A glycosyltransferase mutant and its application

Abstract

The present invention discloses a glycosyltransferase mutant and its application, belonging to the field of genetic engineering technology. The glycosyltransferase mutant has an amino acid sequence as shown in SEQ ID NO.1; or has a sequence with a homology of more than 95% with the amino acid sequence as shown in SEQ ID NO.1. The glycosyltransferase mutant provided by the present invention has a preference for C19 position, can perform glycosylation modification on the C19 position of a variety of steviol glycosides, and the enzyme activity is 1.3 times that of the glycosyltransferase UGT76G4.

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering, and in particular to a glycosyltransferase mutant and application thereof. Background Art

[0002] Steviol glycosides are a class of natural sweeteners extracted from stevia, with high sweetness and low calories. They are widely used in many fields such as food, beverages, health products and medicines as a substitute for sucrose. Through reasonable extraction and application, steviol glycosides can effectively help reduce calorie intake while maintaining the good taste of food and beverages.

[0003] Steviol glycosides include stevioside, rebaudioside A, rebaudioside D, rebaudioside M and other components. Some of these components are too low in content in stevia and are difficult to extract. They need to be converted from other steviol glycosides using biosynthesis, that is, glycosylation modification is performed at the C13 or C19 position of other steviol glycosides using glycosyltransferases. For example, rebaudioside M, which has high sweetness and no bitter aftertaste, needs to be connected to a new glucose at the C3 position of the first glucose at the C19 position of rebaudioside D. However, the existing glycosyltransferase UGT76G1 has a low glycosylation efficiency at the C19 position, resulting in low synthesis efficiency of rebaudioside M.

[0004] Patent CN 115094074 B discloses a glycosyltransferase UGT76G4 that can efficiently glycosylate steviol glycosides at the C19 position, which has a preference for the C19 position and improves the catalytic activity at the C19 position. On this basis, the present invention further improves the glycosylation efficiency of the C19 position of steviol glycosides, thereby further improving the synthesis efficiency of steviol glycosides such as rebaudioside M. Summary of the invention

[0005] In view of this, the object of the present invention is to provide a glycosyltransferase mutant and its application, so as to overcome the problem that the glycosyltransferase UGT76G1 in the prior art does not have a preference for the C19 position and the synthesis efficiency of steviol glycosides such as rebaudioside M is low.

[0006] In a first aspect, the present invention provides a glycosyltransferase mutant having an amino acid sequence as shown in SEQ ID NO.1; or having a sequence having a homology of more than 95% with the amino acid sequence as shown in SEQ ID NO.1.

[0007] Compared with the prior art, the glycosyltransferase mutant provided by the present invention has a preference for the C19 position, can perform glycosylation modification on the C19 position of a variety of steviol glycosides, and the enzyme activity is 1.3 times that of the glycosyltransferase UGT76G4.

[0008] In a second aspect, the present invention provides a nucleic acid encoding the above-mentioned glycosyltransferase mutant.

[0009] Preferably, the nucleic acid has the sequence shown in SEQ ID NO.2.

[0010] In a third aspect, the present invention provides an expression unit comprising a promoter and the above nucleic acid.

[0011] In a fourth aspect, the present invention provides a plasmid vector comprising the above-mentioned nucleic acid or the above-mentioned expression unit.

[0012] In a fifth aspect, the present invention provides a host cell comprising the above-mentioned plasmid vector, or the above-mentioned nucleic acid is integrated into its genome.

[0013] In a sixth aspect, the present invention provides a method for preparing a glycosyltransferase mutant, which is used to prepare the above-mentioned glycosyltransferase mutant, comprising: inducing and culturing the above-mentioned host cells to induce the host cells to express the glycosyltransferase mutant.

[0014] In a seventh aspect, the present invention provides the use of the above-mentioned glycosyltransferase mutant, nucleic acid, expression unit, plasmid vector or host cell in the preparation of steviol glycosides.

[0015] Preferably, the glycosyltransferase mutant, nucleic acid, expression unit, plasmid vector or host cell is used to prepare rebaudioside M. The glycosyltransferase mutant of the present invention can catalyze the synthesis of rebaudioside M with rebaudioside E and UDPG or rebaudioside D and UDPG as substrates, thereby improving the conversion efficiency of the product rebaudioside M.

[0016] In an eighth aspect, the present invention provides a use of a glycosyltransferase mutant, wherein the glycosyltransferase mutant is used for glycosylation of steviol glycosides.

[0017] Furthermore, the glycosylated steviol glycoside includes glycosylation modification at the C19 position of the steviol glycoside.

[0018] Furthermore, the steviol glycoside includes any one or more of stevioside, rebaudioside E, and rebaudioside D. That is, the C19 position of stevioside (STV), rebaudioside E, or rebaudioside D is glycosylated. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 These are the enzyme activity detection results of glycosyltransferase UGT76G4 and glycosyltransferase mutant M1 in Example 3.

[0020] Figure 2 is the conversion rate of STV by the glycosyltransferase mutant M1 in Example 4 at different pH values.

[0021] Figure 3 is the conversion rate of STV by the glycosyltransferase mutant M1 in Example 4 at different temperatures.

[0022] Figure 4 The catalytic results of the glycosyltransferase mutant M1 on Reb E in Example 5 are shown.

[0023] Figure 5 This is the reaction result of the glycosyltransferase mutant M1 coupled with sucrose synthase to amplify the conversion of Reb E in Example 5.

[0024] Figure 6 This is the result of the catalytic reaction of the glycosyltransferase mutant M1 on RD in Example 6.

[0025] Figure 7 This is the result of the RD reaction catalyzed by the glycosyltransferase mutant M1 coupled with sucrose synthase in Example 6.

[0026] Figure 8 This is the reaction result of the glycosyltransferase mutant M1 coupled with sucrose synthase to amplify and transform RD in Example 6. DETAILED DESCRIPTION

[0027] In order to make the technical problems, technical solutions and beneficial effects to be solved by the present invention more clearly understood, the present invention is further described in detail below in conjunction with specific embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0028] It should be understood that the raw materials used in the following examples are all commercially available raw materials unless otherwise specified. Example 1

[0029] Construction of a recombinant strain expressing the glycosyltransferase mutant M1

[0030] Using ugt76G4-F and ugt76G4-R as primers, cDNA of the glycosyltransferase UGT76G4 encoding gene as a template, and high-fidelity DNA polymerase (Wuhan Aibotek Biotechnology Co., Ltd.) was used for PCR amplification to obtain the correct UGT76G4 gene fragment. The nucleic acid sequence of the glycosyltransferase UGT76G4 encoding gene is shown in SEQ ID NO.3, and the amino acid sequence of the glycosyltransferase UGT76G4 is shown in SEQ ID NO.4. The glycosyltransferase UGT76G4 is disclosed in patent CN 115094074B.

[0031] ugt76G4-F:

[0032] GAGATATACATATGGCTAGCATGGAAAATAAAACGGAGACCACC (SEQ ID NO. 5).

[0033] ugt76G4-R:

[0034] GTGGTGGTGGTGCTCGAGTTACAACGATGAAATGTAAGAAA (SEQ ID NO. 6).

[0035] The UGT76G4 gene fragment was connected to the pET21a(+) vector after double digestion with NdeI and XhoI using the Gibson Assembly method. 5 μL of the ligation product was transformed into E. coli TOP10 competent cells, and the transformed strain was spread on solid Luria-Bertani (LB) medium containing 100 μg / mL ampicillin and cultured at 37°C for 14 hours. After the culture was completed, a single colony was picked from the culture medium for PCR verification, and the monoclonal colony with the correct length of the PCR amplification product was inoculated into liquid Luria-Bertani (LB) medium containing 100 μg / mL ampicillin for culture. After shaking and culturing overnight on a shaker at 37°C, the recombinant plasmid containing the UGT76G4 gene fragment was extracted from the colony.

[0036] The above recombinant plasmid was used as a template, F1 and F2 were used as primers, and a high-fidelity DNA polymerase (Wuhan Abotek Biotechnology Co., Ltd.) was used to perform a PCR amplification reaction. After the PCR amplification reaction product was digested with DpnI, a recombinant plasmid containing a glycosyltransferase mutant gene (SEQ ID NO.2) was obtained. The glycosyltransferase mutant was named M1. The mutant M1 was obtained by sequencing that the 85th amino acid of the amino acid sequence shown in SEQ ID NO.4 was mutated from L to F. The amino acid sequence of the mutant M1 is shown in SEQ ID NO.1.

[0037] F1: CCGACTCATGGTCCGTTCGCTGGTATGCGGATTCCGATTA (SEQ ID NO. 7).

[0038] F2: TAATCGGAATCCGCATACCAGCGAACGGACCATGAGTCGG (SEQ ID NO. 8).

[0039] The recombinant plasmid containing the glycosyltransferase mutant gene was transformed into E. coli BL21 (DE3) competent cells to obtain recombinant E. coli expressing the glycosyltransferase mutant M1. Example 2

[0040] Preparation of crude enzyme solution of glycosyltransferase mutant M1

[0041] LB solid medium: peptone 10 g / L, yeast powder 5 g / L, NaCl 10 g / L, agar powder 20 g / L.

[0042] A single colony of the above-mentioned recombinant Escherichia coli was inoculated into LB solid culture medium and cultured at 35°C for 16 hours. Colonies with uniform color, raised colonies, round and smooth surfaces, and colony diameters of 2 to 3 mm were selected and inoculated into 5 mL of LB liquid culture medium containing 50 mg / L of ampicillin. The culture was placed in a shaker at 37°C and 220 rpm for 7 hours to obtain a seed solution.

[0043] The above seed solution was inoculated into another LB medium at an inoculum rate of 1 v / v %, and cultured in a shaker at 37°C and 220 rpm. 600 When the pH value was 0.8, IPTG with a final concentration of 0.5 mM was added for induction culture, and shaking culture was continued at 25°C and 220 rpm in a shaker for 20 h.

[0044] After the induction culture was completed, the OD of the culture medium was measured. 600 The value was 4, and the cells were collected by centrifugation at 5000×g for 10 min. The cells were resuspended in 15mL of 100 mmol / L sodium phosphate buffer with a pH value of 7.0. The bacterial cells were disrupted by ultrasound to release the intracellular enzymes. The ultrasonic power was 400W and the ultrasound lasted for 30min. After the ultrasound, the cells were centrifuged at 8000×g for 10 min at 4℃ in a refrigerated centrifuge. The supernatant was collected as the crude enzyme solution of glycosyltransferase mutant M1. Example 3

[0045] Determination of enzyme activity

[0046] Using glycosyltransferase UGT76G4 as a control group, the crude enzyme solution of glycosyltransferase mutant M1 obtained in Example 2 was used to prepare the following reaction system (1 mL) to determine the enzyme activity:

[0047] (1) 100 mM phosphate buffer (pH 7.0), 2 mM UDPG, 1 mM STV (stevioside), and 5 OD of crude enzyme solution of glycosyltransferase mutant M1 were reacted at 40°C and 200 rpm for 30 min.

[0048] (2) 100 mM phosphate buffer (pH 7.0), 2 mM UDPG, 1 mM STV (stevioside), and 5 OD of crude enzyme solution of glycosyltransferase UGT76G4 were reacted at 40°C and 200 rpm for 30 min.

[0049] After the above two groups of reactions were completed, samples were taken respectively, and the reaction was terminated by heating at 95°C for 5 min. Four volumes of methanol were added and centrifuged at 12,000 rpm for 5 min. The supernatant was filtered through a 0.22 μm filter membrane, and the filtrate was detected by high performance liquid chromatography to calculate the enzyme activity.

[0050] The HPLC detection conditions are as follows:

[0051] Injection volume: 10 μL, chromatographic column: 5 μm, 250×4.6 mm, column temperature: 45°C. Chromatographic conditions: UV 210 nm, mobile phase: (A) acetonitrile, (B) 10 mmol sodium dihydrogen phosphate (pH adjusted to 2.6 with phosphoric acid), flow rate: 0.8 mL / min, elution program: 0-15 min, 26% volume of (A), 74% volume of (B); 16-42 min, 33% volume of (A), 67% volume of (B).

[0052] The results of the test are as follows Figure 1 As shown: Compared with the glycosyltransferase UGT76G4, the enzyme activity of the glycosyltransferase mutant M1 was significantly improved, which is 1.3 times that of the glycosyltransferase UGT76G4. Example 4

[0053] 1. Detect the effect of pH value on the stability of glycosyltransferase mutant M1. The specific detection process is as follows:

[0054] The crude enzyme solution of the glycosyltransferase mutant M1 obtained in Example 2 was used to prepare the following 5 reaction systems (1 mL) with different pH values:

[0055] 100mM phosphate buffer, 5mM UDPG, 2mM STV, 5OD of glycosyltransferase UGT76G4 mutant M1 crude enzyme solution.

[0056] In the above five reaction systems, the pH values ​​of the 100 mM phosphate buffer were set to 6, 6.5, 7, 7.5, and 8, respectively.

[0057] The above reaction systems were placed on a shaker for reaction at 35°C and 200 rpm for 0.5 h. After the reaction, samples were taken and heated at 95°C for 5 min to terminate the reaction. After cooling, 4 volumes of ethanol were added and centrifuged at 12000 rpm for 5 min. The supernatant was filtered through a 0.22 μm filter membrane, and the obtained filtrates were detected by liquid chromatography, and the substrate STV conversion rates were calculated.

[0058] The results of the test are as follows Figure 2 As shown: when the pH value of the reaction system is 7-7.5, the conversion rate of the substrate STV is the highest, indicating that the stability of the glycosyltransferase mutant M1 is the highest at this pH.

[0059] 2. The effect of temperature on the stability of glycosyltransferase mutant M1 was tested. The specific testing process is as follows:

[0060] The crude enzyme solution of the glycosyltransferase mutant M1 obtained in Example 2 was used to prepare the following 4 reaction systems (1 mL):

[0061] 100 mM phosphate buffer (pH 7.0), 0.5 mM UDPG, 5 mM STV, and crude enzyme solution of glycosyltransferase mutant M1 at a final concentration of 5 OD.

[0062] The above four reaction systems were placed on a shaker for reaction at 30°C, 35°C, 40°C, 45°C and 200 rpm for 0.5 h. After the reaction, samples were taken and heated at 95°C for 5 min to terminate the reaction. After cooling, 4 times the volume of ethanol was added, and after shaking and mixing, the mixture was centrifuged at 12000 rpm for 5 min. The supernatant was filtered through a 0.22 μM filter membrane, and the filtrate was detected by liquid chromatography, and the STV conversion rate was calculated.

[0063] The results of the test are as follows Figure 3 As shown: when the temperature of the reaction system is 35℃~40℃, the conversion rate of STV is the highest, indicating that the stability of the glycosyltransferase mutant M1 is the highest at this temperature. Example 5

[0064] 1. Detect the catalytic activity of glycosyltransferase mutant M1 on rebaudioside E (Reb E). The specific detection process is as follows:

[0065] The glycosyltransferase mutant M1 was tested in vitro in 4 reaction systems (1 mL):

[0066] 100 mM sodium phosphate buffer (pH 7.5), 20 OD of glycosyltransferase mutant M1 crude enzyme solution, 2 mM UDPG, and 0.5 mM Reb E.

[0067] The above reaction systems were placed at 35°C and 200 rpm for reaction. After the reaction was carried out for 10 min, 20 min, 30 min, and 60 min, an equal volume of anhydrous butanol was added to terminate the reaction, the mixture was shaken and mixed, and the mixture was centrifuged at 12000 rpm for 10 min. The supernatant was filtered through a 0.22 μm organic filter membrane, and the filtrate was used for qualitative and quantitative detection of the composition of the reaction products by high performance liquid chromatography.

[0068] The HPLC detection conditions are as follows:

[0069] Injection volume: 10 μL, chromatographic column: 5 μm, 250×4.6 mm, column temperature: 45°C. Chromatographic conditions: UV 210 nm, mobile phase: (A) acetonitrile, (B) 10 mmol sodium dihydrogen phosphate (pH adjusted to 2.6 with phosphoric acid), flow rate: 0.8 mL / min, elution program: 0-15 min, 26% volume of (A), 74% volume of (B); 16-42 min, 33% volume of (A), 67% volume of (B).

[0070] The results are as follows Figure 4 As shown: at 10 min, the glycosylation products of Reb E include not only rebaudioside D (Reb D) and rebaudioside AM (Reb AM), but also rebaudioside M (Reb M), and Reb AM is the main product, indicating that the glycosyltransferase mutant M1 has a preference for the C19 position.

[0071] At 30 min, the complete conversion of Reb E to Reb M was basically achieved, indicating that the glycosyltransferase mutant M1 mainly catalyzed Reb E to produce Reb AM by glycosylation at C19, and then rapidly produced Reb M in a short time by glycosylation at C13.

[0072] 2. Verification of the catalytic activity of Reb E after coupling glycosyltransferase mutant M1 with sucrose synthase. The specific process is as follows:

[0073] The function of the glycosyltransferase mutant M1 was verified in vitro according to the following reaction system (5 ml): 100 mM phosphate buffer (pH 7.5), 5 OD of crude enzyme solution of glycosyltransferase mutant M1, 5 OD of sucrose synthase enzyme solution, 0.5 mM UDPG, 5 mM Reb E, 50 mM sucrose, and 1 mM NaOH was used to maintain the pH of the conversion system at 7.5.

[0074] After reacting at 35°C and 200 rpm for 12 hours, an equal volume of anhydrous butanol was added to terminate the reaction, the mixture was shaken and mixed, and the mixture was filtered through a 0.22 μm organic filter membrane. The filtrate was used to qualitatively and quantitatively detect the composition of the reaction product using high performance liquid chromatography, and the detection conditions were the same as above. The test results showed that after 12 hours of reaction, Reb E was almost completely converted, the residual Reb E accounted for less than 5%, and the conversion product rebaudioside M (RM) accounted for more than 85%.

[0075] 3. Increase the amount of substrate: Reb E is used as the substrate to biosynthesize RM through the glycosyltransferase mutant M1 coupled with sucrose synthase. The specific process is as follows:

[0076] The following reaction system was amplified by in vitro shake flask transformation. The final concentration of the materials was as follows: 20OD of crude enzyme solution of glycosyltransferase mutant M1, 20OD of crude enzyme solution of sucrose synthase, 500mM sucrose, 1.5mM UDPG, 30mM Reb E, and the volume was fixed to 10ml with 100mM phosphate buffer. The pH of the transformation system was maintained at 7.5 with 1mM NaOH. The reaction was terminated after shaking at 35°C for 24h. Samples were taken at 4h, 8h, 16h, and 24h during the transformation process to detect the progress of the reaction. The samples were diluted to clarify and then filtered through a 0.22μm organic filter membrane to obtain the filtered clear liquid. The composition of the reaction products was qualitatively and quantitatively detected by liquid chromatography.

[0077] The results are as follows Figure 5 As shown: When the concentration of substrate Reb E increased to 30 mM, the glycosyltransferase mutant M1 coupled with sucrose synthase could convert most of the substrate into RM. Example 6

[0078] 1. Detection of the catalytic efficiency of the glycosyltransferase mutant M1 in preparing rebaudioside M using rebaudioside D (RD). The specific detection process is as follows:

[0079] The glycosylation results of RD were detected in vitro according to the following reaction system: 10OD of crude enzyme solution of glycosyltransferase mutant M1, 2mM UDPG, 1mM RD, and fixed to 500ul using phosphate buffer (pH 7.5).

[0080] After reacting at 35°C and 200 rpm for 60 min, an equal volume of anhydrous butanol was added to terminate the reaction, the mixture was shaken and mixed, and centrifuged at 12000 rpm for 10 min. The supernatant was filtered through a 0.22 μm organic filter membrane, and the filtrate was used to qualitatively and quantitatively detect the composition of the reaction product by liquid chromatography. The liquid chromatography detection conditions were the same as those in Example 5.

[0081] The results are as follows Figure 6 Shown: Glycosyltransferase mutant M1 can rapidly convert substrate RD into RM.

[0082] 2. Verification of RD catalytic activity of glycosyltransferase mutant M1 coupled with sucrose synthase. The specific process is as follows:

[0083] The function of the glycosyltransferase mutant M1 was verified in vitro according to the following reaction system (5 mL): 100 mM phosphate buffer (pH 7), 5 OD of crude enzyme solution of glycosyltransferase mutant M1, 5 OD of crude enzyme solution of sucrose synthase, 1 mM UDPG, 5 mM RD, 30 mM sucrose, and 1 mM NaOH was used to maintain the pH of the conversion system at 7.

[0084] After reacting at 35°C and 200 rpm for 24 hours, an equal volume of anhydrous butanol was added to terminate the reaction, the mixture was shaken and mixed, and the mixture was filtered through a 0.22 μm organic filter membrane. The filtrate was used to qualitatively and quantitatively detect the composition of the reaction product using high performance liquid chromatography under the same detection conditions as above.

[0085] Test results such as Figure 7 As shown: after 24 hours of reaction, RD was almost completely converted, and the proportion of the conversion product RM was >85%.

[0086] 3. Increase substrate concentration: RD is used as substrate to biosynthesize RM through glycosyltransferase mutant M1 coupled with sucrose synthase. The specific process is as follows:

[0087] The following reaction system was amplified by in vitro shake flask transformation, and the final concentration of the materials was as follows: 30OD of crude enzyme solution of glycosyltransferase mutant M1, 20OD of crude enzyme solution of sucrose synthase, 300mM sucrose, 1mM UDPG, 20mM Reb D, and the system was fixed to 20ml with 100mM phosphate buffer, wherein RD was added once every 1h, added in 2 times, and 1mM NaOH was used to adjust and maintain the pH of the transformation system at 7. Samples were taken at 4h, 8h, 16h, and 24h during the transformation process to detect the progress of the reaction, and the samples were diluted to clarify and then filtered through a 0.22μm organic filter membrane to obtain a filtered clear liquid, and the composition of the reaction products was qualitatively and quantitatively detected by liquid chromatography. The detection conditions were the same as those in Example 5.

[0088] Test results such as Figure 8 As shown: When the concentration of substrate RD increased to 20 mM, the glycosyltransferase mutant M1 coupled with sucrose synthase catalyzed the conversion of most RD to RM within 24 hours, and the proportion of RM was not less than 85%.

[0089] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Although the present invention is described in detail with reference to the aforementioned embodiments, those skilled in the art can still modify the technical solutions described in the aforementioned embodiments or replace some of the technical features therein by equivalents. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A glycosyltransferase mutant, characterized in that: The mutant is obtained by mutating the 85th amino acid of the amino acid sequence shown in SEQ ID NO.4 from L to F, and the amino acid sequence of the mutant is shown in SEQ ID NO.

1.

2. A nucleic acid encoding the glycosyltransferase mutant according to claim 1.

3. An expression unit, characterized in that Contains a promoter and the nucleic acid according to claim 2.

4. A plasmid vector, characterized in that It comprises the nucleic acid according to claim 2 or the expression unit according to claim 3.

5. A host cell, characterized in that Contains the plasmid vector of claim 4, or has the nucleic acid of claim 2 integrated into its genome.

6. A method for preparing a glycosyltransferase mutant, for preparing the glycosyltransferase mutant according to claim 1, characterized in that: include: The host cell according to claim 5 is subjected to induction culture to induce the host cell to express the glycosyltransferase mutant.

7. Use of the glycosyltransferase mutant according to claim 1, the nucleic acid according to claim 2, the expression unit according to claim 3, the plasmid vector according to claim 4 or the host cell according to claim 5 in the preparation of steviol glycosides, wherein the steviol glycosides are any one or more of stevioside, rebaudioside E and rebaudioside D.

8. An application of a glycosyltransferase mutant, characterized in that: The glycosyltransferase mutant according to claim 1 is used to glycosylate steviol glycosides, wherein the steviol glycosides are any one or more of stevioside, rebaudioside E, and rebaudioside D.

9. The use according to claim 8, characterized in that: The glycosylated steviol glycoside comprises glycosylation modification at the C19 position of the steviol glycoside.

Images