Method for detecting lentivirus titer by double-standard-curve RT-qPCR (real-time quantitative polymerase chain reaction) method

Abstract

The invention belongs to the technical field of biological detection, and relates to a method for detecting lentivirus titer by a double-standard-curve RT-qPCR (Reverse Transcription-Quantitative Polymerase Chain Reaction) method. Infecting the target cells by adopting a to-be-detected sample containing a recombinant lentivirus, and collecting and extracting genome DNA of the infected target cells; carrying out a viral genome RT-qPCR amplification reaction and an internal reference genome RT-qPCR amplification reaction by respectively taking the original virus standard substance and the internal reference standard substance which are diluted in a gradient manner and the extracted target cell genome DNA as templates; and calculating the lentivirus titer corresponding to the sample according to data obtained by the RT-qPCR amplification reaction. The method can be used for absolute quantitative qPCR detection of lentivirus titer, can accurately determine lentivirus successfully integrated into a cell genome, and reflects the real infection ability of the virus; in addition, the technology has high sensitivity and specificity, is not influenced by the extraction efficiency of the cell genome DNA, and ensures the reliability of the detection result.

Description

Technical Field

[0001] The invention belongs to the technical field of biological detection, and relates to a method for detecting lentivirus titer using a double standard curve RT-qPCR method. Background Art

[0002] The information disclosed in this background technology section is only intended to enhance the understanding of the overall background of the invention, and should not necessarily be regarded as an admission or any form of suggestion that the information constitutes the prior art already known to a person skilled in the art.

[0003] Lentiviral vectors (LVs) titer is a key indicator for measuring the concentration of viral particles, usually expressed in transduction units (TU), that is, the number of biologically active viral particles per unit volume. Accurate calculation of lentiviral titer is crucial for the repeatability of experiments and the safety of gene therapy. Currently, commonly used lentiviral titer detection methods include fluorescent reporter gene detection, antigen-antibody detection based on lentiviral coat protein, and real-time fluorescence quantitative PCR.

[0004] Real-time fluorescence quantitative PCR (RT-qPCR) is a simple, reproducible and sensitive method for determining the titer of LVs. It can detect the viral titer and infection efficiency of vectors that do not carry reporter genes and is not limited by promoter function, so it is widely used. This method adds fluorescent dyes to the PCR reaction, monitors the fluorescent signal in the DNA amplification process in real time, generates a fluorescence intensity curve, and quantifies the copy number of the viral genome by comparing it with the standard, thereby determining the titer of LVs. In recent years, RT-qPCR technology based on Taqman and SybrGreen I strategies has been used to quantitatively determine different nucleic acid substances in LVs, including viral RNA, negative-strand cDNA, and proviral DNA and mRNA in infected cells. However, differences in sample preparation and reverse transcription may affect the accuracy of the results. In order to improve the accuracy of the test, the double standard curve RT-qPCR method adds a standard curve of the internal reference gene on the basis of traditional RT-qPCR to correct the potential errors between different samples. This method does not require strict experimental optimization, nor does it require the gene amplification efficiency to reach 100%, making the experimental operation more flexible and improving the reliability of the test. However, the inventors have found that the double standard curve RT-qPCR method has strict requirements when detecting the titer of lentivirus, and the difference in its standard vectors may cause problems in the test results, such as non-specific amplification. Summary of the invention

[0005] In order to address the deficiencies of the prior art, the purpose of the present invention is to provide a method for detecting lentivirus titer using a double standard curve RT-qPCR method. The present invention solves the problem of nonspecific amplification under specific conditions, thereby achieving high-sensitivity and specificity detection of lentivirus titer using a double standard curve RT-qPCR method. The method can accurately measure lentivirus successfully integrated into the cell genome, reflecting the true infection ability of the virus, and is not affected by the extraction efficiency of cell genome DNA, thereby ensuring the reliability of the detection results. The method of the present invention can more accurately evaluate the infection efficiency and activity of lentivirus vectors, thereby providing an important tool for gene therapy research and application.

[0006] In order to achieve the above object, the technical solution of the present invention is:

[0007] In a first aspect, a method for detecting lentivirus titer using a double standard curve RT-qPCR method comprises the following steps:

[0008] Using HEK-293T cells as target cells, infecting the target cells with a test sample containing a recombinant lentivirus, and collecting and extracting genomic DNA of the infected target cells;

[0009] The original virus standard and internal reference standard diluted in gradient and the extracted target cell genomic DNA were used as templates to perform viral genome RT-qPCR amplification reaction and internal reference genome RT-qPCR amplification reaction respectively;

[0010] The lentiviral titer corresponding to the sample was calculated based on the data obtained from the RT-qPCR amplification reaction;

[0011] Among them, the original virus standard is a Lenti-EF1a-EGFP-puro vector containing a WPRE regulatory element sequence, and the internal reference standard is a pUC-GW-Amp vector containing an albumin (Alb) gene sequence; in the viral genome RT-qPCR amplification reaction, the nucleotide sequences of the primer pairs used to detect the WPRE sequence are shown in SEQ ID NO.3 and SEQ ID NO.4; in the internal reference genome RT-qPCR amplification reaction, the nucleotide sequences of the primer pairs used to detect the Alb gene are shown in SEQ ID NO.7 and SEQID NO.8.

[0012] The present invention has found that when a Lenti-EF1a-EGFP-puro vector containing a WPRE regulatory element sequence is used as a provirus standard, a pUC-GW-Amp vector containing an Alb gene sequence is used as an internal reference standard, and a primer pair as shown in SEQ ID NO.3 and SEQ ID NO.4 and a primer pair as shown in SEQ ID NO.5 and SEQ ID NO.6 or a primer pair as shown in SEQ ID NO.9 and SEQID NO.10 is used to perform a double standard curve RT-qPCR method to detect the titer of the lentivirus, there is a problem of nonspecific amplification. For this reason, the present invention redesigns the primer pair. Studies have shown that, in the detection system of the present invention, when a primer pair as shown in SEQ ID NO.3 and SEQ ID NO.4 and a primer pair as shown in SEQ ID NO.7 and SEQ ID NO.8 are used to perform a double standard curve RT-qPCR method to detect the titer of the lentivirus, the problem of nonspecific amplification can be solved.

[0013] In addition, the present invention also found that false positive results are prone to occur when the double standard curve RT-qPCR method is used to detect the titer of the lentivirus. In order to solve this problem, in some embodiments, UNG enzyme is added in the RT-qPCR amplification reaction. Specifically, the anti-pollution step is to prevent the contamination of PCR products and cause false positive results by adding UNG enzyme. Specifically, before the start of the polymerase chain reaction, the UNG enzyme in the reaction system is first activated at 48 to 52 ° C for 1 to 3 minutes to completely degrade the PCR products containing uracil; then, the UNG enzyme is inactivated by high temperature treatment at 93 to 97 ° C for 1 to 3 minutes, and the DNA chain containing uracil is destroyed; in this way, only the natural DNA template that does not contain uracil can continue to be used as a template for PCR amplification, thereby effectively preventing false positive results caused by PCR product contamination.

[0014] In some embodiments, the nucleotide sequence of the WPRE regulatory element is shown as SEQ ID NO.1.

[0015] In some embodiments, the nucleotide sequence of the Alb gene is shown as SEQ ID NO.2.

[0016] In some embodiments, polybrene is used to facilitate viral transduction.

[0017] In some embodiments, 1 to 3 mL of fresh culture medium containing DNase I is replaced at 23 to 25 hours after infection, and digestion is carried out at 36 to 38° C. for 10 to 20 minutes. This step is used to remove residual plasmid DNA in the lentiviral suspension to prevent the subsequent lentiviral titer determination from being affected.

[0018] In some embodiments, the RT-qPCR amplification reaction uses a three-step RT-qPCR amplification procedure.

[0019] In some embodiments, the process includes establishing a provirus standard curve and / or establishing an internal reference standard curve. Specifically, provirus standards and / or internal reference standards of different gradient copy numbers are used as templates to add primer pairs for detecting WPRE sequences and primer pairs for detecting Alb genes, respectively, and RT-qPCR amplification reactions are performed to obtain Ct values ​​of provirus standards and / or internal reference standards of different contents, and the provirus standard curve and / or internal reference standard curve are established based on the corresponding relationship between Ct value and content.

[0020] In some embodiments, the number of lentiviral genome copies and the number of internal reference genome copies in the sample to be tested are obtained according to the Ct value obtained by the RT-qPCR amplification reaction, and the lentiviral titer is calculated according to the number of lentiviral genome copies and the number of internal reference genome copies. Specifically, the calculation formula for lentiviral titer is: titer (TU / mL) = (D×e1×2) / (e2×A), where D is the number of cells infected with lentivirus, e1 is the number of lentiviral genome copies, e2 is the number of internal reference genome copies, and A is the volume of added virus ÷ the dilution factor of lentivirus.

[0021] In a second aspect, a kit for detecting lentivirus titer by double standard curve RT-qPCR method comprises:

[0022] The original virus standard is the Lenti-EF1a-EGFP-puro vector containing the WPRE regulatory element sequence;

[0023] The internal reference standard is the pUC-GW-Amp vector containing the Alb gene sequence;

[0024] The primer pair used to detect the WPRE sequence, the nucleotide sequences of which are shown in SEQ ID NO.3 and SEQ ID NO.4;

[0025] The nucleotide sequences of the primer pair used for detecting the Alb gene are shown in SEQ ID NO.7 and SEQ ID NO.8.

[0026] In some embodiments, a UNG enzyme is included.

[0027] In some embodiments, the nucleotide sequence of the WPRE regulatory element is shown as SEQ ID NO.1.

[0028] In some embodiments, the nucleotide sequence of the Alb gene is shown as SEQ ID NO.2.

[0029] In some embodiments, polybrene is included.

[0030] The beneficial effects of the present invention are:

[0031] The RT-qPCR double primer pair provided by the present invention includes a detection primer pair for the endogenous WPRE regulatory element of the lentiviral vector and a quantitative primer pair using the human Alb gene as an internal reference, which can be effectively used for the absolute quantitative detection of various lentiviruses; the established double standard curve RT-qPCR lentivirus titer detection method has more advantages in operation, such as relatively broad requirements for the RT-qPCR system and amplification efficiency, human errors in the experiment can be partially corrected when the results are processed, and the obtained data are more accurate and reliable; in addition, RT-qPCR detection can reflect the number of cells that have successfully integrated the lentivirus, thereby truly reflecting the infection activity of the virus, and the detection result is not affected by the efficiency of cell genomic DNA extraction. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] The accompanying drawings in the specification, which constitute a part of the present invention, are used to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute improper limitations on the present invention.

[0033] Figure 1 This is a graph of the original virus standard plasmid for RT-qPCR detection of lentivirus titer established by the present invention;

[0034] Figure 2 This is a plasmid map of the internal reference standard for detecting the lentiviral titer by RT-qPCR established in the present invention;

[0035] Figure 3 It is a melting curve diagram of the WPRE-qPCR primer pair in the RT-qPCR optimal primer screening method established by the present invention;

[0036] Figure 4 It is a melting curve diagram of Alb-qPCR primer pair 1 in the RT-qPCR optimal primer screening method established in the present invention;

[0037] Figure 5 It is a melting curve diagram of Alb-qPCR primer pair 2 in the RT-qPCR optimal primer screening method established by the present invention;

[0038] Figure 6 It is a melting curve diagram of Alb-qPCR primer pair 3 in the RT-qPCR optimal primer screening method established by the present invention;

[0039] Figure 7 The DNA gel electrophoresis diagram of the RT-qPCR product of the primer pair in the RT-qPCR optimal primer screening method established by the present invention;

[0040] Figure 8It is a melting curve diagram of the original virus gene amplification in the RT-qPCR lentivirus titer determination established by the present invention;

[0041] Fig. 9 The amplification curve diagram of the original virus gene amplification in the RT-qPCR lentivirus titer determination established by the present invention;

[0042] Fig.10 It is a melting curve diagram of the internal reference gene amplification in the RT-qPCR lentiviral titer determination established in the present invention;

[0043] Fig.11 It is an amplification curve diagram of the internal reference gene amplification in the RT-qPCR lentiviral titer determination established by the present invention;

[0044] Fig.12 This is a double standard curve diagram for the RT-qPCR lentiviral titer determination established in the present invention. DETAILED DESCRIPTION

[0045] It should be noted that the following detailed descriptions are exemplary and are intended to provide further explanation of the present invention. Unless otherwise specified, all technical and scientific terms used herein have the same meanings as those commonly understood by those skilled in the art to which the present invention belongs.

[0046] It should be noted that the terms used herein are only for describing specific embodiments and are not intended to limit exemplary embodiments according to the present invention. As used herein, unless the context clearly indicates otherwise, the singular form is also intended to include the plural form. In addition, it should be understood that when the terms "comprising" and / or "including" are used in this specification, it indicates the presence of features, steps, operations, devices, components and / or combinations thereof.

[0047] In order to enable those skilled in the art to more clearly understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below in conjunction with specific embodiments.

[0048] Example 1 Preparation of standard vector for RT-qPCR detection of lentiviral titers

[0049] The WPRE regulatory element is the most common endogenous gene in recombinant lentiviruses. This gene does not normally exist in animal cells, so it can be used as a quantitative detection marker region after the recombinant lentivirus is inserted into the target cell genome; 293T cells are a human embryonic kidney cell line, which are commonly used for viral vector production in molecular biology and gene therapy research. The human single-copy gene albumin Alb gene is the most common housekeeping gene in 293T cells and can be used as an internal reference gene for lentiviral titer determination.

[0050] (1) Construction of proviral standard: The correctly sequenced empty lentiviral plasmid Lenti-EF1a-EGFP-puro plasmid (size 9514 bp) available in the laboratory was selected as the proviral standard. Figure 1 It can be seen that the plasmid vector contains the WPRE regulatory element sequence (its nucleotide sequence is shown in SEQ ID NO.1), and the empty lentiviral plasmid was purchased from Aikonde Biotechnology Co., Ltd.

[0051] (2) Construction of internal reference standard: A sequence of the albumin Alb gene, a single-copy gene in the HEK-293T cell genome (its nucleotide sequence is shown in SEQ ID NO. 2) was selected as the internal reference gene. The internal reference gene was cloned and inserted into the pUC-GW-Amp vector to construct the pUC-Alb recombinant plasmid (size 2827 bp). The recombinant plasmid was synthesized by GeneWeiZ ( Figure 2 ) and was confirmed as the internal reference standard after being verified by sequencing.

[0052] (3) After the above standard plasmids were transformed into DH5α for amplification, the plasmids were extracted using a plasmid extraction kit, and then the concentrations of the extracted plasmids were measured using a Thermo Nanodrop 2000 spectrophotometer. WPRE (ng / μL) and C Alb (ng / μL)

[0053] (4) Calculate the copy number of the original virus standard and the internal reference standard according to the formula:

[0054] The number of copies of the original virus standard (copies / μL) = (the mass of the original virus standard A / the relative molecular mass of the original virus standard M) × N (Avogadro constant 6.02 × 10 23 )=(C WPRE ×10 -9 ) / (9514×660)×(6.02×10 23 )

[0055] The number of copies of the internal reference standard (copies / μL) = (mass of the internal reference standard A / relative molecular mass of the internal reference standard M) × N (Avogadro constant 6.02 × 10 23 )=(C Alb ×10 -9 ) / (9514×660)×(6.02×10 23 )

[0056] (5) Adjust the plasmid concentration and dilute the plasmid standard in multiples of 10 to obtain 10 8 copies / μL, 10 7 copies / μL, 106 copies / μL, 10 5 copies / μL, 10 4 The samples were prepared with five concentration gradients of 100 copies / μL as templates for subsequent RT-qPCR detection.

[0057] The nucleotide sequence of the WPRE element gene (SEQ ID NO.1) is as follows:

[0058] (592bp)

[0059] The nucleotide sequence of the Alb internal reference gene (SEQ ID NO.2) is as follows:

[0060] GTTGCTGTCATCTCTTGTGGGCTGTAATCATCGTCTAGGCTTAAGAGT AATATTGCAAAACCTGTCATGCCCACACAAATCTCTCCCTGGCATTGTTGT CTTTGCAGATGTCAGTGAAAGAGAACCAGCAGTCCCCATGAGT(142bp)

[0061] Example 2 Construction and screening of optimal primer pairs for RT-qPCR detection of lentiviral titers

[0062] (1) According to the RT-qPCR primer design principles, one WPRE primer pair and three Alb candidate primer pairs were designed. The primer sequences are shown in Table 1.

[0063] Table 1 RT-qPCR primer sequences for lentivirus titer detection

[0064] name sequence WPRE-qPCR-F GGCACTGACAATTCCGTGGT(SEQ ID NO.3) WPRE-qPCR-R AGGGACGTAGCAGAAGGACG(SEQ ID NO.4) Alb-qPCR-F1 GTTGCTGTCATCTCTTGTGGGCTGT(SEQ ID NO.5) Alb-qPCR-R1 ACTCATGGGAGCTGCTGGTTCTCTT(SEQ ID NO.6) Alb-qPCR-F2 TCATCTCTTGTGGGCTGTAATC(SEQ ID NO.7) Alb-qPCR-R2 TGCCAGGGAGAGATTTGTGTG(SEQ ID NO.8) Alb-qPCR-F3 GCTGTCATCTCTTGTGGGCTGT(SEQ ID NO.9) Alb-qPCR-R3 ACTCATGGGAGCTGCTGGTTC(SEQ ID NO.10)

[0065] (2) RT-qPCR amplification

[0066] The plasmid standard obtained in Example 1 and the extracted HEK-293T cell genomic DNA were used as templates, and the corresponding upstream primers and downstream primers were added to perform RT-qPCR amplification reaction. The reaction conditions were: 50°C for 2 min; 95°C for 2 min, enter the cycle; 95°C for 20 s, 60°C for 30 s, 72°C for 60 s, end point plate reading, a total of 40 cycles; 60°C-95°C ΔT 1°C for 15 s, and the obtained melting curve was as shown in the figure. Figure 3-6 shown.

[0067] (3) RT-qPCR product DNA gel electrophoresis verification

[0068] The RT-qPCR product obtained in step (2) of Example 2 above was subjected to DNA gel electrophoresis, and the DNA bands were visualized and photographed using a gel imaging system.

[0069] (4) RT-qPCR results analysis

[0070] The criteria for determining whether a primer pair is suitable is whether its melting curve shows a single clear peak, and whether the peak shape is consistent when using the standard and 293T cell genomic DNA as templates, that is, whether the melting temperature (Tm) is the same. Figure 3 ) showed a single clear peak, and no amplification was observed in the 293T cell genomic DNA template, indicating that the primers specifically bind to the WPRE element in the lentivirus and initiate the polymerase chain reaction; for the three primer pairs of the Alb gene (such as Figure 4-6 ), the melting curve of primer pair 2 also showed a single clear peak, and when the internal reference standard and 293T cell genomic DNA were used as templates, the peak shape and Tm value were consistent, indicating that it has strong specificity. In contrast, the melting curves of primer pairs 1 and 3 under the same conditions were not a single clear peak, suggesting the presence of nonspecific amplification.

[0071] (5) Analysis of DNA gel electrophoresis results of RT-qPCR products

[0072] By observing the brightness and size of the DNA bands, the specificity and purity of the RT-qPCR products can be assessed. Figure 7 The DNA gel electrophoresis of the RT-qPCR products shown shows that the WPRE primer pair produces specific amplification only for the provirus standard. In addition, the specificity of Alb primer pair 2 is significantly higher than primer pairs 1 and 3.

[0073] The melting curve results of RT-qPCR were consistent with the results of DNA gel electrophoresis, which further verified the specificity of the primer pair and the purity of the product. Therefore, in subsequent experiments, the WPRE primer pair and Alb primer pair 2 were selected as the best double primer pair in the double standard curve RT-qPCR lentiviral titer determination.

[0074] Example 3 Preparation of double standard curve for RT-qPCR lentiviral titer determination

[0075] (1) Using the original virus standards with five different gradient copy numbers and the internal reference standard obtained in Example 1 as templates, the optimal primer pairs screened in Example 2 were added respectively.

[0076] WPRE-qPCR-F / WPRE-qPCR-R and Alb-qPCR-F2 / Alb-qPCR-R2 were used for RT-qPCR amplification reaction. The reaction conditions were as follows: 50℃2min; 95℃2min, enter the cycle; 95℃20s, 60℃30s, 72℃60s, end point plate reading, a total of 40 cycles; 60℃-95℃△T 1℃15s. Figure 8-11 Amplification and melting curves are shown.

[0077] (2) Based on Fig. 9 and Fig.11 The amplification curve shown in the figure obtains the Ct value of each amplified original virus standard and internal reference standard. The double standard curve established according to the corresponding relationship between Ct value and content is as follows: Fig.12 As shown. Provirus standard curve: y = -3.199x + 43.298, R 2 =0.993; internal reference standard curve: y=-3.265x+42.386; R 2=0.9945; wherein the abscissa x is the Log value of the copy number of the standard, and the ordinate y is the Ct value of the standard.

[0078] (3) Calculate the amplification efficiency of the amplification regulatory element WPRE and the internal reference gene Alb in the RT-qPCR amplification reaction

[0079] Amplification efficiency E = [-1 + 10 (-1 / slop) ]*100%, slop represents the slope of the standard curve, calculated according to the formula: E (WPRE) =[-1+10 (-1 / -3.199) ]*100%=105%; E (Alb) =[-1+10 (-1 / -33.265) ]*100%=102%; both are within the ideal range of 90%-110% for RT-qPCR, further indicating that these two pairs of primers can be used for double standard curve RT-qPCR lentiviral titer detection experiments.

[0080] Example 4 Double standard curve RT-qPCR detection of lentivirus titer in samples

[0081] (1) Lentiviral transduction of 293T cells

[0082] 293T cells were plated one day before lentiviral infection, and 5 × 10 4 cells, the volume is 2 ml.

[0083] During lentiviral infection, cells from one well were taken for trypsin digestion and cell counting, and the counting result was saved as D.

[0084] Prepare 2 sterile EP tubes according to the expected titer of the virus, add 900 μL of DMEM complete medium to each tube, take 100 μL of the virus stock solution to be tested and add it to the first tube, mix well and take 100 μL and add it to the second tube to obtain a 100-fold diluted lentivirus dilution.

[0085] Select the desired cell wells, remove the culture medium and wash with PBS, add 100 μL of virus dilution and Polybrene with a final concentration of 8 μg / mL, fill with fresh complete culture medium and continue culturing.

[0086] 24 hours after infection, the virus-containing culture medium was removed and replaced with 2 mL of fresh culture medium containing DNase I, and digested at 37°C for 15 min (this step is to remove the residual plasmid DNA in the lentiviral suspension to prevent affecting the subsequent lentiviral titer determination).

[0087] Remove the fresh culture medium containing DNaseⅠ, then add fresh growth medium, and continue to culture the cells in a 37°C, 5% CO2 cell culture incubator (Note: Be careful during the whole process and do not blow up the cells).

[0088] (2) Extraction of genomic DNA from infected cells

[0089] After 2 to 3 days, the cells were collected and the genomic DNA of the target cells infected with the lentivirus was extracted using a genomic DNA extraction kit (Quanshijin, EE101-02).

[0090] (3) RT-qPCR analysis

[0091] The gradiently diluted original virus standard plasmid and the internal reference standard plasmid and the extracted lentivirus-infected target cell genomic DNA were used as templates, and the above-mentioned WPRE-qPCR-F and WPRE-qPCR-R primer pairs were used to carry out the real-time fluorescence quantitative PCR amplification reaction of the viral genome. The above-screened optimal Alb-qPCR-F2 and Alb-qPCR-R2 primer pairs were used to carry out the real-time fluorescence quantitative PCR amplification reaction of the internal reference genome. In order to prevent false positive results caused by contamination of PCR products, 2×SYBR Green PCR Mix (Solebo, SR1111) containing UNG enzyme was used.

[0092] The viral genome amplification reaction system is:

[0093]

[0094] The internal reference gene amplification reaction system is:

[0095]

[0096]

[0097] To reduce errors, each sample should have at least two replicate wells; at the same time, an NTC group (i.e., a negative control using ddH2O instead of template DNA) should be set up during the experiment to monitor contamination in the reaction system to avoid false positives that affect the experimental results.

[0098] RT-qPCR adopts a three-step method and adds an anti-contamination step. The qTOWER3G Jena fluorescent quantitative PCR instrument is used. The specific RT-qPCR amplification reaction procedure is as follows:

[0099]

[0100] (4) Analysis of UNG enzyme anti-pollution results

[0101] When UNG enzyme was not added to the reaction system, the Ct value range of the NTC group was 28-32, and it was inferred that there was slight contamination in the reaction system, resulting in false positive results. After improvements, UNG enzyme was added to the reaction system and an anti-contamination step was added to the RT-qPCR amplification reaction program. The Ct value of the NTC group reached above 35. Theoretically, the starting copy number of the template is less than 1, which can be considered meaningless, that is, the influence of false positives on the test results is eliminated.

[0102] (5) Analysis of hyperbolic RT-qPCR lentiviral titer determination results

[0103] According to the Ct value measured by RT-qPCR, the number of viral genome copies in the sample is e1, and the number of internal reference genome copies is e2. The lentiviral titer corresponding to the sample is calculated according to the formula:

[0104]

[0105] That is, the lentivirus titer measured in the sample = D × 2000 × e1 / e2.

[0106] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A method for detecting lentivirus titer using a double standard curve RT-qPCR method, characterized in that: The steps include: Using HEK-293T cells as target cells, infecting the target cells with a test sample containing a recombinant lentivirus, and collecting and extracting genomic DNA of the infected target cells; The original virus standard and internal reference standard diluted in gradient and the extracted target cell genomic DNA were used as templates to perform viral genome RT-qPCR amplification reaction and internal reference genome RT-qPCR amplification reaction respectively; The lentiviral titer corresponding to the sample was calculated based on the data obtained from the RT-qPCR amplification reaction; Among them, the original virus standard is a Lenti-EF1a-EGFP-puro vector containing a WPRE regulatory element sequence, and the internal reference standard is a pUC-GW-Amp vector containing an Alb gene sequence; in the viral genome RT-qPCR amplification reaction, the nucleotide sequences of the primer pairs used to detect the WPRE sequence are shown in SEQ ID NO.3 and SEQ ID NO.4; in the internal reference genome RT-qPCR amplification reaction, the nucleotide sequences of the primer pairs used to detect the Alb gene are shown in SEQ ID NO.7 and SEQ ID NO.

8.

2. The method according to claim 1, characterized in that: In the RT-qPCR amplification reaction, UNG enzyme was added.

3. The method according to claim 1, characterized in that: The nucleotide sequence of the WPRE regulatory element is shown in SEQ ID NO.1; Or, the nucleotide sequence of the Alb gene is shown as SEQ ID NO.

2.

4. The method according to claim 1, characterized in that: Polybrene was used to facilitate viral transduction.

5. The method according to claim 1, characterized in that: The RT-qPCR amplification reaction used a three-step RT-qPCR amplification procedure; Or, it includes the establishment of a provirus standard curve and / or an internal reference standard curve.

6. The method according to claim 1, characterized in that: The lentiviral genome copy number and the internal reference genome copy number in the sample to be tested were obtained according to the Ct value obtained by the RT-qPCR amplification reaction, and the lentiviral titer was calculated according to the lentiviral genome copy number and the internal reference genome copy number.

7. A kit for detecting lentivirus titer by double standard curve RT-qPCR method, characterized in that: include: The original virus standard is the Lenti-EF1a-EGFP-puro vector containing the WPRE regulatory element sequence; The internal reference standard is the pUC-GW-Amp vector containing the Alb gene sequence; The primer pair used to detect the WPRE sequence, the nucleotide sequences of which are shown in SEQ ID NO.3 and SEQ ID NO.4; The nucleotide sequences of the primer pair used for detecting the Alb gene are shown in SEQ ID NO.7 and SEQ ID NO.

8.

8. The kit according to claim 7, characterized in that: Including UNG enzyme.

9. The kit according to claim 7, characterized in that: The nucleotide sequence of the WPRE regulatory element is shown in SEQ ID NO.1; Or, the nucleotide sequence of the Alb gene is shown as SEQ ID NO.

2.

10. The kit according to claim 7, characterized in that: Includes polybrene.

Images