polymorphic in all 12 populations described. Among them, White Leghorn laying hens, as the most common fine breed laying hens, have been selected for the egg weight trait for a long time, and the egg weight throughout the whole period is more uniform, especially the egg weight uniformity in the later period is higher than that of other types of chickens, see Table 2. These results can all confirm that this SNP locus can be widely used as a molecular marker for egg weight traits.

[0065] Table 2. Distribution of allele frequencies of CCDC171 gene molecular markers in different varieties

[0066]

[0067] In addition to the above implementations, the present invention may also have other implementations. Any technical solution formed by equivalent replacement or equivalent transformation falls within the protection scope required by the present invention.

Claims

1. An application of a detection primer for a CCDC171 gene SNP site associated with egg weight, characterized in that: The detection primers are used to detect the egg weight trait. The nucleotide sequences of the detection primers are shown in SEQ ID NO: 1 and SEQ ID NO:

2. The SNP site is located at the 32551904th base on chromosome Z of the chicken reference genome GRCg7b version, and the base mutation is C or T. The egg weight of chickens with C / C genotype at the SNP site is higher than that of individuals with T / T genotype.

2. The use of the detection primers for the CCDC171 gene SNP site associated with the egg weight trait according to claim 1, characterized in that: The detection method comprises the following steps, The first step is to provide a chicken DNA sample to be tested, and perform PCR amplification with the detection primers to obtain an amplified product, wherein the amplified product is 401 bp in length and contains the 32551904th base of chromosome Z of the chicken reference genome GRCg7b version; The second step is to perform Sanger sequencing on the PCR product; The third step is to determine the genotype of the SNP site at base 32551904 on chromosome Z of the chicken reference genome GRCg7b version based on the sequencing results of the second step.

3. The use of the detection primers for the CCDC171 gene SNP site associated with the egg weight trait according to claim 2, characterized in that: The final volume of the reaction system was 25 μl. Chicken DNA to be tested 50 ng 2 x Accurate Taq Master Mix 12.5 μl Upstream primer 1 μl Downstream primer 1 μl Add sterile water to 25 μl; The reaction conditions of the PCR amplification are: 94°C pre-denaturation for 5 min; 94°C denaturation for 30 sec, 55°C annealing for 30 sec, 72°C extension for 60 sec, a total of 30 cycles; 72°C extension for 2 min; 4°C storage; the nucleotide sequence of the amplified product is shown in SEQ ID NO: 3 or SEQ ID NO: 4.

Images