Application of GHERF114 gene in regulating plant salt stress and drought stress tolerance

Abstract

The present invention discloses the application of the GHERF114 gene in regulating plant salt stress and drought stress tolerance, and the ID of the gene is GH_A05G2445. The present invention obtains a homozygous Arabidopsis thaliana overexpressing the GHERF114 gene through transgenic technology, and verifies that the tolerance of transgenic Arabidopsis to salt stress and drought stress is significantly reduced through phenotypic changes, leaf wilting degree, comparison of the size and morphology of rosette leaves, water loss rate of detached leaves, relative water content of leaves and chlorophyll content after salt stress and drought stress treatment. TRV: GHERF114 gene silenced plants are obtained through VIGS technology, and the silenced plants have significantly increased salt tolerance and drought resistance compared with the control group after salt stress and drought stress treatment. The results show that GHERF114 plays an important role in the response process of plant salt stress and drought stress, and is of great significance in breeding and research to improve cotton salt tolerance and drought tolerance. It can be used through gene knockout technology and applied to the screening of stress-resistant cotton varieties.

Description

Technical Field

[0001] The invention relates to the field of genetic engineering, and in particular to application of cotton gene GHERF114 in regulating plant salt stress resistance and drought stress resistance. Background Art

[0002] As an important economic crop, cotton has been planted in China for more than 2,000 years. As a "pioneer crop" of saline-alkali land, cotton has a strong adaptability to soil with high salinity. However, with the decreasing amount of arable land and the increasing severity of soil salinization, the emergence of more and more saline-alkali land is a severe test for the survival of cotton and the yield of fiber. With the progress of the times and the development of scientific research, bioinformatics technology can be used to accurately mine a number of salt-tolerant and drought-resistant cotton genes, and genetic engineering, molecular biology and biological breeding methods can be combined to analyze the salt tolerance and drought resistance analysis mechanism of cotton, and obtain a number of transgenic cotton varieties with salt tolerance and drought resistance. This can not only further utilize the saline-alkali land in coastal and inland areas and increase the planting area, but also further improve the fiber quality of cotton.

[0003] AP2 / ERFs are characterized by an APETALA2 (AP2) / ethylene response element binding factor (EREB) domain consisting of 40-70 conserved amino acids involved in DNA binding. AP2 / ERFs contain four major subfamilies: AP2, RAV, dehydration response element binding proteins (DREBs), and ethylene response factors (ERFs). AP2 / ERFs act as transcription factors and regulate genes involved in a variety of biological processes such as growth, development, hormones, and stress responses through multiple mechanisms such as transcriptional and post-translational regulation. DREBs have been extensively studied in abiotic stresses, where they respond and actively regulate cold, drought, heat, and salt tolerance by directly regulating stress response genes.

[0004] In addition, many other Arabidopsis ERFs also regulate abiotic stresses. ERF1 and ethylene-salt-induced ERF genes (ESEs) in the ERF-IX group positively regulate plant salt tolerance by promoting the expression of salt-responsive genes. Another member of the ERF-IX group, ERF6, triggers growth inhibition to obtain long-term osmotic stress tolerance. RAP2.6L of the ERF-X subgroup improves drought and salt tolerance. In addition, Arabidopsis RAVs, especially AP2s, play a central role in developmental processes such as the control of organ number and size, maintenance of stem and root meristems, and flower formation and growth. The cotton gene GHERF114 has an ID of GH_A05G2445 and a full CDS length of 1245 bp. It is an ethylene-responsive transcription factor ERF114. Currently, there is no application of GHERF114 in molecular breeding of cotton stress resistance. Summary of the invention

[0005] In view of the problems existing in the prior art, the purpose of the present invention is to provide an application of cotton gene GHERF114 in regulating plant salt stress and drought stress tolerance, and expand the application scope of gene GHERF114. Further research on the function of GHERF114 gene in cotton can provide good gene resources for cultivating cotton stress resistance molecular breeding.

[0006] The technical solution of the present invention is: application of cotton gene GHERF114 in regulating plant salt stress resistance and drought stress resistance, and the CDS sequence of the cotton gene GHERF114 is shown in sequence 1.

[0007] Furthermore, the stress is abiotic stress, including but not limited to salt stress and drought stress.

[0008] Furthermore, the above application is to use a plant overexpression vector to overexpress the cotton gene GHERF114 in Arabidopsis or cotton, thereby reducing the salt and drought stress tolerance of the plant.

[0009] Furthermore, the above application is to use virus-induced gene silencing technology (VIGS) to silence the specific sequence fragment of the cotton gene GHERF114, and transform it into cotton through Agrobacterium-mediated transformation to improve the plant's tolerance to salt and drought stress.

[0010] The present invention also discloses a plant breeding method, wherein the expression of the GHERF114 gene in the target plant is regulated by overexpressing or silencing the GHERF114 gene, the nucleotide sequence of the GHERF114 gene is shown in Sequence 1, and the target plant is cotton or Arabidopsis thaliana.

[0011] The present invention also discloses a method for reducing plant resistance to salt and drought stress, using a plant overexpression vector to introduce a GHERF114 gene of upland cotton into the plant to obtain a transgenic plant that is more sensitive to salt and drought, wherein the plant is cotton or Arabidopsis thaliana.

[0012] The advantages and positive effects of the present invention are:

[0013] The present invention discloses the application of the upland cotton gene GHERF114 in reducing the ability of plants to withstand salt and drought stress. The gene ID of the upland cotton gene GHERF114 is GH_A05G2445. The present invention obtains a homozygous Arabidopsis thaliana line overexpressing the GHERF114 gene through transgenic technology. After salt and drought stress treatment, it is found that the tolerance to salt and drought stress is significantly reduced, which is mainly manifested in: (1) The GHERF114 gene can be highly upregulated after salt stress and drought stress. (2) From the phenotype and leaf size morphology of the transgenic lines (OE-8, OE-11) and the wild type after salt and drought stress, it can be seen that compared with the wild type, the salt and drought stress have a greater impact on the transgenic lines. (3) Overexpression of the GHERF114 gene can increase the impact of osmotic stress on plants to a certain extent. Compared with the wild type, the leaf chlorophyll content, leaf relative water content and ion leaf water loss rate of the transgenic lines are lower, which reduces the tolerance of plants to abiotic stress. Therefore, the present invention has important significance in breeding and research for improving the salt and drought tolerance of cotton. Subsequently, the gene knockout technology can be used to quickly screen out salt and drought tolerant cotton varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings required for use in the embodiments are briefly introduced below. It should be understood that the following drawings only show the embodiments of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other relevant drawings can be obtained based on these drawings without creative work.

[0015] Figure 1 Schematic diagram of the relative expression of the GHERF114 gene analyzed by qRT-PCR and the subcellular localization results of GHERF114 in tobacco provided in the preferred embodiment of the present invention, A: expression level of the GHERF114 gene in different tissues of cotton, such as roots, stems, leaves and flowers under normal growth conditions; B: expression level of GHERF114 in cotton seedlings under salt stress (350 mM NaCl) at different treatment times; C: schematic diagram of the subcellular localization results of GHERF114 in tobacco;

[0016] Figure 2 Schematic diagram of bioinformatics analysis of the gene GHERF114 in upland cotton provided in a preferred embodiment of the present invention, A: Gene structure analysis of GHERF114; B: Secondary structure and tertiary structure analysis of GHERF114; C: Protein sequence comparison of GHERF114 homologs in different species; D: Evolutionary tree analysis of the gene GHERF114;

[0017] Figure 3The phenotype of albino cotton plants after TRV:GHERF114 silencing cotton plants (A) and the silencing efficiency of TRV:GHERF114 in upland cotton (B) provided in a preferred embodiment of the present invention;

[0018] Figure 4 The phenotypic changes of WT, TRV:00 and GHERF114 gene silenced plants before and after salt stress treatment (350 mM NaCl) (A) and drought stress treatment (15% PEG6000) (B) provided in the examples of the present invention;

[0019] Figure 5 The DAB staining of leaves and the detection of physiological and biochemical indicators of TRV:GHERF114 silenced cotton plants before and after salt stress and drought stress treatment provided in the embodiments of the present invention. A: Schematic diagram of DAB staining results of cotton leaves before and after salt stress and drought stress treatment of VIGS injected plants; B: Determination of chlorophyll content; C: Determination of water loss rate of detached leaves; D: Determination of relative water content of leaves;

[0020] Figure 6 The invention provides the acquisition of the homozygous Arabidopsis thaliana overexpressing the gene GHERF114 and the detection of the expression level of the GHERF114 gene in the T2 generation Arabidopsis, A: the positive screening process of Arabidopsis thaliana overexpressing the GHERF114 gene; B: the transformation results of the T1 generation transgenic Arabidopsis thaliana detected by PCR, M is Marker 5000, OE-1, OE-3, OE-5, OE-7, OE-8, OE-9, OE-10, OE-11 are the transformation lines; C: the expression level of GHERF114 in the T2 generation transgenic Arabidopsis thaliana was analyzed by qRT-PCR;

[0021] Figure 7 The phenotypic changes of the GHERF114 transgenic line and the wild type before and after the drought stress treatment provided in the examples of the present invention (A) and the size and morphology comparison of the rosette leaves in response to the drought stress (B);

[0022] Figure 8 The present invention provides a method for determining the phenotypic changes of the GHERF114 transgenic line and the wild type before and after the salt stress treatment, the size and morphology comparison of the rosette leaves in response to the salt stress, and the determination of physiological and biochemical indicators. A: phenotypic changes before and after the salt stress treatment; B: comparison of the size and morphology of the rosette leaves in response to the salt stress; C: determination of the chlorophyll content; D: determination of the relative water content of the leaves. DETAILED DESCRIPTION

[0023] The specific implementation of the present invention is further described in detail below in conjunction with the drawings and examples.

[0024] Example 1 Extraction of RNA from Upland Cotton Tissues, Reverse Transcription of cDNA and qRT-PCR Analysis of GHERF114 Gene

[0025] In this embodiment, the description of the corresponding genes is as follows:

[0026] Total RNA was extracted from roots, leaves, stems and petals of upland cotton (TM-1) (from the wild cotton germplasm resource bank of the Cotton Research Institute of the Chinese Academy of Agricultural Sciences); in addition, another batch of TM-1 cotton seedlings were sown and subjected to salt stress (350 mM NaCl) when they grew to the three true leaves stage. Cotton true leaves were taken at 0, 1, 3, 6, 12 and 24 h, and RNA from leaf tissues at different treatment periods was extracted. The extracted RNA was reverse transcribed into cDNA using a reverse transcription kit (TAKARA). SYBR dye method was used to perform qRT-PCR analysis on the ABI7500fast platform with cotton Ghactin (F: ATCCTCCGTCTTGACCTTG; R: TGTCCGTCAGGCAACTCAT) as the internal reference gene and specific primers for the target gene GHERF114 (F: CGCTTATGAAGAAACCGGCG; R:ACTGATGTTTGGGTAGCGGG). Using 2 -ΔΔCt The algorithm calculated the relative expression of the target gene, and each cDNA sample was biologically replicated at least three times.

[0027] Using cDNA as a template, PCR amplification was performed with specific primers YA_GHERF114-F: TAGAGGATCCCCGGGGGTACCATGTGCCTAATTGACAAGGT and YA_GHERF114-R: GCCCTTGCTCACCATGGTACCTGAACCAGTGGATGAAG as primers, and the PCR product was gel-recovered and purified to obtain the target fragment; the pBI121-eGFP plasmid was digested with restriction endonuclease KpnI, and the digestion product was then gel-recovered and purified, and combined with the target fragment to generate pBI121-eGFP-GHERF114, which was transformed into Escherichia coli and sequenced. The correctly sequenced pBI121-eGFP-GHERF114 plasmid was transformed into Agrobacterium GV3101, and the successfully transformed bacterial solution was further amplified by PCR using specific primers YA_GHERF114-F and YA_GHERF114-R. A single colony with the same size as YA_GHERF114 was selected for shaking, and the Agrobacterium was stored at -80 °C for later use. After the obtained pBI121-eGFP-GHERF114 fusion expression strain was activated, it was cultured at 28 °C and 220 rpm until OD 600When the OD reached 0.9-1.0, the cells were centrifuged at 6000 rpm and then resuspended in MS liquid medium containing 1 M MgCl2, 1 M MES and 200 µM AS to a value of OD 600 The resuspended bacterial solution was injected into the back of 4-6 week-old tobacco leaves, and after 2-3 days, the location of green fluorescence expression was observed under the green light band using a laser confocal microscope.

[0028] The gene expression levels of GHERF114 gene in different tissues of cotton under normal growth conditions are as follows Figure 1 As shown in Figure A: The expression level of this gene is highest in the root of upland cotton, followed by the stem, and lowest in the leaves and petals, and the difference between the two is not significant. This indicates that this gene is mainly expressed in the root and stem. The expression level of GHERF114 gene in cotton seedlings under salt stress (350 mM NaCl) is shown in Figure Figure 1 As shown in B: The gene began to be up-regulated after 3 h of salt stress treatment. As the salt stress treatment time prolonged, the expression level decreased at 6 h of salt stress treatment, but increased again at 12 h and 24 h of treatment, and reached the highest expression level at 12 h. Fluorescence quantitative results showed that the overall expression level of the GHERF114 gene was up-regulated under salt stress treatment, further indicating that the gene is a gene expressed in response to salt stress.

[0029] In order to further determine the expression location of GHERF114 in different organelles, the subcellular localization experiment of GHERF114 in tobacco was conducted. The GFP fusion expression vector pBI121-eGFP-GHERF114 of GHERF114 and the positive control pBI121-eGFP-Flag were transformed into tobacco leaves for transient expression. Figure 1 As shown in C: Green fluorescence was observed in the cell nucleus and cell membrane of the positive control, and green fluorescence was observed in the cell nucleus of pBI121-eGFP-GHERF114, so we inferred that GHERF114 was localized in the cell nucleus.

[0030] Sequence 1:

[0031]

[0032] Example 2 Bioinformatics Analysis of Gene GHERF114 (GH_A05G2445) in Upland Cotton

[0033] The protein sequence of GhERF114 and its homologous sequence were downloaded from the CottonFGD (https: / / cottonfgd.net / ) and Phytozome (https: / / phytozome-next.jgi.doe.gov / ) databases. The upstream promoter region of the GhERF114 gene was analyzed and predicted using the PlantCARE online tool (https: / / bioinformatics.psb.ugent.be / webtools / plantcare / html / ), and its conserved domain was predicted using the MEME online tool (http: / / meme-suite.org / meme / ). Finally, the analysis results were visualized using TBtools software. The physiological and biochemical properties and secondary structure of GhERF114 were analyzed using ProtParam (http: / / web.expasy.org / protparam / ) and SOPMA (https: / / npsa-prabi.ibcp.fr / cgi-bin / secpred_sopma.pl), respectively. SignalP 5.0 server (http: / / www.cbs.dtu.dk / services / SignalP / ) was used to predict signal peptides. TMHMM (http: / / www.cbs.dtu.dk / services / TMHMM / ) was used to analyze the transmembrane structure of GhERF114. SWISS-MODEL (http: / / swissmodel.expasy.org / ) was used to predict the tertiary structure of the protein. The Blastp tool was used to search for similar sequences in other species, and multiple sequence alignment was performed by Jalview. Finally, the phylogenetic tree was drawn using MEGA 7 software.

[0034] like Figure 2As shown in A: GHERF114 is located on chromosome A05, within the range of 24877493-24879208 bases, with 2 exons. The prediction of the GHERF114 promoter sequence shows that in addition to the light response elements necessary for growth (GT1-motif, 3-AF1 binding site, chs-CMA1a, MRE, TCT-motif, Box 4, GA-motif and G-Box), it also contains a large number of hormone response elements, such as methyl jasmonate response elements (CGTCA-motif and TGACG-motif), gibberellin response elements (TATC-box and P-box) and abscisic acid response elements (ABRE). In addition, it also contains stress response elements (ARE and DRE), endosperm expression (GCN4_motif) and meristem expression response elements (CAT-box).

[0035] like Figure 2 As shown in B: The physicochemical analysis of the protein revealed some important properties of GHERF114. The theoretical relative molecular mass of the protein is 44.725 kDa, it contains 414 amino acids, and the theoretical isoelectric point is 6.42. In terms of charge distribution, GHERF114 contains 36 negatively charged residues and 33 positively charged residues, and its molecular formula is C1940H2956N572O628S12. In addition, the instability coefficient of GHERF114 is as high as 59.66, indicating that its stability is poor; the average hydrophilicity value is -0.578, indicating that it is a hydrophilic protein. Signal peptide prediction shows that GHERF114 does not contain a signal peptide and is a non-secretory protein. Transmembrane structure analysis speculates that GHERF114 has no transmembrane structure. The secondary structure prediction of GHERF114 shows that random coil and α-helix account for the largest proportion, accounting for 63.53% and 26.09% respectively, followed by 6.76% of extended chain and 3.72% of β-turn. The 3D structure of GHERF114 was predicted by SWISS-MORE homology modeling, and its main structure is also α-helix and random coil, which is consistent with the predicted secondary structure.

[0036] Multiple sequence alignment and analysis of ERF114 protein sequences in G. hirsutum, G. asparagineum, G. barbata, G. raimondii, millet, rice, maize and Arabidopsis were performed. Figure 2 As shown in C: ERF114 has highly conserved regions in these species. Similarity analysis found that GHERF114 has high similarity with these species, indicating that the ERF114 gene is highly conserved among different species. According to the phylogenetic tree, Figure 2As shown in D: GHERF114 is closely related to dicots and distantly related to monocots. The above two results indicate that ERF114 is relatively conservative in structure, but there are differences between monocots and dicots.

[0037] Example 3 VIGS experiments to verify the role of GHERF114 in cotton response to salt stress and drought stress

[0038] 3.1 Construction of plant VIGS vector TRV:GHERF114

[0039] A specific 264 bp fragment was selected from the CDS sequence of GHERF114, and gene cloning primers were designed based on the specific fragment (F: AGGTTACCGAATTCTCTAGACGCTTATGAAGAAACCGGCG; R: AGACGCGTGAGCTCGGTACCACTGATGTTTGGGTAGCGGG). The specific target fragment of gene GHERF114 was obtained by PCR amplification using upland cotton cDNA as a template. The TRV:00 plasmid was digested with restriction endonucleases XbaI and KpnI, and then the digestion product was purified by gel recovery and combined with the target fragment to generate TRV:GHERF114, which was transformed into Escherichia coli and sequenced. The TRV:GHERF114 plasmid with correct sequencing was transformed into Agrobacterium GV3101, and the successfully transformed bacterial solution was further PCR amplified using specific primers. The single colony with the same size of 264 bp was selected for shaking, and the Agrobacterium was stored at -80 ℃ for later use. The leaves of TM-1 hydroponic seedlings grown to the cotyledon expansion stage were injected with Agrobacterium solution, with TRV:00 Agrobacterium as negative control and TRV:PDS Agrobacterium as positive control.

[0040] First, prepare the bacterial solution for injection of the target gene (TRV: GHERF114), the albino gene (PDS), and the empty vector (TRV: 00) to an OD of 600 Keep it at about 1.5. The PDS-injected upland cotton seedlings will show albino phenotype after about 15 days of growth. Figure 3As shown in A, the albino phenotype still exists after 30 days, indicating that the gene silencing is successful and that the silencing effect is relatively stable. When the albino phenotype is relatively stable, the true leaves of cotton from TRV:GHERF114, WT and TRV:00 were selected for RNA extraction and reverse transcription into cDNA for RT-qPCR detection. The expression of GHERF114 in TRV:GHERF114 and TRV:00 was detected by RT-qPCR. The results showed that the expression of GHERF114 in the four plants TRV:GH ERF114-1, TRV:GH ERF114-2, TRV:GH ERF114-3 and TRV:ERF114-4 was lower than 0.4, and lower than TRV:00. The difference between the two was significant, further indicating that the GHERF114 gene was successfully silenced ( Figure 3 After the plants grew three true leaves, they were transferred to 1 / 2 Gran nutrient solution containing 350 mM NaCl and 15% PEG6000 for salt stress and drought stress treatments. The true leaves were collected at 0 h and 48 h, quickly frozen in liquid nitrogen, and stored at -80 °C for subsequent experiments.

[0041] 3.2 Phenotypic identification of GHERF114 gene-silenced cotton in response to drought and salt stress

[0042] Before drought and salt stress treatments, the growth of WT, TRV:00, and TRV:GHERF114 seedlings was the same. After 48 h of treatment with 350 mM NaCl and 15% PEG6000, the growth of WT, TRV:00, and TRV:GHERF114 seedlings was the same. Figure 4 As shown in A and B: The true leaves of WT and TRV:00 seedlings wilted severely and the leaves had already fallen off, while the TRV:GHERF114 phenotype had no significant difference compared with before stress treatment, and the true leaves of cotton only showed slight wilting, indicating that after GHERF114 was silenced in upland cotton, the ability of cotton plants to respond to drought stress and salt stress increased.

[0043] 3.3 DAB staining of GHERF114 gene-silenced plants, WT and TRV:00 before and after drought and salt stress treatments, and determination of changes in physiological and biochemical indicators

[0044] Leaves of WT, TRV:00 and TRV:GHERF114 cotton plants were collected after 0 h and 48 h of salt and drought treatment, and the DAB staining test was used to verify the damage of leaves after salt and drought treatment. Figure 5As shown in A, DAB staining showed that under normal conditions, the amount of ROS accumulation in the leaves of WT, TRV:00 and TRV: GHERF114 cotton was very small, and the brown appearance of the leaves was not obvious. After salt stress and drought stress treatment, obvious black areas appeared on the leaves of WT and TRV:00 plants, and the brown color was obvious. The brown color of the salt stress treatment group was the most obvious;

[0045] The leaves of TRV:GHERF114 cotton plants were not obviously brown in either the salt stress group or the drought stress group. The above results indicate that under the same 350 mM NaCl salt stress and 15% PEG6000 stress conditions, the damage degree of TRV:GHERF114 plants was lower ( Figure 5 Middle A), further indicating that the drought and salt resistance of cotton plants increased after GHERF114 gene silencing.

[0046] The chlorophyll content (SPAD) of cotton leaves of WT, TRV:00 and TRV:GHERF114 was measured at 0 h and 48 h after drought and salt stress treatment. Figure 5 As shown in B, the relative content of chlorophyll in cotton leaves was determined by SPAD instrument. The measurement data showed that at 0 h of drought treatment and salt stress treatment, the chlorophyll content values ​​of WT, TRV:00 and TRV: GHERF114 fluctuated around 39, basically consistent and with no significant difference; but after 48 h of salt stress treatment, the chlorophyll content of TRV: GHERF114 plants fluctuated around 29, while the chlorophyll content of WT and TRV:00 plants fluctuated around 25, which was more reduced than the chlorophyll content of TRV: GHERF114 plants, and the difference was significant; similarly, after 48 h of drought stress treatment, the chlorophyll content of TRV: GHERF114 plants fluctuated around 35, while the chlorophyll content of WT and TRV:00 plants fluctuated around 25, and the chlorophyll content also decreased more than TRV: ERF114, with a significant difference. The above results indicate that the growth of silenced plants is better than that of WT and TRV:00 plants under drought stress and salt stress conditions ( Figure 5 ). From the results, we can see that after GHERF114 silencing, the drought and salt stress resistance of the plants increased.

[0047] The results of the determination of detached leaf water loss rate (ELWL) and leaf relative water content (RLWC) are shown in Figure 5As shown in Figures C and D. The results showed that under normal conditions, the relative water content of leaves and the water loss rate of detached leaves between WT, TRV:00 and TRV: GHERF114 did not change significantly, but after drought and salt stress treatment, the measured values ​​of WT, TRV:00 and TRV: GHERF114 were lower than those under normal conditions, while WT and TRV:00 were significantly lower than TRV: GHERF114. The above results all indicate that silencing the GHERF114 gene will further reduce the degree of cell membrane damage and enhance the drought resistance and salt tolerance of Upland Cotton (TM-1).

[0048] Example 4 Verification of the role of the GHERF114 gene in response to salt stress and drought stress in Arabidopsis using a plant overexpression vector

[0049] 4.1 Construction of plant overexpression vector pCMBIA2300-35S:GHERF114

[0050] Gene cloning primers (GHERF114-F: ATTTGGAGAGGACAGGGTACC ATGTGCCTAATTGACAAGGT; GHERF114-R: CTAGGTTAACCATGTGGTACCCTATGAACCAGTGGATGAAG) were designed according to the CDS coding region sequence of the GHERF114 gene. The target fragment of the gene GHERF114 was obtained by PCR amplification using the cDNA of upland cotton (TM-1) as a template, and the plant overexpression vector pCMBIA2300 was digested with restriction endonuclease KpnI, and the purified products of the target gene fragment and the vector fragment were obtained by gel recovery. Use ligase to connect the two, transform the ligation product into Escherichia coli DH5α competent cells, obtain the recombinant vector pCMBIA2300-35S: GHERF114 containing the 35S promoter, send it to the company for sequencing, and after the sequencing results are correct, extract the plasmid containing the correct target gene and transform it into Agrobacterium GV3101 competent cells; after Agrobacterium grows a single colony, use specific primers GHERF114-F and GHERF114-R to perform colony PCR on the single colony to obtain a single colony with the same size of PCR product and target gene. Shake the single colony and store the bacteria at -80℃ for later use. At this point, the plant overexpression recombinant vector pCMBIA2300-35S: GHERF114 was successfully constructed.

[0051] 4.2 Transformation of Arabidopsis and Screening of Transgenic Arabidopsis

[0052] Wild-type Arabidopsis (Col-0) seeds were sterilized with 0.1% mercuric chloride for 5 min, then washed with sterilized ultrapure water for 5 times, 3 min each time, and finally planted on 1 / 2MS solid culture medium, which was placed in a 4 ℃ refrigerator for 2 days to break seed dormancy. After 2 days, the culture medium was placed in an Arabidopsis greenhouse (temperature was 22 ℃, 16 h light / 8 h dark). When it grew to the size of 4 leaves, the seedlings were transferred to nutrient pots filled with nutrient soil for growth. Wild-type Arabidopsis was infected by the flower dipping method. The heavy suspension used for infection contained MS 2.15 g / L, AS 200 mmol / mL, Silweet 77 200 μL / L and sucrose 50 g / L, pH 5.7-5.8. To improve the transformation efficiency, Arabidopsis was infected again one week later. The seeds harvested after maturity are the T0 generation. Figure 6 As shown in A: T0 generation seeds were planted in a medium containing 100 mg / mL Kan + The positive seedlings were transplanted to the greenhouse in nutrient soil when they grew to 4-5 leaves, and the T1 generation seeds were harvested. At the same time, wild-type Arabidopsis seeds were sown in a medium containing 100 mg / mL Kan + 1 / 2MS solid medium was used as a control, and the results showed that wild-type Arabidopsis could not survive ( Figure 6 Middle A).

[0053] T1 generation seeds were sown in + The germination screening was continued on the culture medium, and the ratio of the survival rate to the mortality rate of the seedlings in the culture medium was calculated (about 3:1) to further identify the transgenic GHERF114 single-copy strains. The positive seedlings that met the ratio were retained and transplanted into nutrient soil, and the seeds of the identified positive strains were harvested as T2 seeds ( Figure 6 At the same time, Figure 6 As shown in B, the leaves of T1 generation Arabidopsis were collected, DNA was extracted, and the gene GHERF114 was amplified. The expression of the target gene GHERF114 was screened, and strains containing the target gene (OE-1, OE-3, OE-5, OE-7, OE-8, OE-9, OE-10 and OE-11) were obtained. The T2 generation seeds were planted again in a medium containing 100 mg / mL Kan + The Arabidopsis thaliana was germinated on solid selective medium, and the surviving Arabidopsis was selected for transplanting and seed collection. At the same time, T2 leaves were taken for RNA extraction, reverse transcription and qRT-PCR analysis to detect the quality and expression of positive strains, such as Figure 6As shown in C, the GHERF114 expression levels of the two transgenic lines, OE-8 and OE-11, were relatively high, and they were determined to be homozygous lines of Arabidopsis thaliana with high expression of the GHERF114 gene. After the T2 generation grew to maturity, the T3 generation seeds were harvested for the next experiment.

[0054] 4.3 Tolerance responses of Arabidopsis thaliana overexpressing the GHERF114 gene and wild-type WT to drought and salt stress

[0055] The wild-type (WT) and transgenic lines (OE-8 and OE-11) Arabidopsis sown on the culture medium were placed in the Arabidopsis greenhouse for 10 days (the Arabidopsis seedlings grew to 4-6 leaves), and then transferred to the nutrient soil containing vermiculite for soil culture. After one week of soil culture, they were subjected to drought stress of 15% PEG6000 and salt stress of 200 mM NaCl. After 8 days of drought stress and 12 days of salt stress, the phenotypes of Arabidopsis overexpressing the gene GHERF114, the wild-type (WT), and the size and morphology of the rosette leaves in response to salt stress, as well as the degree of wilting were observed and counted. In addition, the chlorophyll content, detached leaf water loss rate (ELWL) and leaf relative water content (RLWC) of the leaves in the salt stress treatment group were also measured.

[0056] like Figure 7 As shown in Figures A and B: Before drought stress treatment, the phenotypes and growth conditions of wild-type (WT) and overexpressing GHERF114 Arabidopsis were good and there was no significant difference; after drought stress treatment, Arabidopsis plants suffered varying degrees of damage. Compared with the wild-type (WT), the transgenic lines (OE-8 and OE-11) Arabidopsis strains suffered the most damage, with leaves completely dried up and almost dead; while the leaves of the wild-type (WT) Arabidopsis partially dried up, the Arabidopsis still had great vitality. Similarly, Figure 8 As shown in Figure A: Before salt stress treatment, the phenotype and growth conditions of wild-type (WT) and transgenic lines (OE-8 and OE-11) Arabidopsis were good and there was no significant difference; after salt stress treatment, Arabidopsis plants suffered varying degrees of damage. Compared with transgenic lines (OE-8 and OE-11) Arabidopsis, the leaves of wild-type (WT) only partially dried up, but Arabidopsis still had great vitality, while transgenic lines (OE-8 and OE-11) Arabidopsis grew slowly, the leaves dried up severely, and the leaves were severely damaged.

[0057] 4.4 Determination of chlorophyll content, water loss rate of detached leaves and relative water content of leaves

[0058] After 12 days of salt stress treatment, the chlorophyll content of rosette leaves of wild-type (WT) and transgenic lines (OE-8 and OE-11) Arabidopsis thaliana in the control group and the treatment group was measured using a SPAD instrument; the measured chlorophyll content was as follows Figure 8 As shown in B. Under non-salt stress, there was no difference in leaf chlorophyll content between wild-type (WT) and transgenic lines (OE-8 and OE-11) Arabidopsis; after salt stress, the chlorophyll content of transgenic lines (OE-8 and OE-11) was lower than that of WT. The relevant results further indicate that under salt stress, the growth condition of wild-type Arabidopsis is better than that of transgenic lines.

[0059] Arabidopsis leaves were collected for the determination of physiological traits, including detached leaf water loss (ELWL) and relative leaf water content (RLWC). All experiments were repeated at least four times. Figure 8 As shown in Figures C and D. The results showed that under normal conditions, there was no significant difference in the physiological indexes of the wild type (WT) and transgenic lines (OE-8 and OE-11), but when salt stress was applied to the strains overexpressing the gene GHERF114, the values ​​of the GHERF114 transgenic lines were significantly lower than those of the wild type and showed a negative regulatory effect.

[0060] After salt stress treatment, the water loss rate of detached leaves of GHERF114 transgenic lines was significantly lower than that of wild type (WT), indicating that overexpression of GHERF114 gene reduced the water holding capacity of plants ( Figure 8 Middle D). After salt stress treatment, the relative water content of leaves of GHERF114 transgenic line was significantly lower than that of wild type (WT) ( Figure 8 (C) The above results indicate that the drought and salt tolerance of GHERF114 transgenic lines are significantly reduced compared with the wild type (WT).

[0061] The present invention obtains GHERF114 gene silenced cotton strains through VIGS experiments, and compares the tolerance of wild-type cotton (WT), empty plants (TRV:00) and gene silenced strains (TRV: GHERF114) to drought stress and salt stress. The results show that the gene silenced strains (TRV: The phenotype and physiological and biochemical indicators of the transgenic lines of GHERF114 (OE-8 and OE-11) are better than those of the wild type and the empty plants; in addition, the present invention obtains the pure Arabidopsis lines of the transgenic lines overexpressing GHERF114 by transgenic technology, and by comparing the tolerance of the wild type (WT) and the transgenic lines (OE-8 and OE-11) to drought stress and salt stress, the results show that in the Arabidopsis seedling stage, the Arabidopsis overexpressing GHERF114 has weaker activity and tolerance than the wild type in response to drought stress and salt stress treatment; after drought stress and salt stress treatment, the Arabidopsis is less damaged and the leaf cells are less damaged, while after the transgenic lines overexpressing GHERF114 are subjected to drought stress and salt stress treatment, the Arabidopsis rosette leaves wither in a large area, the cells are wrinkled in a large area, and the Arabidopsis seedlings are almost all dead. Therefore, compared with the wild type, drought stress and salt stress have a greater impact on the transgenic lines.

[0062] In addition, after salt stress treatment, the water loss rate and relative water content of the detached leaves of the GHERF114 transgenic line were significantly lower than those of the wild type (WT), indicating that the water holding capacity of the plant decreased after overexpression of the GHERF114 gene. From the results, we can see that the salt resistance of the GHERF114 transgenic line is significantly reduced compared with the wild type, indicating that this gene plays a significant inhibitory role in plant salt stress tolerance.

[0063] The above embodiments are only preferred embodiments of the present invention, and are not intended to limit the present invention in other forms. Any person skilled in the art can use the above disclosed technical contents to change or modify them into equivalent embodiments with equivalent changes. However, any modification, equivalent change and modification made to the above embodiments according to the technical essence of the present invention without departing from the technical solution of the present invention still falls within the protection scope of the technical solution of the present invention.

Claims

1. Application of the GHERF114 gene in regulating plant salt stress tolerance and drought stress tolerance, characterized in that: The expression of the GHERF114 gene in the target plant is regulated by overexpressing or silencing the GHERF114 gene. The nucleotide sequence of the GHERF114 gene is shown in Sequence 1 in the sequence table. The plant is cotton or Arabidopsis thaliana.

2. The use according to claim 1, characterized in that: The application is to use a plant overexpression vector to overexpress the cotton gene GHERF114 in Arabidopsis or cotton, thereby reducing the salt and drought stress tolerance of the plant.

3. The use according to claim 1, characterized in that: The application is to use the virus-induced gene silencing technology VIGS to silence the specific sequence fragment of the cotton gene GHERF114, and transform it into cotton through Agrobacterium-mediated transformation to improve the plant's tolerance to salt and drought stress.

4. A plant breeding method, characterized in that: The expression of the GHERF114 gene in the target plant is regulated by overexpressing or silencing the GHERF114 gene. The nucleotide sequence of the GHERF114 gene is shown in Sequence 1 in the sequence table. The target plant is cotton or Arabidopsis thaliana.

5. A method for reducing salt and drought stress tolerance of plants, characterized in that: The upland cotton GHERF114 gene is introduced into the plant using a plant overexpression vector to obtain a transgenic plant that is more sensitive to salt and drought. The nucleotide sequence of the GHERF114 gene is shown in sequence 1 in the sequence table, and the plant is cotton or Arabidopsis thaliana.

Images