InDel Molecular Markers for Identifying Yuanxiaochun Hybrid Citrus and Their Applications
By designing InDel molecular marker and its primer pair A21-F/R, and using PCR amplification and electrophoresis technology, the problem of difficult to distinguish between Yuan Xiaochun tangerine during the seedling stage is solved, and the early accurate identification and correctness of seedling varieties are achieved.
Patent Information
- Application Number
- CN202411670541.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-21
- Publication Date
- 2025-07-22
- Estimated Expiration
- 2044-11-21
AI Technical Summary
It is difficult to accurately distinguish between Yuanxiaochun mixed tangerines and other mixed tangerine varieties during the seedling stage, resulting in serious losses for growers and chaotic seedlings.
An InDel molecular marker and its primer pair A21-F/R were designed, and agarose gel electrophoresis was used to distinguish between Yuanxiaochun tangerine from other citrus varieties using a 519bp band, providing an early accurate identification method.
It has achieved rapid and accurate identification of Yuan Xiaochun tangerines during the seedling stage, reducing the breeding workload and ensuring the correctness of seedling varieties.
Smart Images

Figure CN119287064B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of citrus molecular markers, and in particular to an InDel molecular marker for identifying Yuanxiaochun hybrid citrus and an application thereof. Background Art
[0002] Yuan Xiaochun is an excellent hybrid citrus variety introduced from Japan. It was hybridized by Kiyomi and Golden Orange in the Ehime Fruit Tree Experimental Field in Japan in 1994, and applied for Japanese variety registration in 2007. Yuan Xiaochun fruit is spherical, slightly smooth, light lemon yellow, and easy to peel. The single fruit weighs about 125 grams, the flesh is soft and juicy, with a special aroma, and no seeds. When fully mature, the soluble solids are more than 15%, the acid is less than 0.8%, the quality is excellent, and the yield is high and stable. In recent years, it has been very popular among consumers and growers.
[0003] Yuan Xiaochun belongs to the category of hybrid citrus in the citrus classification. Its leaves are very similar to those of hybrid citrus varieties such as Shiranui, Harumi, and Haruhime. It is difficult to distinguish them from the morphology at the seedling stage. This gives some merchants an opportunity to pass off other hybrid citrus varieties as Yuan Xiaochun, seriously damaging the rights and interests of growers. If DNA molecular markers can be used to achieve early selection at the seedling stage, it will greatly reduce the losses of growers and reduce the occurrence of "substituting inferior products for good ones" and seedling confusion. Summary of the invention
[0004] The purpose of the present invention is to overcome the shortcomings of the prior art and provide an InDel molecular marker for identifying Yuan Xiaochun hybrid citrus and its application; the present invention can directly judge the genotype of each material from the gel map, so as to quickly identify whether the hybrid citrus variety is Yuan Xiaochun in the seedling stage, overcoming the shortcomings of traditional phenotypic identification that is time-consuming, labor-intensive and has a low accuracy rate.
[0005] To achieve the above purpose, the technical solution designed by the present invention is as follows:
[0006] The present invention provides an InDel molecular marker for identifying Yuanxiaochun hybrid citrus, and the nucleotide sequence of the InDel molecular marker is as shown in SEQ ID No.1:
[0007] TAGCTAACAAGTAATTAATCAATATAACAACAGTATGTGGTGTGACTGTCCTTCACAACAGTTTTTTTTTTTTTTCTTTTAATCACGAAATATTTGGAAAGGACCTTCGTTATAAAAGGCATCTTTAAATTCGGATCATAATTTAAATTAAAAATCCCTACTTGAATAAAAAAATACAAATTCTCCCAATAAAAATAATTTCACTGTAATTCAAACTGATAAATAAACTAAATCAAATTACTCAAAGAAGCTCCATTATCAACGGAGCCAACTCTTTATCGGTCCTTCACAACAGTTGTTAAATAGCTAACAACTCACC。
[0008] Primer pair A21-F / R for obtaining the above InDel molecular marker, characterized in that: the primer pair A21-F / R is as follows:
[0009] Forward primer A21-F: ATTGACCATTCAAACGTTGCTCTT, as shown in SEQ ID No.2;
[0010] Reverse primer A21-R: CAAATTGATGACGTGTCCTTCACA, as shown in SEQ ID No.3.
[0011] The present invention also provides an application of the above primer pair A21-F / R in identifying Yuanxiaochun hybrid citrus or preparing a kit for identifying Yuanxiaochun hybrid citrus.
[0012] Based on the whole-genome resequencing results, the present invention develops the above 1 polymorphic InDel marker primer. Using this 1 pair of primers, Yuanxiaochun hybrid citrus can be distinguished from other citrus varieties, providing a basis for the early and accurate identification of Yuanxiaochun hybrid citrus varieties.
[0013] The present invention also provides a kit for identifying Yuanxiaochun hybrid citrus, and the kit contains the above primer pair A21-F / R.
[0014] The present invention also provides a method for identifying Yuanxiaochun hybrid citrus, comprising the following steps:
[0015] 1) Extract the genomic DNA of the sample to be tested,
[0016] 2) Using the above genomic DNA as a template, perform PCR amplification with the above primer pair A21-F / R or the kit described in claim 4; obtain a PCR product;
[0017] 3) Detection of PCR products by electrophoresis, and the test results are analyzed as follows:
[0018] When a 519-bp band 1 is shown, and the band 1 contains the InDel molecular marker (the nucleotide sequence is as shown in SEQ ID No. 1), then the variety to be tested is Yuanxiaochun hybrid citrus.
[0019] When any small fragment band less than 300 bp or two small fragment bands are shown, the variety to be tested is other citrus varieties; among them, the two small fragment bands are band 2 of 277 bp and band 3 of 226 bp respectively.
[0020] Further, in the step 2), the PCR amplification system is as follows:
[0021] Mix solution 7 μl Forward primer A21-F (10 mmol / L) 0.3 μl Reverse primer A21-R (10 mmol / L) 0.3 μl Genomic DNA 1.5 μl <![CDATA[dd H2O]]> 5.9 μl Total 15 μl
[0022] The PCR amplification program includes: pre-denaturation at 94 °C for 5 min; denaturation at 94 °C for 30 s, annealing at 55 °C for 30 s, extension at 72 °C for 30 s, and the reaction is carried out for 35 cycles; extension at 72 °C for 5 min again.
[0023] When using the primer set or kit of the present invention for the identification, by using PCR amplification and agarose gel electrophoresis, when the primer with a clear gel image and a size exactly consistent with the prediction is retained (i.e., a 519-bp band, containing the InDel molecular marker, and its nucleotide sequence is as shown in SEQ ID No. 1), then the variety to be tested is Yuanxiaochun hybrid citrus; when one or two bands less than 300 bp are visible in the primer amplification, it indicates that the variety to be tested is other citrus varieties, and there are size differences distinguishable in the gel image, and thus it can be determined as a marker with good effect that can be used. The agarose gel electrophoresis of the present invention preferably uses an agarose gel with a mass percentage of 2%, a voltage of 120 V, and electrophoresis for 15 - 20 min.
[0024] The present invention also provides an application of the above primer pair A21-F / R or the above kit in the early identification of Yuanxiaochun hybrid citrus.
[0025] The primer set or kit of the present invention can be applied to early identification, and it can be carried out by using the young and tender leaves of young trees. Therefore, the genomic DNA is preferably extracted from young and tender leaves. The present invention does not have special limitations on the method for extracting the genomic DNA, and preferably uses the CTAB method or the kit method.
[0026] The present invention also provides an application of the above primer pair A21-F / R or the above kit in the breeding of hybrid citrus.
[0027] The beneficial effects of the present invention:
[0028] The present invention successfully obtains an InDel marker for identifying Yuanxiaochun hybrid citrus. The present invention performs PCR amplification through a primer pair. The product of Yuanxiaochun hybrid citrus is a long band of 519 bp, and the products of other hybrid citrus are a short band of 226 bp or 277 bp or both. Using the marker to identify Yuanxiaochun hybrid citrus seedlings can reduce the workload of breeding and ensure the correctness of seedling varieties. BRIEF DESCRIPTION OF THE DRAWINGS
[0029] Figure 1 The electrophoresis diagram of PCR products of 48 samples to be tested is shown in Figure 2.
[0030] In the picture, 1 represents 439 orange; 2 represents Hime Koharu; 3 represents seedless orange; 4 represents Asumimi; 5 represents Ehime 68; 6 represents Ehime 46; 7 represents Haruhime; 8 represents Ehime 28; 9 represents Kiyomi; 10 represents Sunshine One tangerine; 11 represents Amakusa; 12 represents Tsu no Kashi; 13 represents Yoka; 14 represents Nishi no Kashi; 15 represents Ganpei; 16 represents Golden Autumn Sugar Mandarin; 17 represents Qiuhui; 18 represents Nichiki; 19 represents W. Murcott; 20 represents Wogan; 21 represents Shiranui; 22 represents Harumimi; 23 represents Ehime 34; 24 represents Haruka tangerine; 25 represents The first one is Ou tangerine; 26 is tangerine; 27 is Mantouhong Zhuju; 28 is Rinan No. 1; 29 is Siji tangerine; 30 is Hongguang; 31 is Kishu; 32 is Xingjin; 33 is Miguang; 34 is Zhuhong tangerine; 35 is Yamashitahong; 36 is Shatang tangerine; 37 is Oita No. 1; 38 is Nangan No. 20; 39 is Shuangjin No. 1; 40 is Dapu No. 5; 41 is Xinyu Mitangerine; 42 is Sanhu Hongtangerine; 43 is Sanhu Huahong; 44 is Ponkan; 45 is Zhuju; 46 is Jiangan; 47 is Yangxiao 26; 48 is Gongchuan. Numbers 1-24 are hybrid tangerine varieties, and numbers 25-48 are wide-skinned tangerine varieties. DETAILED DESCRIPTION
[0031] The present invention is further described in detail below in conjunction with specific embodiments so that those skilled in the art can understand.
[0032] Example 1
[0033] Based on the results of whole genome resequencing, compared with the genomes of other varieties, Yuan Xiaochun hybrid orange was found to have a highly polymorphic unique fragment at 23272035bp on chromosome 7. This fragment was named InDel molecular marker, and its nucleotide sequence is shown in SEQ ID No. 1:
[0034] TAGCTAACAAGTAATTAATCAATATAACAACAGTATGTGGTGTGACTGTCCTTCACAACAGTTTTTTTTTTTTTTCTTTTAATCACGAAATATTTGGAAAGGACCTTCGTTATAAAAGGCATCTTTAAATTCGGATCATAATTTAAATTAAAAATCCCTACTTGAATAAAAAAATACAAATTCTCCCAATAAAAATAATTTCACTGTAATTCAAACTGATAAATAAACTAAATCAAATTACTCAAAGAAGCTCCATTATCAACGGAGCCAACTCTTTATCGGTCCTTCACAACAGTTGTTAAATAGCTAACAACTCACC。
[0035] Example 2
[0036] The primer pair designed for the above InDel molecular marker:
[0037] Forward primer A21-F: ATTGACCATTCAAACGTTGCTCTT, as shown in SEQ ID No.2;
[0038] Reverse primer A21-R: CAAATTGATGACGTGTCCTTCACA, as shown in SEQ ID No.3.
[0039] The primers synthesized by Wuhan Tianyi Huiyuan Biotechnology Co., Ltd. were used to perform PCR amplification with the genomic DNA of Encore hybrid citrus as the template. After electrophoresis detection of the PCR products, when a single 519-bp band 1 was detected, this band 1 contained the InDel molecular marker (the nucleotide sequence is as shown in SEQ ID No.1), and the nucleotide sequence of this band 1 is as shown in SEQ ID No.4:
[0040] ATTGACCATTCAAACGTTGCTCTTTATATTAATATCCGCCTTCGACTTTTGCAAAAAAAAATTACGGCCGGCGGTCCAACAAGACGATCGCTCCGTTCATACATCTCCAAATCCAAACTCGTTAATGTGACGTCATCGTGTAAATAGCTAACAAGTAATTAATCAATATAACAACAGTATGTGGTGTGACTGTCCTTCACAACAGTTTTTTTTTTTTTTCTTTTAATCACGAAATATTTGGAAAGGACCTTCGTTATAAAAGGCATCTTTAAATTCGGATCATAATTTAAATTAAAAATCCCTACTTGAATAAAAAAATACAAATTCTCCCAATAAAAATAATTTCACTGCAATTCAAACTGATAAATAAACTAAATCAAATTACTCAAAGAAGCTCCATTATCAACGGAGCCAACTCTTTATCGGTCCTTCACAACAGTTGTTAAATAGCTAACAACTCACCCGGCTTCAAGTCATTAATCAATTACAACAGCATGTGAAGGACACGTCATCAATTTG。
[0041] Example 3
[0042] A kit for identifying Harumikan mandarin contains the primer pair of the above Example 2.
[0043] A method for identifying Harumikan mandarin based on the kit includes the following steps:
[0044] 1) Extract the genomic DNA of the sample to be tested,
[0045] 2) Using the above genomic DNA as a template, perform PCR amplification with the primer pair; obtain the PCR product; wherein,
[0046] The system of PCR amplification is as follows:
[0047] Mix solution 7 μl Forward primer F (10 mmol / L) 0.3 μl Reverse primer R (10 mmol / L) 0.3 μl Genomic DNA 1.5 μl <![CDATA[dd H2O]]> 5.9 μl Total 15 μl
[0048] The program of PCR amplification includes: pre-denaturation at 94 °C for 5 min; denaturation at 94 °C for 30 s, annealing at 55 °C for 30 s, extension at 72 °C for 30 s, and the reaction is carried out for 35 cycles; extension at 72 °C for another 5 min;
[0049] 3) Electrophoresis detection of PCR products (using agarose gel with a mass percentage of 2%, voltage 120V, electrophoresis for 15 - 20 min), and the test results are analyzed as follows:
[0050] When a 519 - bp band 1 is shown, the band 1 contains the InDel molecular marker (the nucleotide sequence is as shown in SEQ ID No.1), then the variety to be tested is Yuanxiaochun hybrid citrus.
[0051] When any small - fragment band or two small - fragment bands are shown, the variety to be tested is other citrus varieties; among them, the two small - fragment bands are band 2 with 298 bp and band 3 with 350 bp respectively;
[0052] The nucleotide sequence of the 226 - bp band 2 is as shown in SEQ ID No.5:
[0053] ATTGACCATTCAAACGTTGCTCTTTATATTAATATCCGCCTTCGACTTTTGCAAAAGAAATTACGGCCGGCGGTCCAACATGACGATCGCTCCGTTCATACATCTCCAAATCCAAACTCGTTAATGTGACGTCATCGTGTAAACAGTTGTTAAATACCTAACAACTCACGCGGCTTCAAGTCATTAATCAATTACAACAGCATGTGAAGGACACGTCATCAATTTG;
[0054] The nucleotide sequence of the 277 - bp band 3 is as shown in SEQ ID No.6:
[0055] ATTGACCATTCAAACGTTGCTCTTTATATTAATATCCGCCTTCGACTTTTGCAAAAGAAATTACGGCCGGCGGTCCAACATGACGATCGCTCCGTTCATACATCTCCAAATCCAAACTCGTTAATGTGACGTCATCGTGTAAATAGCTAACAAGTAATTAATCAATAACAACAGTATGTGACTGTCCTTCACAACAGTTGTTAAATACCCAACAACTCACGCGGCTTCAAGTCATTAATCAATTACAACAGCATGTGAAGGACACGTCATCAATTTG.
[0056] Example 4
[0057] The kit of Example 3 was used to detect Enatsu hybrid citrus, other hybrid citrus varieties, and common citrus fruits. The specific steps are as follows:
[0058] 1) Extract the genomic DNA of the leaves of Enatsu hybrid citrus, other hybrid citrus varieties, and common citrus fruits.
[0059] 2) Using the above genomic DNA as a template, perform PCR amplification with a primer pair to obtain a PCR product. Among them,
[0060] The system for PCR amplification is as follows:
[0061] Mix solution 7 μl Forward primer F (10 mmol / L) 0.3 μl Reverse primer R (10 mmol / L) 0.3 μl Genomic DNA 1.5 μl <![CDATA[dd H2O]]> 5.9 μl Total 15 μl
[0062] The procedure for PCR amplification includes: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 30 s, and performing 35 cycles; re-extension at 72°C for 5 min.
[0063] 3) Detect the PCR product by electrophoresis (using a 2% agarose gel by mass percentage, voltage 120 V, electrophoresis for 15 - 20 min). The test results are analyzed as follows:
[0064] The results are as Figure 1 shown: The bands of the PCR products in other lanes are all 226 bp bands and / or 277 bp bands, which correspond to other citrus varieties (including hybrid citrus varieties and common citrus fruits). Only in lane 2, a 519 bp fragment band was amplified, which is Enatsu hybrid citrus. Thus, it can be determined as a marker with good effects that can be used.
[0065] Other parts not described in detail are all prior arts. Although the above embodiments have described the present invention in detail, they are only a part of the embodiments of the present invention, rather than all embodiments. People can also obtain other embodiments based on this embodiment without creative efforts, and these embodiments all fall within the protection scope of the present invention.
Claims
1. An InDel molecular marker for identifying Encore Satsuma Mandarin, characterized in that: The nucleotide sequence of the InDel molecular marker is as shown in SEQ ID No.
1.
2. Primer pair A21-F / R for obtaining the InDel molecular marker according to claim 1, characterized in that: The primer pair A21-F / R is as follows: Forward primer A21-F: ATTGACCATTCAAACGTTGCTCTT, as shown in SEQ ID No. 2; Reverse primer A21-R: CAAATTGATGACGTGTCCTTCACA, as shown in SEQ ID No.
3.
3. Use of the primer pair A21-F / R according to claim 2 in identifying Citrus reticulata Blanco cv. Yuanxiaochun or in preparing a kit for identifying Citrus reticulata Blanco cv. Yuanxiaochun.
4. A kit for identifying Encore Satsuma mandarin, characterized in that: The kit contains the primer pair A21-F / R according to claim 2.
5. A method for identifying Encore Satsuma mandarin, characterized in that: It includes the following steps: 1) Extract the genomic DNA of the sample to be tested, 2) Using the above genomic DNA as a template, perform PCR amplification with the primer pair A21-F / R according to claim 2 or the kit according to claim 4; obtain a PCR product; 3) Detect the PCR product by electrophoresis, and the test results are analyzed as follows: When a 519bp band is shown, the InDel molecular marker is contained in the band, and the variety to be tested is Citrus reticulata Blanco cv. Yuanxiaochun; When any small fragment band less than 300bp or two small fragment bands are shown, the variety to be tested is other citrus varieties.
6. The method according to claim 5, wherein: In step 2), the PCR amplification system is as follows: The PCR amplification program includes: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 30 s, and the reaction is carried out for 35 cycles; then extension at 72°C for 5 min.
7. Use of the primer pair A21-F / R according to claim 2 or the kit according to claim 4 in the early identification of Citrus reticulata Blanco cv. Yuanxiaochun.
Citation Information
Patent Citations
InDel molecular marker for identifying citrus chachiensis and application of InDel molecular marker
CN113355448A
Identification method, identification kit for citrus varieties, and nucleic acid detection device
JP2024083314A