An attenuated endotoxin vaccine strain of Haemophilus parasuis and its preparation method and application
By constructing an optimized LpxE gene plasmid and electroporating it to transform Haemophilus parasuis, the phosphate group was specifically removed, which solved the problem of endotoxin attenuation in Haemophilus parasuis and achieved a highly efficient endotoxin attenuation effect.
Patent Information
- Application Number
- CN202411299265.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-09-18
- Publication Date
- 2025-09-16
- Estimated Expiration
- 2044-09-18
AI Technical Summary
The existing technology cannot effectively achieve the attenuation of endotoxin of Haemophilus parasuis.
By constructing an optimized LpxE gene plasmid and transforming it into Haemophilus parasuis by electroporation, the phosphate groups on the A1 position of some lipids in the wild-type strain are specifically removed, thereby transforming Haemophilus parasuis.
The endotoxin attenuation of Haemophilus parasuis was successfully achieved, with the dephosphorization effect reaching 83.96%, an increase of 65% compared with the existing technology, significantly improving the safety and immune effect of the strain.
Smart Images

Figure CN119307529B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the biological field, and more specifically, relates to an attenuated Haemophilus parasuis endotoxin vaccine strain and a preparation method and application thereof. Background Art
[0002] Haemophilus parasuis disease (H. parasuis) is an infectious disease caused by Haemophilus parasuis of pigs, characterized by fever, joint swelling, difficulty breathing, polyserositis, arthritis and high mortality. It is also called polyfibrinous serositis and arthritis, which seriously endangers the health of piglets and young pigs.
[0003] The applicant has previously applied for an invention patent CN115216478B, a method for constructing and applying an attenuated inactivated vaccine strain of avian Pasteurella multocida endotoxin. The method uses a plasmid containing a codon-optimized LpxE gene to transform into avian Pasteurella multocida to obtain an attenuated inactivated vaccine strain of avian Pasteurella multocida endotoxin.
[0004] In this application, the dephosphorization efficiency was 16.23%.
[0005] The applicant plans to continue using this strategy to carry out experiments on attenuation of Haemophilus parasuis endotoxins, but found that directly copying this method cannot effectively attenuate the endotoxins of Haemophilus parasuis.
[0006] Therefore, the technical problem solved in this case is: how to achieve effective endotoxin attenuation of Haemophilus parasuis. Summary of the Invention
[0007] The main purpose of the present invention is to provide an endotoxin-attenuated vaccine strain of Haemophilus parasuis, which optimizes the LpxE gene using different strategies to obtain a new plasmid, thereby successfully achieving endotoxin attenuation in Haemophilus parasuis.
[0008] At the same time, the invention also discloses a preparation method and application of the strain.
[0009] According to a first aspect of the present invention, a method for preparing an endotoxin-attenuated vaccine strain of Haemophilus parasuis is provided, wherein a plasmid containing an optimized LpxE gene is electroporated into Haemophilus parasuis to obtain an endotoxin-attenuated vaccine strain; the sequence of the optimized LpxE gene is shown in SEQ ID NO.1.
[0010] In the above preparation method, the plasmid vector is a pET28 plasmid vector.
[0011] Meanwhile, the present invention also discloses an attenuated endotoxin vaccine strain of Haemophilus parasuis, which is prepared by the method described above.
[0012] At the same time, the present invention also provides a use of the above-mentioned Haemophilus parasuis endotoxin attenuated vaccine strain for preparing a vaccine.
[0013] Finally, the present invention discloses a vaccine comprising the endotoxin-attenuated vaccine strain of Haemophilus parasuis as described above.
[0014] One of the above technical solutions of the present invention has at least one of the following advantages or beneficial effects:
[0015] The present invention successfully obtained an endotoxin-attenuated strain by constructing a recombinant plasmid expressing the LpxE gene and transforming it into Haemophilus parasuis through electroporation. The present invention also successfully transformed Haemophilus parasuis by using the optimized LpxE gene to specifically remove the phosphate group at the A1 position of some lipids in the wild-type strain. BRIEF DESCRIPTION OF THE DRAWINGS
[0016] Figure 1 This is the plasmid map of plasmid pSF814;
[0017] Figure 2 is the plasmid map of plasmid pSF815-lpxE;
[0018] Figure 3 is the plasmid map of plasmid pSF816-lpxE;
[0019] Figure 4 This is the mass spectrometry analysis of lipid A extracted from the wild sc096 strain;
[0020] Figure 5 Mass spectrometry analysis of lipid A extracted from the plasmid constructed for the original LpxE gene;
[0021] Figure 6 Mass spectrometry analysis of lipid A extracted from the plasmid constructed with the optimized LpxE gene;
[0022] Figure 7 This is the electrophoresis diagram of the amplified Pasteurella replicon fragment;
[0023] Figure 8 is the electrophoresis diagram of the amplified vector fragment;
[0024] Figure 9 is the electrophoresis diagram of the amplified native lpxE gene;
[0025] Figure 10 This is the electrophoresis diagram of the optimized gene lpxE-opt amplification. DETAILED DESCRIPTION
[0026] The embodiments of the present invention are described in detail below. The embodiments are exemplary and are only used to explain the present invention, and are not to be construed as limiting the present invention.
[0027] Experimental methods
[0028] 1. Construction of pSF814 plasmid
[0029] (1) First, we commissioned Sangon Gene to synthesize the Pasteurella replicon (NCBI No.: DQ125466.1, SEQ ID NO. 2);
[0030] (2) Obtain the Pasteurella replicon fragment using the following primers P1 and P2;
[0031] P1:GATCCCTTTTTCTGTAATCTGTTTCG(SEQ ID NO.6)
[0032] P2:GATCATAGGCTCAATTCTCGCAATT(SEQ ID NO.7)
[0033] The amplification conditions used for PCR cloning were: 95°C for 3 min; 95°C for 15 s, 55°C for 15 s, 72°C for 90 s, 35 cycles; 72°C for 3 min; the amplification electrophoresis can be seen Figure 7 .
[0034] The nucleotide sequence of the cloned Pasteurella replicon fragment is shown in SEQ ID NO. 2;
[0035] (3) Amplify the pET28 vector using the following primers p3 and p4 to obtain the vector fragment
[0036] P3: TGCGAGAATTGAGCCTATGATCAACGCCAGCAACGCGGCCTT (SEQ ID NO.8)
[0037] P4: GAAACAGATTACAGAAAAAGGGATTCTTTCCATAGGCTCCGCCCCCCTGAC (SEQ ID NO.9)
[0038] The amplification conditions used for cloning were: 95°C for 3 min; 95°C for 15 s, 56°C for 15 s, 72°C for 3 min, 40 cycles; 72°C for 6 min. The amplification electrophoresis was visible. Figure 8 .
[0039] The nucleotide sequence of the pET28 vector fragment is shown in SEQ ID NO. 3;
[0040] (4) The obtained Pasteurella replicon fragment and pET28 vector fragment were sent for sequencing after confirming their correct size by PCR. After confirming that there were no mutations, the target gene was recovered and purified using a DNA gel recovery kit;
[0041] (5) Determine the concentration of the recovered product using an ultramicro spectrophotometer;
[0042] (6) Prepare seamless homologous recombination solution in a microcentrifuge tube, the total volume is 10 μL, and the DNA solution system is shown in Table 1 below;
[0043] Table 1 System for preparing seamless homologous recombination solution
[0044]
[0045]
[0046] (7) Connection: Place in a metal bath at 50°C for 50 minutes;
[0047] (8) Transformation: Take out a tube of competent DH5αE.coli from -80℃ and place it on ice. After 5 minutes, add 10μL of the ligation product in step (7). After reacting on ice for 25 minutes, heat shock for 45 seconds, quickly put it back on ice, let it stand for 3 minutes, then add 700μL of antibiotic-free LB liquid culture medium, and culture at 37℃, 200r / min shaking for 1 hour;
[0048] (9) Sequencing identification: Spread 100 μL of bacterial solution on a kanamycin LB agar plate, wait for the bacteria to grow, pick a single colony and perform bacterial solution PCR. The PCR amplification reaction conditions and system are the same as those in step (3) above.
[0049] The bacterial solution corresponding to the positive band was sequenced;
[0050] (10) Extraction of plasmid and preservation of seed: The bacterial solution with correct sequencing results was expanded and cultured. The plasmid pSF814 was extracted using a plasmid extraction kit and stored at -20°C. The bacterial solution was then preserved at -80°C using LB liquid culture medium containing 15-20% glycerol.
[0051] The plasmid map of plasmid pSF814 is shown in Figure 1 ;
[0052] The nucleotide sequence of plasmid pSF814 is shown in SEQ ID NO. 4;
[0053] 2. Construction of pS815 and pS816 plasmids
[0054] (1) Gene synthesis of the native lpxE gene and the codon-optimized lpxE gene, respectively. The native sequence is from Francisella tularensis subsp. novicida FTG (ABXZ01000007.1, 38038-38757); the nucleotide sequence of the native lpxE gene is shown in SEQ ID NO. 5; the nucleotide sequence of the codon-optimized lpxE gene is shown in SEQ ID NO. 1;
[0055] (2) Primers p5 and p6 were used to amplify the native lpxE gene, and the amplified electrophoresis showed Figure 9 ;
[0056] The codon-optimized gene lpxE-opt was amplified using primers p5 and p7. The amplified electrophoresis pattern showed Figure 10 ;
[0057] P5: GGTGGACAGCAAATGGGTCGC ACGTGGCAATGACAGTGCTTTTAG (SEQ ID NO.10)
[0058] P6: GTGGTGGTGCTCGAGTGCGGCCGC CTAAATAATCTCTCTATTTCTCATCCA (SEQ ID NO.11)
[0059] P7: GTGGTGGTGCTCGAGTGCGGCCGC TTAAATGATTTCGCGGTTACGCATC (SEQ ID NO. 12)
[0060] The amplification conditions used for cloning were: 95°C for 3 min; 95°C for 15 s, 60°C for 30 s, 72°C for 60 s, 40 cycles; 72°C for 2 min
[0061] (3) Enzyme digestion: pSF814 was digested with BamHI and HindIII enzymes. The digestion system was: 1 μg of enzyme plus 10 μg of pSF814 plasmid. The digestion conditions were 37°C in a water bath for 30 min. After digestion, the target gene was recovered and purified using a DNA gel recovery kit. The concentration of the recovered product was measured using an ultra-micro spectrophotometer.
[0062] (4) lpxE and lpxE-opt were connected to pSF814 using seamless recombination to obtain pSF815 and pSF816.
[0063] Prepare a DNA solution in a microcentrifuge tube, the total volume is 10 μL, and the seamless homologous recombination solution system is shown in Table 2 below;
[0064] Table 2 System for preparing seamless homologous recombination solution
[0065] Reagents Usage amount (μL) pSF814 2 lpxE / lpxE-opt 3 Homologous recombination enzyme 5
[0066] (5) Connection: Place in a metal bath at 50°C for 50 minutes;
[0067] (6) Transformation: Take out two tubes of competent DH5αE.coli from -80℃ and place them on ice. After 5 minutes, add 10μL of the ligation product in (5). After reacting on ice for 25 minutes, heat shock for 45 seconds, quickly put them back on ice, let them stand for 3 minutes, and then add 100μL of antibiotic-free LB liquid culture medium to each tube. Incubate at 37℃, 200r / min on a shaking platform for 1 hour.
[0068] (7) Sequencing identification: 100 μL of bacterial solution was spread on a kanamycin LB agar plate. After the bacteria grew, single colonies of pS815-DH5α E. coli and pS816-DH5α E. coli were picked for detection. The target band size was about 900 bp, indicating that the target bands LpxE and lpxE-opt were present in the pSF815-lpxE plasmid and pSF816-lpxE plasmid. The bacterial solution corresponding to the positive bands was sequenced.
[0069] (8) Extraction of plasmids and preservation of seed: The bacterial solution with correct sequencing results was expanded and cultured. Plasmid pSF815-lpxE and plasmid pSF816-lpxE were extracted using a plasmid extraction kit and stored at -20°C. The bacterial solution was then preserved at -80°C using LB liquid culture medium containing 15-20% glycerol.
[0070] The plasmid map of plasmid pSF815-lpxE is shown in Figure 2 ;
[0071] The plasmid map of plasmid pSF816-lpxE is shown in Figure 3 .
[0072] 3. Preparation of electroporation competent cells of Haemophilus parasuis
[0073] TSB medium: Add 15 g of Tryptone, 5 g of Peptones soybean, and 5 g of NaCl to 1 L of deionized water, adjust the pH to neutral, set the autoclave at 121°C, steam sterilize, and store in a refrigerator at 4°C.
[0074] TSA medium: Add 40 g of Tryptone SOYA AGAR and 3 g of YEAST EXTRACT to 1 L of deionized water. Set the autoclave to 121°C for steam sterilization and store at room temperature.
[0075] The Haemophilus parasuis sc096 strain was obtained from the National and Local Joint Engineering Laboratory for Zoonotic Disease Prevention and Control Preparations of South China Agricultural University.
[0076] The two plasmids pSF815-lpxE and pSF816-lpxE constructed above were transformed into Haemophilus parasuis by electroporation, and the specific method for preparing Haemophilus parasuis electroporation competent cells is as follows:
[0077] (1) A single colony of Haemophilus parasuis sc096 was selected and inoculated into 3–4 mL of TSB liquid culture medium. The culture was shaken at 37°C and 200 rpm for 12–14 h.
[0078] (2) Inoculate the sc096 strain into 100 mL of fresh TSB liquid medium at a ratio of 1:100 and culture at 37°C, 200 rpm, and shake for about 2.5 to 3 hours until the OD 600 When the value reaches 0.4-0.6, hyaluronidase is added at a ratio of 100 U / mL and the shaking culture is continued for 30 min;
[0079] (3) Precool the bacterial solution on ice for 15–30 min (shake occasionally to accelerate the cooling of the bacterial solution). Aliquot the bacterial solution into precooled 50 mL centrifuge tubes. Precool the centrifuge to 4°C, centrifuge at 4000 rpm for 10 min, and discard the supernatant.
[0080] (4) Wash the cells four times with sterilized pre-cooled sucrose 272, centrifuge at 4°C, 4000 rpm for 10 min, and discard the supernatant;
[0081] (5) Add 1.5 mL to 2 mL of sterile, pre-cooled sucrose 272 to resuspend the cells, then dispense into sterile, pre-cooled 1.5 mL centrifuge tubes at a rate of 90 μL / tube and store in a -80°C refrigerator.
[0082] 4. Electroporation and identification of phosphatase overexpressing plasmids
[0083] The two plasmids pSF815-lpxE plasmid and pSF816-lpxE plasmid were transformed into competent cells of Haemophilus parasuis. The specific steps are as follows:
[0084] (1) The competent cells of Haemophilus parasuis sc096 strain prepared above were taken out from a -80°C refrigerator and placed on an ice-water mixture to melt;
[0085] (2) Take out a 0.1 cm electric shock cup and cup cover, take it out of the storage solution and place it upside down on clean absorbent paper for 5 minutes to drain the water. Place it upright for 5 minutes to allow the ethanol to evaporate completely. Once the ethanol evaporates completely, immediately insert it into ice and compact the ice surface. Keep the top of the electrode cup 0.5 cm away from the ice surface to facilitate the cover. Let it stand in the ice for 5 minutes to fully cool down.
[0086] (3) Add 5 μL of recombinant plasmids pSF815-lpxE plasmid and pSF816-lpxE plasmid to the competent cell strain sc096 in the 1.5 mL centrifuge tube prepared in advance, stir the bottom of the tube by hand to mix, immediately insert it into ice, and place it on the ice-water mixture for 10 minutes; use the tip of the pipette to quickly transfer the competent cell and plasmid mixture to a 0.1 cm ice-bathed electroporation cup, cover the cup, and keep the empty tube for later use. Avoid generating bubbles when adding the competent cells to the electroporation cup, as bubbles will increase the risk of arc discharge;
[0087] (4) Set the parameters of the electroporator: voltage 1850V / cm, pulse resistance 200Ω, capacitance 50μF, wipe the water outside the electroporation cup dry and then perform electroporation. After the electroporation is completed, add 1mL TSB liquid culture medium to mix the bacteria (TSB culture medium should be added quickly after electroporation), and transfer to a 1.5mL EP tube. Note: When adding plasmid, the volume should not be greater than 1 / 10 of the competent volume; if the plasmid is impure or contaminated by organic matter such as ethanol, the transformation efficiency will drop sharply; if the plasmid is doubled, the transformation efficiency will drop by one order of magnitude. Be gentle when mixing in the plasmid. Transforming high-concentration plasmids can reduce the amount of bacteria used for plating. When the density of positive clones on the plate is too high, the positive clones grow slower and the colonies become smaller due to insufficient nutrition. In order to obtain large colonies, the amount of plasmid should be reduced;
[0088] (5) After preheating at 37°C, transfer to a shaking incubator at 200 rpm for 2–3 h (preheating after transformation can increase homologous recombination and bacterial survival rate) to fully activate the bacteria.
[0089] (6) Spread the bacterial suspension on TSA agar plates containing Km resistance, with 200 μL applied to one plate;
[0090] (7) Place the plate in a 37°C incubator until the liquid is completely absorbed, invert the plate, and observe the results after incubation for 36 to 48 hours;
[0091] (8) After the bacteria grow, pick a single colony and perform PCR on the bacterial solution, and sequence the bacterial solution corresponding to the positive band;
[0092] (9) After the sequencing results were verified to be correct, an endotoxin-attenuated strain of Haemophilus parasuis was obtained, and the strain was expanded and freeze-dried and stored in a -80°C refrigerator.
[0093] The final endotoxin-attenuated strain of Haemophilus parasuis was preserved in the National and Local Joint Engineering Laboratory for Zoonotic Disease Prevention and Control Preparations of South China Agricultural University, and this endotoxin-attenuated strain was used for subsequent experiments.
[0094] 5. Extraction of lipid A from Haemophilus parasuis
[0095] (1) The two endotoxin-attenuated strains of Haemophilus parasuis constructed in 2 were used to extract lipid A, and single bacteria were picked and inoculated into 10 mL of TSB medium and cultured at 37°C in a shaking incubator for 16 h;
[0096] (2) 1% seed solution was added to 300 mL of TSB medium for expansion and cultured overnight at 37°C and 200 rpm for 24 h.
[0097] (3) The expanded culture solution was centrifuged at 3500 × g for 20 min to collect the cells;
[0098] (4) The bacterial pellets were then washed twice with phosphate buffered saline (PBS), centrifuged at 5000 rpm for 15 min, and the cells were collected again (to flush out excess culture medium to prevent any impact on subsequent experiments);
[0099] (5) Add 10 mL of double-distilled water to the precipitated bacteria and mix thoroughly with a pipette to fully resuspend them in the double-distilled water. Observe the bacterial solution until there are no obvious bacterial clumps.
[0100] (6) Add 8 mL of bacterial solution to a 100 mL beaker with a magnetic stirring bar.
[0101] (7) Chloroform and methanol were added to a beaker at a final ratio of 1:2:0.8 (chloroform:methanol:water v / v) to form a single-phase Bligh / Dyer mixture;
[0102] (8) The bacterial solution and the mixture were magnetically stirred at room temperature for 1 h;
[0103] (9) Transfer the liquid to a Nalgene centrifuge tube and centrifuge at 2500 × g for 20 min;
[0104] (10) After centrifugation, a white precipitate was obtained. The supernatant was discarded and the precipitate was resuspended in 19 mL of a monophasic Bligh / Dyer mixture and washed once.
[0105] (11) Centrifuge again, discard the supernatant, and let it sit for a while until the organic liquid evaporates and the precipitate becomes slightly dry;
[0106] (12) Add 13.5 mL of 12.5 mM sodium acetate (pH 4.5) to the dried pellet and vortex to fully resuspend the pellet;
[0107] (13) The resuspended pellet was placed in boiling water for 30 min to release lipid A from LPS;
[0108] (14) After cooling, add 15 mL of a 1:1 mixture of methanol and 15 mL of chloroform (final ratio 2:2:1.8);
[0109] (15) Vortex the mixture to fully lyse and extract lipid A;
[0110] (16) After lysis, centrifuge at 2500 × g for 20 min to separate the two phases;
[0111] (17) Using a pipette, carefully transfer the lower portion of the bottle, i.e., the chloroform phase, to a round-bottom flask and dry on a rotary evaporator for 30 min to obtain dry lipid A.
[0112] (18) Dried lipid A was dissolved in chloroform:methanol (2:1, v / v) by vortexing and sonication, transferred to a glass tube, dried, sealed with a Teflon-lined cap, and stored at −80 °C;
[0113] 6. MALDI-TOF / TOF-MS Mass Spectrometry Analysis of Lipid A
[0114] Mass spectrometric analysis of lipid A was performed using MALDI-TOF / TOF MS (matrix-assisted laser desorption ionization time-of-flight tandem mass spectrometry) in negative ion mode. 1 μL of each of the three extracted lipid A samples (A: lipid A extracted from the wild-type sc096 strain, B: lipid A extracted from a plasmid constructed with the original LpxE gene, and C: lipid A extracted from a plasmid constructed with the optimized LpxE gene) was spotted onto a MALDI plate. Subsequently, 1 μL of matrix solution dissolved in chloroform / methanol / water (3:1.5:0.25, v / v / v) was added. The laser intensity was adjusted to 500 shots and 50% laser power for analysis.
[0115] Note: For MS / MS analysis, the LIFT mode was used. Based on the MS mass spectrum, the precursor ion was selected and the MS / MS analysis was performed in the LIFT TOF / TOF mode. The instrument was calibrated using the ES Tuning Mix (Agilent, Palo Alto, CA, USA).
[0116] The results of mass spectrometry analysis of lipid A are as follows Figures 4 to 6 As shown, Figure 4For wild-type sc096, the phosphorus ratio is 2.40%; Figure 5 It is native LpxE, with a dephosphorization ratio of 29.64%; Figure 6 The optimized LpxE gene was used, with Group C achieving a dephosphorylation rate of 83.96%, demonstrating excellent results. Mass spectrometry analysis also confirmed that LpxE specifically removed the phosphate group at the A1 position of some lipids in the attenuated endotoxin-producing strain of Haemophilus parasuis, sc096, demonstrating successful modification of the lipopolysaccharide structure of Haemophilus parasuis.
[0117] One of the advantages of the present invention is that: LpxE is optimized through a selected codon optimization strategy to obtain an optimized LpxE gene, and the dephosphorylation effect of the optimized LpxE gene reaches 83.96%. Compared with the applicant's prior patent application CN115216478B, the dephosphorylation effect of the avian Pasteurella multocida obtained by the construction method of a avian Pasteurella multocida endotoxin attenuated inactivated vaccine strain and the application thereof is increased by 65%, which is equivalent to 5 times the dephosphorylation effect of the prior solution.
Claims
1. A method for preparing an attenuated endotoxin vaccine strain of Haemophilus parasuis, characterized in that: The plasmid containing the optimized LpxE gene was transformed into the Haemophilus parasuis sc096 strain by electroporation to obtain an endotoxin attenuated vaccine strain; the sequence of the optimized LpxE gene is shown in SEQ ID NO.
1.
2. The preparation method according to claim 1, characterized in that The plasmid vector is a pET28 plasmid vector.
3. An attenuated endotoxin vaccine strain of Haemophilus parasuis, characterized in that: The method according to claim 1 or 2 is used for preparation.
4. Use of the attenuated Haemophilus parasuis endotoxin vaccine strain as claimed in claim 3 in preparing a vaccine.
5. A vaccine, characterized in that Contains the attenuated vaccine strain of Haemophilus parasuis endotoxin as claimed in claim 3.
Citation Information
Patent Citations
Construction method and application of an attenuated inactivated vaccine strain of avian Pasteurella multocida endotoxin
CN115216478B