An egg yolk antibody against Muscovy duck reovirus of goose origin, its preparation method and application

Abstract

The present invention discloses an egg yolk antibody against Muscovy duck reovirus of goose origin, its preparation method and application, belonging to the technical field of veterinary biological products. The egg yolk antibody is prepared by immunizing poultry with a vaccine prepared using the inactivated Muscovy duck reovirus of goose origin with the preservation number CCTCC NO: V202491 as an antigen, and then extracting and purifying it from the egg yolk of highly immunized poultry eggs. Using the Muscovy duck reovirus of goose origin with the preservation number CCTCC NO: V202491 as a vaccine production strain to prepare an inactivated vaccine to immunize poultry can efficiently obtain the egg yolk antibody. This egg yolk antibody has good safety, high neutralization titer, and has a good prevention and treatment effect against the infection of Muscovy duck reovirus of goose origin, and has broad prospects for commercial development.

Description

Technical Field

[0001] The present invention relates to the technical field of veterinary biological products, and particularly relates to an egg yolk antibody against Muscovy duck reovirus of goose origin, a preparation method thereof, and an application thereof. Background Art

[0002] Avian orthoreovirus (ARV) is a non-enveloped, segmented, double-stranded RNA virus with a diameter of 50 - 80 nm, in an icosahedral shape with a double capsid structure. The International Committee on Taxonomy of Viruses clearly states in its ninth classification report that the Reoviridae family is divided into the Spinareovirus subfamily and the Sedoreovirus subfamily. ARV belongs to the Reoviridae family, Spinareovirus subfamily, and Orthoreovirus genus.

[0003] Muscovy duck reovirus is a dsRNA virus without an envelope structure, in an icosahedral symmetry with a double capsid structure. Under a high-power microscope, the virus particles have a diameter between 50 - 80 nm and are hexagonal. Since 2021, in the main goose-raising areas of China, an outbreak of Muscovy duck reovirus disease has occurred. This disease mainly causes uneven individual development in large groups of geese, listlessness, lying on the ground unable to get up, movement disorders, messy and dull feathers, a significant decrease in water and feed intake, and the excretion of yellowish-green loose feces. The mortality rate can reach up to 50%, causing huge economic losses to the goose-raising industry.

[0004] Egg yolk antibody is a technology that obtains specific polyclonal antibodies from the egg yolk of highly immunized poultry by immunizing the poultry body with specific antigens, so as to prevent and treat corresponding diseases. Compared with serum antibodies, the preparation of egg yolk antibodies has the advantages of uniform properties, easy extraction, effective avoidance of non-specific immune responses, low production cost, easy operation, large yield, safety, high efficiency, no residue, mild and environmentally friendly, etc. It has great development potential in immunization technology, immune monitoring, human and animal treatment, etc.

[0005] For the infection of Muscovy duck reovirus of goose origin, there is currently no commercial vaccine or antibody on the market, and conventional antiviral and antibacterial treatment methods are ineffective. There is no report on the egg yolk antibody for the emergency prevention and early infection treatment of this Muscovy duck reovirus of goose origin. Therefore, it is extremely urgent to develop a safe and highly effective egg yolk antibody that can effectively prevent Muscovy duck reovirus of goose origin. Summary of the Invention

[0006] Aiming at the above-mentioned existing technologies, the object of the present invention is to provide an egg yolk antibody against Muscovy duck reovirus of goose origin, a preparation method thereof, and an application thereof, which are used for preventing and treating the infection of Muscovy duck reovirus of goose origin with the main symptoms of a large number of white necrotic spots in tissues and organs such as the liver and spleen and joint cavity bleeding in geese, so as to make up for the serious economic losses caused by this disease.

[0007] To achieve the above object, the present invention adopts the following technical solutions:

[0008] Based on a strain of Muscovy duck reovirus isolated from the liver tissue of diseased goslings,

[0009] an inactivated vaccine capable of preventing and treating this Muscovy duck reovirus was developed. Using this inactivated vaccine to highly immunize healthy poultry eggs, and then isolating and purifying the yolk antibody from the yolk of the immunized poultry eggs. The virus was deposited at the China Center for Type Culture Collection (abbreviated as CCTCC) on October 30, 2024. The deposit name is: Muscovy duck reovirus MDRV-JS001, and the taxonomic name is: Muscovy Duck Reovirus. The deposit address is: Wuhan University, Wuhan, China, and the deposit number is: CCTCC NO: V202491. Specifically:

[0010] In the first aspect of the present invention, a yolk antibody against Muscovy duck reovirus that causes "flower liver disease" and joint cavity bleeding in geese is provided. The yolk antibody is obtained by immunizing poultry with the inactivated Muscovy duck reovirus with the deposit number CCTCC NO: V202491 as an immunogen, and then extracting and purifying it from the yolk of highly immunized poultry eggs.

[0011] Preferably, the poultry is a laying hen, and the yolk of the highly immunized poultry eggs is the yolk of highly immunized chicken eggs.

[0012] In the second aspect of the present invention, a preparation method of the above yolk antibody is provided. The preparation method includes the following steps:

[0013] (1) Using the inactivated Muscovy duck reovirus with the deposit number CCTCC NO: V202491 as an immunogen to prepare an inactivated vaccine of Muscovy duck reovirus;

[0014] (2) Injecting and immunizing poultry with the inactivated vaccine prepared in step (1) to obtain highly immunized poultry eggs;

[0015] (3) Collecting the yolk of the highly immunized poultry eggs, and preparing a yolk antibody for preventing and treating Muscovy duck reovirus after one inactivation, acid extraction, secondary inactivation, coarse filtration, sterile filtration, concentration, and three inactivations.

[0016] The neutralizing antibody titer of the prepared yolk antibody for preventing and treating Muscovy duck reovirus is ≥1:1024.

[0017] Preferably, in step (1), the inactivated vaccine is prepared by the following method:

[0018] 1) Inoculate the Muscovy duck reovirus from geese with the preservation number CCTCC NO: V202491 into LMH cells. After proliferating and culturing the Muscovy duck reovirus from geese, break the cells by freeze-thawing, collect the supernatant, and purify it to obtain the Muscovy duck reovirus solution from geese.

[0019] 2) Inactivate the virus solution of the Muscovy duck reovirus strain from geese, add Tween-80 and mix as the aqueous phase, and use white oil, aluminum stearate, and Span-80 mixed as the oil phase. Mix the oil phase and the aqueous phase evenly at a ratio of 2:1, and emulsify to obtain an inactivated vaccine for preventing and controlling Muscovy duck reovirus from geese.

[0020] The virus titer in the virus solution of the Muscovy duck reovirus strain from geese is 10 -6.2 TCID 50 / 0.1 mL.

[0021] Preferably, in step (2), the laying hens are immunized 4 times with the prepared inactivated vaccine, and the interval between each immunization is 2 weeks. The immunization route is subcutaneous or intramuscular injection of the inactivated vaccine in the neck.

[0022] Preferably, in step (3), the first inactivation is specifically: mix the egg yolk liquid and water at a volume ratio of 1:(0.5 - 1.5), stir evenly to obtain an egg yolk dilution, and keep it warm at 60 - 65 °C for 25 - 35 min.

[0023] Preferably, in step (3), the acidification extraction is specifically: add an acetate buffer solution 2.5 - 3.5 times the volume of the egg yolk dilution to the egg yolk dilution, stir and then filter to collect the filtrate. Further preferably, the pH value of the acetate buffer solution is 4.8 - 5.2; more preferably 5.0.

[0024] Preferably, in step (3), the second inactivation is specifically: add caprylic acid to the filtrate after acidification extraction to a final concentration of 3.5 - 4.5%, stir for 30 - 120 min, and place it at 2 - 8 °C for 4 - 8 hours after stirring.

[0025] Preferably, in step (3), the rough filtration is specifically: first filter with a filter cloth, and then filter with a filter membrane until the filtrate is clear. Further preferably, the filter cloth is a polypropylene 750B filter cloth.

[0026] Preferably, in step (3), the sterile filtration is specifically: filter and sterilize with a 0.22 μm filter membrane.

[0027] Preferably, in step (3), the concentration is specifically: concentrate with a 30 - 50KD PES hollow fiber ultrafiltration membrane at 2 - 8 °C until the antibody titer is not less than 1:1024.

[0028] Preferably, in step (3), the triple inactivation is specifically as follows: adding a formaldehyde solution to make the final concentration of the formaldehyde solution 0.1%, and inactivating at 37 °C for 16 h.

[0029] In the third aspect of the present invention, there is provided an application of the above yolk antibody in the preparation of a product for preventing and / or treating goose-origin Muscovy duck reovirus infection; the preservation number of the goose-origin Muscovy duck reovirus is CCTCC NO: V202491.

[0030] In the above application, the yolk antibody can be used alone or in combination with other immunological preparations and / or drugs to prepare a product for preventing and / or treating goose-origin Muscovy duck reovirus infection.

[0031] Advantages of the present invention:

[0032] (1) The Muscovy duck reovirus with the preservation number of CCTCC NO: V202491 provided by the present invention has the ability of cross-species transmission and can infect goslings. Moreover, the goose-origin Muscovy duck reovirus JS001 has a wide cell tropism and can proliferate on LMH cells, which is very suitable for the production of high-quality inactivated vaccines with high antigen titers; it has good immunogenicity against the newly emerging goose-origin Muscovy duck reovirus infection mainly characterized by "flower liver disease" and joint cavity bleeding in goslings.

[0033] (2) The inactivated vaccine prepared with the goose-origin Muscovy duck reovirus strain with the preservation number of CCTCC NO: V202491 has good safety, a protection rate of 100%, and a long immunoprotective duration.

[0034] (3) Using the goose-origin Muscovy duck reovirus with the preservation number of CCTCC NO: V202491 as a vaccine production strain to prepare an inactivated vaccine to immunize laying hens can efficiently obtain yolk antibodies. The yolk antibodies have good safety, high neutralization titers, and good prevention and treatment effects against goose-origin Muscovy duck reovirus infection, and have broad prospects for commercial development. Description of the Drawings

[0035] Figure 1 It is a pathological change diagram of virus cultured in LMH cells; wherein Figure 1 A in is a picture of the goose-origin Muscovy duck reovirus JS001 inoculated into LMH cells after 48 h, Figure 1 B in is a picture of control cells without virus inoculation.

[0036] Figure 2The results of PCR identification; in the figure, lane 1 is duck reovirus, lane 2 is duck Tembusu virus, lane 3 is duck astrovirus, lane 4 is duck circovirus, lane 5 is duck plague virus, lane 6 is duck hepatitis A virus, lane 7 is the blank control, lane 8 is goose-origin Muscovy duck reovirus, and M is 2000bp Marker. Detailed implementation manners

[0037] It should be noted that the following detailed descriptions are all illustrative and are intended to provide further explanations for the present application. Unless otherwise specified, all technical and scientific terms used herein have the same meanings as those commonly understood by those of ordinary skill in the technical field to which the present application belongs.

[0038] The following combines examples to further describe in detail the specific implementation manners of the present invention. The following detailed descriptions are all illustrative and are intended to provide further explanations for the present application, rather than limiting the scope of the present invention.

[0039] In order to enable those skilled in the art to more clearly understand the technical solutions of the present application, the technical solutions of the present application will be described in detail below in combination with specific examples. If the specific experimental conditions are not specified in the examples, they are usually in accordance with conventional conditions or the conditions recommended by the reagent company; for the reagents, consumables, etc. used in the following examples, unless otherwise specified, they can all be obtained through commercial channels. Among them:

[0040] The RNA extraction kit was purchased from Beijing ComWin Biotech Co., Ltd., the ordinary agarose gel recovery kit was purchased from Beijing TransGen Biotech Co., Ltd., the reverse transcription kit was purchased from Takara (Dalian) Co., Ltd., the 2×Es Taq MasterMix was purchased from Beijing ComWin Biotech Co., Ltd., and the DL2000 Marker was purchased from Takara (Dalian) Co., Ltd.

[0041] Example 1: Isolation and identification of goose-origin Muscovy duck reovirus

[0042] 1. Epidemiological investigation:

[0043] Since March 2021, an infectious disease characterized by paralysis and a large number of white necrotic spots in tissues and organs such as the liver and spleen has broken out in gosling flocks in Jiangsu, Liaoning, Henan and other places in China. This disease mainly occurs in goslings aged 7 to 35 days. There are a large number of white necrotic spots in various tissues and organs of diseased goslings. The diseased goslings also show clinical symptoms of swollen joints, and the highest mortality rate can reach 80%. Autopsy of the dead goslings shows the following main pathological changes: the liver and spleen are enlarged, with a large number of white necrotic spots on the surface, and severe bleeding in the joint cavity.

[0044] 2. Collection and processing of diseased materials:

[0045] Collect the liver tissues of diseased goslings, add sterile PBS, grind them into homogenates, freeze-thaw them three times repeatedly, centrifuge to obtain the supernatant. After the supernatant is filtered and sterilized through a 0.22 μm filter, inoculate it onto LMH cells with good growth status, adsorb in a cell incubator for 30 min, discard the sample treatment solution, and add 2% cell maintenance solution to continue the culture; set a negative control with sterile normal saline and incubate at 37°C. Observe and record the cell status daily. When the cell fusion phenomenon reaches 80%, collect the virus solution. Blind passage three generations in the same way for subsequent detection. After three generations of subculture, the degree of cell fusion tends to be stable, and typical cytopathic effects can occur in 80% of the cells 48 h after inoculation ( Figure 1 A in Figure 1 ), and no lesions appear in the negative control (

[0046] 3. RT-PCR identification:

[0047] (1) RNA extraction: Repeatedly freeze-thaw and centrifuge the collected cell virus solution to obtain the supernatant. According to the requirements of the RNA extraction kit instructions, extract the viral RNA and store it at -20°C for standby.

[0048] (2) Reverse transcription to obtain cDNA: The reverse transcription kit used is PrimeScript™ RT Master Mix with the catalog number RR036A from Takara Bio (Dalian) Co., Ltd. In a 200 μL PCR reaction tube, add 5×PrimeScript RT Master Mix × 2 μL and RNA extracted from the virus solution ~2 μL in sequence, and supplement with RNase Free dH2O to a 10 μl system. Place it in a PCR instrument for reaction. The reaction conditions are 37°C for 15 min; 85°C for 5 s, and then store at 4°C.

[0049] (3) PCR amplification:

[0050] Muscovy duck reovirus belongs to the genus Orthoreovirus in the family Reoviridae. The σC protein is a very important structural protein of Orthoreovirus and plays an important role in the pathogenic process of the virus. In addition, the σC protein-encoding gene is the gene fragment most prone to mutation in the genome. Therefore, in this study, a pair of specific primers for amplifying a 1002 bp fragment was designed based on the Muscovy duck reovirus σC gene sequence in the gene sequence database Genbank established by the National Center for Biotechnology Information in the United States and synthesized by Beijing Tsingke New Industry Biotechnology Co., Ltd.

[0051] Forward primer: 5′- CCGATTGGGCCGACATCTCAT-3′ (SEQ ID NO.1)

[0052] Downstream primer: 5′- ACTACCTCAAGTGGTCGCAA-3′ (SEQ ID NO.2)

[0053] Amplification was carried out using a 20 μL system: template cDNA × 2 μL, upstream and downstream primers each × 1 μL, 2×Es TaqMasterMix × 10 μL, and supplemented with ddH2O to a 20 μL system. After mixing and briefly centrifuging, it was placed in a PCR instrument for reaction. The reaction conditions were 95°C for 5 min, followed by 30 cycles of 95°C for 45 s, 52°C for 30 s, 72°C for 25 s, and then 72°C for 10 min, and stored at 4°C for later use.

[0054] Meanwhile, the specific primers reported were used to detect conventional duck-derived viruses, including: Duck Reovirus (DRV), Duck Tembusu virus (TMUV), Duck Astrovirus (DAStV), Duck Circovirus (DuCV), Duck Plague virus (DPV), and Duck Hepatitis A virus (DHAV).

[0055] (4) Agarose gel electrophoresis:

[0056] The PCR amplification products were detected by 1% agarose gel electrophoresis. The results showed that specific bands corresponding to the expected size of 1002 bp appeared after electrophoresis of the products amplified by the primers of SEQ ID NO.1 and SEQ ID NO.2 in 1% agarose gel, indicating the presence of Muscovy duck reovirus of goose origin in the cell culture of the isolate ( Figure 2 )), named strain JS001. In addition, the conventional duck-derived virus detection of the isolate, including: DRV, TMUV, DAStV, DuCV, DPV, and DHAV, all showed negative results, and no other virus contamination was detected.

[0057] 4. Sequencing and sequence analysis:

[0058] The amplified products were recovered from the gel and sent to Beijing Tsingke New Industry Biotechnology Co., Ltd. for sequencing. After splicing the sequencing results, Blast was used for alignment, and at the same time, homology analysis was carried out with other waterfowl reoviruses.

[0059] The results showed that the σC gene sequence (SEQ ID NO.3) of the JS001 isolate was most closely related to the classical Muscovy duck reovirus ZJ2000M strain, with nucleotide and amino acid homology both above 95%. It was distantly related to other waterfowl reovirus isolates and was in different genetic evolution branches. Thus, it can be determined that the isolate JS001 is a Muscovy duck reovirus of goose origin.

[0060] SEQ ID NO.3:

[0061] ATGTCCGAAACTCCCGCTCCTCCAGGATACAGTGTTCCATCCTGCTCCCCGGGCTCTCGAGATCTAACTAGATCTGATGTCTTAGCGCTAATTCTTTCGTTTAATCCAGTGTCCCGGTCTGATGTCGAGGATTTGTCACGTCGTCTTTCCTCATTGCAGTCCTCGTATGATGCTCTCTTCGAAGAGGTGCTACGCTTACGCGTACGTATGGATATGATATACAACTCGTTTTCTAAGTCTCTATCCGATTTAGGTGATCGTGTTGCTAAGTTAGAATGTGCGACGTCTCACATTAAGACTGTCCGGGCTCCTTTACACGTCAATGACGGCGAGCTGGTTCTCTTAGCTAAACCTTCATTCTGCACTCTGGATCCAGTACTTTCAGGCACCTCATTGAATGCTGTCTTTGCCACCGGTTCCTGGCTCGCTAAGATAGAGGCTGGCGTGTCCATCGCCTCGTTCGTCCTGAACCTGCGGTTTCATCACTTTGGACAACGGACAACATTGTTTCTATCCTCTCCTAACGTTGTTACTGTCTTCCCAGGCTCCAGTGTTTACTTGGTGTTAGACACGTCTCGTCTCATTGACCCCGCGTACGATACCTCCCTGTTGACTCCTAGTCCCGCGTTTGCCGCTAACATGTTCATGGTCGACATGGTGTTTGACGATGCTTCCACGAAGGAAAGCTTCTCTCTGTCGACTACTGGTTCGTTCAGCCACTCCGCCTTCAGGATTGCATGGATACCAGTTGCCTCCGAGACCAAGAATTATTTTATTCGAGCGGTTCGCTTCTCCATTGCGACCACTTGA。

[0062] This strain was named Muscovy duck reovirus MDRV-JS001 of goose origin. And the biological preservation of this strain was carried out, and the preservation information is as follows:

[0063] Name of the strain: Muscovy duck reovirus MDRV-JS001

[0064] Preservation institution: China Center for Type Culture Collection

[0065] Abbreviation of the depositary institution: CCTCC

[0066] Address: Wuhan University, Wuhan, China

[0067] Date of deposit: October 30, 2024

[0068] Taxonomic name: Muscovy Duck Reovirus

[0069] Registration number in the depositary center: CCTCC NO: V202491

[0070] Example 2: Preparation of inactivated vaccine

[0071] (1) Virus propagation and harvest:

[0072] The goose-origin Muscovy Duck Reovirus JS001 after isolation and identification was inoculated into well-grown LMH cells at an inoculation volume ratio of 1:100; adsorbed at 37 °C for 30 min, and then cultured in DMEM medium containing 2% newborn bovine serum under the conditions of 37 °C and 5% CO2 until 80% of the cells showed cytopathic effect, and then harvested to obtain cell virus fluid. The obtained sufficient cell virus fluid was frozen at -20 °C, and after two freeze-thaw cycles, the supernatant was centrifuged to collect the virus fluid. Calculate TCID 50 , and the virus content in every 0.1 ml of virus fluid is 10 -6.2 TCID 50 .

[0073] (2) Virus purification:

[0074] The established detection methods such as PCR and RT-PCR were used to detect whether the obtained virus fluid contained other common viruses. The detection items included DRV, TMUV, DAStV, DuCV, DPV, DHAV, etc., and the seed virus was purified

[0075] (3) Inactivation of virus fluid:

[0076] The virus fluid with qualified bacterial inspection was inactivated with formaldehyde, and the optimal inactivation condition was to add formaldehyde with a final concentration of 0.2% and inactivate it by stirring at 37 °C for 16 h

[0077] (4) Preparation of vaccine:

[0078] ① Preparation of oil phase: Take medicinal white oil No. 10 and Span-80 and mix them evenly in a ratio of 94:6, then add 2% aluminum tristearate, stir until light yellow and clear and transparent, and then sterilize it by high-pressure steam at 121 °C for standby

[0079] ② Preparation of aqueous phase: The inactivated complete virus solution and sterile Tween-80 are mixed evenly by shaking at a ratio of 96:4 to completely dissolve Tween-80.

[0080] ③ Emulsification: The oil phase and the aqueous phase are mixed at a ratio of 2:1. Add 2 parts of the oil phase to the tissue homogenizer in the laminar flow hood, and slowly add 1 part of the aqueous phase while constantly stirring. After all the aqueous phase is added, mix at 6000 rpm for 10 min, then emulsify at 8000 r / min for 20 min, and divide and store for later use, that is, the inactivated vaccine is prepared.

[0081] The prepared inactivated vaccine is subjected to quality inspection including: dosage form, centrifugal stability, viscosity, sterility and shelf life. The specific method refers to the "Pharmacopoeia of the People's Republic of China" (2015 edition).

[0082] The results are as follows: The dosage form of the inactivated vaccine prepared by the present invention is water-in-oil (W / O); the centrifugal stability, viscosity and sterility inspection comply with the regulations of the "Pharmacopoeia of the People's Republic of China" (2015 edition).

[0083] Example 3: Preparation of egg yolk antibody against Muscovy duck reovirus from geese

[0084] 1. Immunize laying hens with the inactivated vaccine:

[0085] Immunize laying hens with the inactivated vaccine against Muscovy duck reovirus from geese prepared in Example 2. For the first immunization, inject 2.0 mL of the inactivated vaccine subcutaneously into the neck of each chicken. After 14 days, conduct the second immunization, inject 2.0 mL of the inactivated vaccine subcutaneously into the neck of each chicken. After 14 days after the second immunization, conduct the third immunization, inject 2.0 mL of the inactivated vaccine subcutaneously into the neck of each chicken. After 14 days after the third immunization, conduct a booster immunization, inject 2.0 mL of the inactivated vaccine subcutaneously into the neck of each chicken. 14 days after the booster immunization, collect the egg yolk to measure the neutralizing antibody titer of Muscovy duck reovirus from geese, which should be ≥1:1024.

[0086] 2. Manufacture of egg yolk antibody:

[0087] (1) Eggshell disinfection: Collect high-immune eggs and soak them in 1% benzalkonium bromide solution for 15 min. After taking them out and drying them naturally or by blowing, spray 75% alcohol on the eggshell surface for disinfection and reserve for later use.

[0088] (2) Egg yolk separation: Adopt the mechanical egg-beating method. When beating the eggs, the egg white, germinal disc and chalaza should be removed thoroughly, and collect the egg yolk.

[0089] (3) Inactivation I: Thoroughly stir the collected egg yolk until it becomes a uniform paste. Start the peristaltic pump, pump the egg yolk liquid into the jacketed reaction tank, add an equal volume of injection water to the egg yolk (the injection water is first disinfected at 80°C for 30 min and cooled to below 65°C), stir and mix evenly, and then keep it at 65°C for heat preservation (inactivation) for 30 min.

[0090] (4) Acidification extraction: First, add an acetic acid buffer solution with a pH value of 5.0 and a volume three times that of the original egg yolk to the isolation reaction tank, then add the egg yolk liquid, turn on the stirrer, and stir thoroughly for 30 min.

[0091] (5) Inactivation II: Add octanoic acid with a final concentration (V / V) of 4% as an inactivator and extractant to the egg yolk liquid, stir vigorously for 90 min, and place it at 2°C for 4 h.

[0092] (6) Coarse filtration: Filter with a polypropylene 750B filter cloth, and then filter with a core filter until it is clear.

[0093] (7) Sterilization filtration: Filter and sterilize with a 0.22 μm filter membrane. Store at 2°C, and the storage period should not exceed 14 days. At the same time, take samples to detect the neutralizing antibody titer of goose-origin Muscovy duck reovirus.

[0094] (8) Concentration: If the neutralizing antibody titer of the detected goose-origin Muscovy duck reovirus is lower than 1:1024, the egg yolk antibody after sterilization filtration should be ultrafiltered and concentrated appropriately with a 30 KD concentration membrane package at 2°C. The neutralizing antibody titer of the concentrated goose-origin Muscovy duck reovirus should be ≥1:1024.

[0095] (9) Inactivation III: Pour the concentrated solution into the inactivation tank, measure and add a 10% formaldehyde solution, turn on the stirrer to stir and make it mix thoroughly. The final concentration (V / V) of the formaldehyde solution is 0.1%, and inactivate at 37°C for 16 hours.

[0096] (10) Sub-packaging and storage: Under sterile conditions, sub-package the inactivated filtrate into sterile glass bottles, cover with rubber stoppers, crimp aluminum caps, affix labels, and store for standby. The storage temperature is -20°C.

[0097] Example 4: Quality inspection of egg yolk antibody

[0098] 1. Safety inspection:

[0099] Use 10 susceptible goslings at 5 days old (the maternal antibodies of goose-origin Muscovy duck reovirus are all <1:4), and inject 2.0 mL of the egg yolk antibody prepared in Example 3 of the present invention into each of them at multiple muscle injection points. Observe for 14 days. All the susceptible goslings survived healthily, indicating that the egg yolk antibody of the present invention has good safety.

[0100] 2. Sterility inspection:

[0101] Performed in accordance with the Chinese Veterinary Pharmacopoeia (2015 Edition), the results showed that there was no contamination by bacteria, mycoplasma, and exogenous viruses.

[0102] 3. Potency test (immunization and challenge method):

[0103] Forty 5-day-old susceptible goslings (with maternally-derived antibodies against Muscovy duck reovirus from geese all < 1:4) were randomly divided into four groups, A and B, with 20 goslings in each group. Among them, group A was the immunized group, and the yolk antibody prepared in Example 3 was injected subcutaneously or intramuscularly into the neck, 0.5 mL per gosling; group B was the challenge control group, and normal saline was injected subcutaneously or intramuscularly, 0.5 mL per gosling. They were raised in isolation.

[0104] After 16 h, the goslings in both groups A and B were injected intramuscularly with Muscovy duck reovirus from geese diluted 10-fold with normal saline, 0.5 mL per gosling. The goslings were observed for 10 days after challenge, and the morbidity and mortality of the goslings in each group were recorded.

[0105] Results: 20 / 20 goslings in group A were protected after challenge; the goslings in group B started to show symptoms 12 h after challenge and 13 died within 10 days. This indicates that the yolk antibody prepared by the present invention has a good immune protection effect against Muscovy duck reovirus infection from geese.

[0106] Example 5: Application of the yolk antibody

[0107] 1. Application in the prevention of Muscovy duck reovirus from geese

[0108] Sixty 5-day-old susceptible goslings (with maternally-derived antibodies against Muscovy duck reovirus from geese all < 1:4) were used as the experimental subjects and randomly divided into three groups, with 20 goslings in each group. Among them:

[0109] Experimental group: The yolk antibody prepared in Example 3 was injected subcutaneously or intramuscularly into the neck, 0.5 mL per gosling;

[0110] Control group: Using the duck reovirus with NCBI accession number MK749407 as the immunogen, the inactivated vaccine of duck reovirus was prepared according to the method for preparing inactivated vaccine described in Example 2 of this application to immunize laying hens, and the yolk antibody was prepared according to the method of Example 3, and the yolk antibody was injected subcutaneously or intramuscularly into the neck, 0.5 mL per gosling;

[0111] Blank control group: Normal saline was injected subcutaneously or intramuscularly, 0.5 mL per gosling.

[0112] The above three groups of goslings were raised in isolation. After 16 h, they were respectively injected intramuscularly with Muscovy duck reovirus from geese diluted 10-fold with normal saline, 0.5 mL per gosling. The goslings were observed for 10 days after challenge, and the morbidity and mortality of the goslings in each group were recorded. The results are shown in Table 1.

[0113] Table 1:

[0114]

[0115] Note: Preventive protection is the number of healthy surviving goslings after virus challenge / the total number of goslings.

[0116] As can be seen from Table 1, the yolk antibody of the present invention has excellent preventive protection efficacy, can provide 100% preventive protection against the goose-origin Muscovy duck reovirus, and its protection efficacy is better than that of the yolk antibody prepared with the existing inactivated vaccine.

[0117] 2. Application in the treatment of goose-origin Muscovy duck reovirus

[0118] In the area where goose-origin Muscovy duck reovirus infection occurs, the symptoms are that there are a large number of white necrotic spots in tissues and organs such as the liver and spleen and joint cavity bleeding. Taking 30 goslings with similar disease courses as the test objects, they are randomly divided into 3 groups, with 10 in each group, and all are raised in isolation. Among them:

[0119] Experimental group: Subcutaneously or intramuscularly inject the yolk antibody prepared in Example 3 at a dose of 1.0 mL per gosling.

[0120] Control group: Immunize laying hens with the currently commercially available inactivated vaccine against Muscovy duck reovirus, and prepare the yolk antibody according to the method of Example 3, then subcutaneously or intramuscularly inject the yolk antibody at a dose of 1.0 mL per gosling.

[0121] Blank control group: Subcutaneously or intramuscularly inject normal saline at a dose of 1.0 mL per gosling.

[0122] Observe for 10 days and record the disease conditions and death situations of goslings in each group.

[0123] The results are as follows: After 2 days of injecting the yolk antibody in the experimental group, the feed intake of the diseased goslings began to increase, and the mental state improved significantly. No gosling died within 10 days. After 10 days, 1 / 2 of the goslings were culled and dissected, and it was found that the white necrotic spots in the livers and spleens of the diseased goslings were significantly reduced, and the amount of bleeding in the joint cavity was small. After injecting the yolk antibody in the control group, the feed intake and mental state of the diseased goslings did not improve significantly. Diseased goslings began to die from the 4th day after injecting the yolk antibody, and the mortality rate of the diseased goslings within 10 days was 30%. After 10 days, the surviving goslings were culled and dissected, and it was found that the white necrotic spots in the livers and spleens of the diseased goslings were not significantly reduced, and there were obvious symptoms of joint cavity bleeding. The mortality rate of the diseased goslings in the blank control group reached 45% within 10 days.

[0124] The above test results show that the yolk antibody of the present invention has good safety, good preventive effect and high cure rate, can be used for the prevention and treatment of goose-origin Muscovy duck reovirus infection, and has great economic and social benefits.

[0125] The above are only the preferred embodiments of the present application and are not intended to limit the present application. For those skilled in the art, various changes and modifications can be made to the present application. Any modification

[0126] equivalent replacement, improvement, etc. shall be included within the protection scope of the present application.

Claims

1. Use of an egg yolk antibody in the preparation of a product for preventing and / or treating Muscovy duck reovirus infection of goose origin; The egg yolk antibody is obtained by immunizing avian bodies with inactivated Muscovy duck reovirus with the preservation number of CCTCC NO: V202491 as an immunogen, and then extracting and purifying from the egg yolk of hyperimmunized avian eggs; The symptoms of Muscovy duck reovirus infection of goose origin are: diseased geese showing "flower liver disease" and joint cavity bleeding; The neutralizing antibody titer of the egg yolk antibody ≥ 1:1024; The preparation method of the egg yolk antibody includes the following steps: (1) Using inactivated Muscovy duck reovirus with the preservation number of CCTCC NO: V202491 as an immunogen to prepare an inactivated vaccine of Muscovy duck reovirus; (2) Injecting and immunizing avian bodies with the inactivated vaccine prepared in step (1) to obtain hyperimmunized avian eggs; (3) Collecting the egg yolk of hyperimmunized avian eggs, and preparing an egg yolk antibody for preventing and treating Muscovy duck reovirus after one inactivation, acid extraction, secondary inactivation, coarse filtration, sterile filtration, concentration and tertiary inactivation; In step (1), the inactivated vaccine is prepared by the following method: 1) Inoculating Muscovy duck reovirus with the preservation number of CCTCC NO: V202491 into LMH cells, proliferating and culturing Muscovy duck reovirus, then disrupting the cells by freeze-thawing, collecting the supernatant, and purifying to obtain Muscovy duck reovirus liquid; 2) Inactivating the Muscovy duck reovirus strain virus liquid, adding Tween-80 and mixing as the aqueous phase, using white oil, aluminum stearate and Span-80 mixed as the oil phase, mixing the oil phase and the aqueous phase evenly at a ratio of 2:1, and emulsifying to obtain an inactivated vaccine for preventing and treating Muscovy duck reovirus; The virus titer in the virus solution of the goose-origin Muscovy duck reovirus strain is 10 -6.2 TCID 50 / 0.1 mL.

2. The application according to claim 1, wherein The egg yolk antibody is used alone as a product for preventing and / or treating Muscovy duck reovirus infection of goose origin.

3. The application according to claim 1, characterized in that, The egg yolk antibody is used in combination with other immunological preparations and / or drugs to prepare a product for preventing and / or treating Muscovy duck reovirus infection of goose origin.

Images