A molecular marker primer for PPP3R1 gene related to comb size trait and its application

Abstract

The present invention relates to a PPP3R1 gene molecular marker primer related to the comb size trait and an application thereof, and belongs to the field of biotechnology. The PPP3R1 gene molecular marker of the present invention is located at the 11347456th base of chromosome 3 of the chicken reference genome GRCg7b version, the base mutation is T or G, and the genotype is G / G, T / G and T / T. The comb of a G / G genotype chicken is larger than that of individuals with T / G and T / T genotypes, and the comb of a T / G genotype chicken is larger than that of an individual with T / T genotype. The present invention utilizes forward and reverse primer pairs to amplify a fragment containing the above-mentioned molecular marker site, and performs Sanger sequencing on the amplified product, so as to quickly and accurately identify the genotype of an individual; the molecular marker can be used as a genetic marker for chicken breeding, and chickens with appropriate comb sizes can be selected; the comb size of a chicken can be efficiently and accurately detected, and the uniformity of the comb of a group can be improved, which is of great value for chicken breeding and production.

Description

Technical Field

[0001] The invention relates to a PPP3R1 gene molecular marker primer related to the comb size trait and application thereof, belonging to the field of biotechnology. Background Art

[0002] Compared with fast-growing large white-feathered broilers, high-quality broilers have the disadvantages of long feeding cycle, slow growth rate, late sexual maturity, and high production cost. Therefore, it is urgent to breed early-maturing high-quality chickens. The sexual maturity traits of chickens include comb size, age at first laying, and weight at first laying, which are closely related to the production performance and meat quality of chickens. Early sexual maturity is an important economic trait and selection index unique to high-quality yellow-feathered broilers. The degree of sexual maturity determines the grade and price of the product. Having a sexually mature appearance (large comb, red face, bright hair color, and a certain amount of subcutaneous fat, etc.) is the basic condition for high-quality broilers to be listed. Studies on high-quality broilers have found that the comb size trait is closely related to the overall growth and development of chickens, production efficiency, and early maturity. A red and large comb is one of the typical characteristics of early-maturing high-quality chickens. Therefore, comb size is an important appearance quality trait and breeding focus trait of high-quality yellow-feathered broilers, and it is also a technical difficulty in breeding. At present, there is a lack of efficient, accurate and convenient selection methods.

[0003] The PPP3R1 gene is a protein-coding gene, and the pathway annotations associated with this gene include calcium ion binding and calmodulin binding pathways. The comb size of roosters is positively correlated with the area and density of the medullary cavity of the bone metaphysis and the cortical content of the bone shaft, indicating that roosters with larger combs have higher overall bone density and strength. Hens with larger combs can deposit more calcium in their bones, and the PPP3R1 gene is affected by calcium ion concentration. Single nucleotide polymorphism (SNP) refers to the variation of a single nucleotide in the genome, which can be stably inherited to offspring during the transmission of genetic material, so it can be used as a molecular marker for population selection and seed conservation. Marker-Assisted Selection (MAS) is a genetic improvement technology that enhances traditional selection methods through molecular markers or genetic markers. Based on the relationship between candidate genes or molecular markers and traits of interest, MAS can help breeders accurately select individuals with desired traits before the traits are expressed, thereby achieving early selection, improving selection efficiency, reducing feeding costs, and improving selection accuracy. Summary of the invention

[0004] The purpose of the present invention is to address the defects of the prior art, propose a PPP3R1 gene molecular marker primer related to the comb size trait and its application, and quickly detect and screen the genotype related to the comb size trait.

[0005] The present invention measures the comb size phenotypic traits of hens, uses second-generation sequencing technology to perform whole-genome SNP genotyping, and screens the PPP3R1 gene molecular marker that is significantly correlated with the comb size trait through whole-genome association analysis, providing new gene and molecular marker resources for comb size trait selection and breeding.

[0006] The present invention solves the technical problem through the following technical scheme: firstly, a PPP3R1 gene molecular marker primer related to the comb size trait is provided, the nucleotide sequence of the molecular marker primer is shown in SEQ ID NO:1 and SEQ ID NO:2, the molecular marker is located at the 11347456th base on chromosome 3 of the chicken reference genome GRCg7b version, and the base is mutated to T or G. The sequence is shown in the 324th base as shown in SEQ ID NO:3 or SEQ ID NO:4.

[0007] The present invention further provides an application of the above molecular marker primers for detecting SNP genotypes related to comb size. The detection method comprises the following steps:

[0008] The first step is to provide a chicken DNA sample to be tested, and perform PCR amplification using a molecular marker primer pair to obtain an amplification product, wherein the amplification product is 573 bp in length and contains the 11347456th base of chicken chromosome 3;

[0009] Step 2: Sanger sequencing of the PCR product;

[0010] Step 3: Determine the genotype of the SNP molecular marker at base 11347456 of chicken chromosome 3 based on the sequencing results of step 2.

[0011] Wherein, the deoxyribonucleotide sequence of the molecular marker primer pair described in the first step is:

[0012] Upstream primer: 5'-AATCAGTGCCAGTGGAGGTG-3' (SEQ ID NO: 1)

[0013] Downstream primer: 5'-AGCTGAACCTTTACGCCTGT-3' (SEQ ID NO: 2)

[0014] The final concentration of the reaction system is 25 μl.

[0015] Chicken DNA to be tested 50 ng,

[0016] 2 x Accurate Taq Master Mix 12.5 μl,

[0017] Upstream primer 1 μl,

[0018] Downstream primer 1 μl,

[0019] Add sterile water to 25 μl.

[0020] The reaction conditions of the PCR amplification are: pre-denaturation at 94°C for 5 minutes; denaturation at 94°C for 30 seconds, annealing at 55°C for 30 seconds, extension at 72°C for 60 seconds, for a total of 30 cycles; extension at 72°C for 2 minutes; storage at 4°C; the nucleotide sequence of the amplified product is shown in SEQ ID NO: 3 or SEQ ID NO: 4, the amplified product is 573 bp in length, and contains the 11347456th base of chicken chromosome 3.

[0021] In the third step, the judgment standard is that the comb of the G / G genotype chicken at the SNP site is larger than that of the T / G and T / T genotype individuals, and the comb of the T / G genotype chicken is larger than that of the T / T genotype individual.

[0022] The present invention detects the genotype of the comb size trait through the PPP3R1 gene molecular marker, and obtains that the comb of the G / G genotype individual is larger than that of the T / G genotype and T / T genotype individuals, and the comb of the T / G genotype individual is larger than that of the T / T genotype individual. The genomic DNA of the chicken to be tested is used as a template, and PCR amplification is performed using specific primers, and then the PCR amplification product is subjected to Sanger sequencing and SNP molecular marker genotyping, and the genotype based on the SNP molecular marker can be used to select the comb size trait. In breeding, according to the breeding goal, the T / G and T / T genotype individuals can be eliminated, and the G / G genotype individuals can be retained. The beneficial effect is that the molecular marker can be used as a genetic marker for chicken breeding, and high-quality chickens with large combs can be selected; the comb traits can be identified efficiently and quickly, and the uniformity of the combs of the chicken flock can be improved, providing a scientific basis for the early selection of chickens, which is of great value for chicken breeding. In addition, the detection method disclosed in the present invention is simple and easy to operate, and can be carried out in the laboratory. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 This is the Manhattan plot of the genome-wide association analysis of comb size traits.

[0024] Figure 2 These are the Sanger sequencing results of the PCR amplification products of the three genotypes. DETAILED DESCRIPTION

[0025] The following embodiments are applicable to chicken breeding, and the breeds of chickens cited are not limited to the following embodiments.

[0026] Example 1

[0027] In this example, the comb size scoring trait of recessive White Lock hens before laying was measured, and whole-genome SNP genotyping was performed using second-generation sequencing technology. The PPP3R1 gene molecular marker significantly associated with comb size was screened through whole-genome association analysis. The results are as follows: Figure 1 shown.

[0028] In this example, the molecular marker of the PPP3R1 gene related to the comb size was identified and applied through the following experiments.

[0029] 1. Phenotypic and genotypic testing

[0030] (1) Experimental materials and comb size phenotype determination

[0031] A total of 2348 recessive White Rock hens were selected as experimental animals and raised under the same feeding conditions. They had free access to feed and water throughout the entire process. At 24 weeks of age, the comb size was scored before laying. The comb score is divided into 4 levels, with comb area increasing from 1 to 4 points, which serves as the phenotypic data of comb size.

[0032] (2) Extraction of genomic DNA

[0033] Blood was collected from the subwing vein of the individual to be tested, lysed after anticoagulation, digested with proteinase K, extracted with saturated sodium chloride method, dissolved in TE and stored at -20℃.

[0034] (3) PCR amplification

[0035] Using the genomic DNA extracted as above as a template, a fragment containing the site at base position 11347456 on chromosome 3 was amplified.

[0036] Upstream primer: 5'-AATCAGTGCCAGTGGAGGTG-3' (SEQ ID NO: 1)

[0037] Downstream primer: 5'-AGCTGAACCTTTACGCCTGT-3' (SEQ ID NO: 2)

[0038] The final concentration of the reaction system is 25 μl.

[0039] DNA to be tested 50 ng,

[0040] 2 x Accurate Taq Master Mix 12.5 μl,

[0041] Upstream primer 1 μl,

[0042] Downstream primer 1 μl,

[0043] Add sterile water to 25 μl.

[0044] The reaction conditions of PCR amplification are: 94℃ pre-denaturation for 5min; 94℃ denaturation for 30sec, 55℃ annealing for 30sec, 72℃ extension for 60sec, 30 cycles in total; 72℃ extension for 2min; 4℃ storage; 10μl was taken for agarose detection, and a single target band with a length of 573bp was amplified, containing the SNP molecular marker at the 11347456th base site of chicken chromosome 3. The sequence of the amplified product is as follows:

[0045] SEQ ID NO:3

[0046] AATCAGTGCCAGTGGAGGTGACCCACTATCACTACTGCTGAAACACAACACCCACTGCTTCGCTGTGCTCACATCCACTGTTTGGTCTCAATAAGCATCCACCAAATATTGATGAATGTCAGTGGATGCCATGTTTTCCACAT GGAGAAATTCAACAATACCACTTTGCTTCATATGCTCTTCCACGTTGCATGGCAAACAGGTATATAGATTGTAAGGTAAATAAGTATAGGGCCAGAGAGATTATTGCGTTACAAAAGAGTAATGAAATAAAGAACTTACCTGT GTCCTGGGCTCGCAGAAGGGTCCCAAGGGGAGTGATCGCCAGAGAGATCCTTCCTCCTTGGGAGTCAGCCTCAGAGTGACCAGTCTTCCAGTCACTCAGGTGAAATTGCTTTCACCTGTGCCACTGCAGATGACTCAGCAC TCGCCTCAGGTGGTCAATCAGAGGTTCAGGCCGTGATTCAACAGTTCCCATACACGTCAAACACCATTCTGTCAGAGTGCCCCTCTGCTGCCATCTGCCAAGTAGCAACAAACATAACAGAATACAGGCGTAAAGGTTCAGCT

[0047] SEQ ID NO:4

[0048] AATCAGTGCCAGTGGAGGTGACCCACTATCACTACTGCTGAAACACAACACCCACTGCTTCGCTGTGCTCACATCCACTGTTTGGTCTCAATAAGCATCCACCAAATATTGATGAATGTCAGTGGATGCCATGTTTTCCACAT GGAGAAATTCAACAATACCACTTTGCTTCATATGCTCTTCCACGTTGCATGGCAAACAGGTATATAGATTGTAAGGTAAATAAGTATAGGGCCAGAGAGATTATTGCGTTACAAAAGAGTAATGAAATAAAGAACTTACCTGT GTCCTGGGCTCGCAGAAGGGTCCCAAGGGGAGTGATCTCCAGAGAGATCCTTCCTCCTTGGGAGTCAGCCTCAGAGTGACCAGTCTTCCAGTCACTCAGGTGAAATTGCTTTCACCTGTGCCACTGCAGATGACTCAGCAC TCGCCTCAGGTGGTCAATCAGAGGTTCAGGCCGTGATTCAACAGTTCCCATACACGTCAAACACCATTCTGTCAGAGTGCCCCTCTGCTGCCATCTGCCAAGTAGCAACAAACATAACAGAATACAGGCGTAAAGGTTCAGCT

[0049] (4) Sanger sequencing and genotyping

[0050] The PCR products of each sample were subjected to Sanger sequencing, and the sequencing peaks of different genotypes were obtained as shown in Figure 2 shown.

[0051] 2. Correlation Analysis

[0052] 2348 24-week-old hens with clear comb phenotype records were selected for correlation analysis. The ANOVA test function of R 4.2 statistical drawing software was used for statistical test, and the pairwise mean comparison mode was selected to perform statistical test on the genotype and comb size traits of the experimental chickens. P<0.05 indicated significant differences. The results are shown in Tables 1 and 2. Among the tested individuals, there were 1743 G / G genotypes, 551 T / G genotypes, and 54 T / T genotypes. The comb phenotype scores of the three genotypes were significantly different (P<0.05). The proportion of 4 points in the comb score of G / G genotype individuals was 70.11%, which was higher than 54.99% (P<0.05) of T / G genotype individuals and 31.48% (P<0.05) of T / T genotype individuals. The proportion of 4 points in the comb score of T / G genotype individuals was higher than that of T / T genotype individuals (P<0.05). The results showed that the chicken PPP3R1 gene molecular marker was significantly correlated with the comb size phenotype. According to the actual breeding goals, G / G genotype individuals can be selected to breed high-quality chickens with larger combs, improve the overall uniformity of comb size, and speed up breeding efficiency.

[0053] Table 1 The proportion of comb scores of different genotypes of PPP3R1 gene molecular markers

[0054]

[0055] Note: Data in the same column with the same letter or no letter indicate no significant difference, while data with different letters indicate significant difference (P<0.05).

[0056] Table 2 Association analysis between PPP3R1 gene molecular markers and comb size traits

[0057]

[0058] Note: Data in the same column with the same letters on their shoulders indicate no significant difference, while data with different letters on their shoulders indicate significant difference (P<0.05).

[0059] Example 2

[0060] Genotype frequencies of different varieties

[0061] Step 1: Blood sample collection

[0062] Blood samples from 15 breeds, including Beijing Oily Chicken, Big Bone Chicken, Daweishan Miniature Chicken, Wenchang Chicken, Wuding Chicken, Piao Chicken, Bearded Chicken, Tibetan Chicken, Camellia Chicken, Fujian Hetian Chicken, Liyang Chicken, Xinghua Chicken, Guangxi Sanhuang Chicken, Recessive White Rock Chicken and White Leghorn Laying Hen, were collected by subwing vein blood collection and stored at -20℃ for future use.

[0063] Step 2: Extract genomic DNA

[0064] Take the tissue sample obtained in step 1 and use Omega's tissue genomic DNA extraction kit to extract genomic DNA. The specific method refers to the standard operating procedure provided by Omega.

[0065] Step 3: Genotype detection

[0066] Using the genomic DNA obtained in step 2 as a template, a primer pair consisting of an F nucleotide sequence (SEQ ID NO: 1) and an R nucleotide sequence (SEQ ID NO: 2) was used for PCR amplification and Sanger sequencing to obtain the individual's G / G genotype, G / T genotype, and T / T genotype.

[0067] Step 4: Result Analysis

[0068] Beijing Oil Chicken, Big Bone Chicken, Daweishan Miniature Chicken, Wenchang Chicken, Wuding Chicken, Piao Chicken, Bearded Chicken, Tibetan Chicken, Camellia Chicken, Fujian Hetian Chicken, Liyang Chicken, Xinghua Chicken and Guangxi Sanhuang Chicken are well-known local chicken breeds in China. Recessive White Rock Chicken is a popular commercial broiler breed on the market. Among them, recessive White Rock Chicken is often used as a specialized strain in the yellow-feathered broiler matching system, and the comb has been selected for a long time. The frequency of the G allele in the recessive White Rock chicken population is higher than that of other local chicken breeds. In the early growth and development of chickens, the height of the comb is positively correlated with sexual maturity, and hens with larger comb heights lay eggs earlier. Therefore, after long-term selection and breeding of the comb of White Leghorn laying hens, the comb of the group is large and uniform, and the frequency of the G allele in the population is higher than that of other chicken breeds. These results can all confirm that this SNP site can be used as a molecular marker for comb size. See Table 3.

[0069] Table 3 Distribution of allele frequencies of PPP3R1 gene molecular markers in different varieties

[0070] variety G allele frequency T allele frequency Number of individuals Beijing Fried Chicken 45.00% 55.00% 20 Big bone chicken 42.86% 57.14% 7 Daweishan Miniature Chicken 71.05% 28.95% 19 Wenchang Chicken 68.57% 31.43% 20 Wuding Chicken 33.33% 66.67% 15 Chicken 37.50% 62.50% 16 Bearded Chicken 38.89% 61.11% 9 Tibetan Chicken 40.00% 60.00% 10 Camellia Chicken 63.16% 36.84% 13 Fujian River Chicken 85.00% 15.00% 10 Liyang Chicken 62.50% 37.50% 22 Apricot Chicken 25.00% 75.00% 10 Guangxi Three Yellow Chicken 40.00% 60.00% 8 Recessive White Rock Chicken 71.53% 28.47% 35 White Leghorn Layers 90.00% 10.00% 20

[0071] In addition to the above implementations, the present invention may also have other implementations. Any technical solution formed by equivalent replacement or equivalent transformation falls within the protection scope required by the present invention.

Claims

1. An application of a detection primer for a SNP site of the PPP3R1 gene associated with the comb size trait, characterized in that: Used to detect the genotype of a SNP site related to comb size, the nucleotide sequence of the detection primer is shown in SEQ ID NO: 1 and SEQ ID NO: 2, the SNP site is located at the 11347456th base on chromosome 3 of the chicken reference genome GRCg7b version, the base mutation is T or G, the comb of a chicken with a G / G genotype at the SNP site is larger than that of an individual with T / G and T / T genotypes, and the comb of a chicken with a T / G genotype is larger than that of an individual with a T / T genotype.

2. The use of the detection primers for the SNP site of the PPP3R1 gene related to the comb size trait according to claim 1, characterized in that: The detection method comprises the following steps, The first step is to provide a chicken DNA sample to be tested, and perform PCR amplification with the detection primers to obtain an amplified product, wherein the amplified product is 573 bp in length and contains the 11347456th base of chromosome 3 of the chicken reference genome GRCg7b version; The second step is to perform Sanger sequencing on the PCR product; The third step is to determine the genotype of the SNP site at base 11347456 on chromosome 3 of the chicken reference genome GRCg7b version based on the sequencing results of the second step.

3. The use of the detection primers for the SNP site of the PPP3R1 gene related to the comb size trait according to claim 2, characterized in that: The final volume of the reaction system was 25 μl. Chicken DNA to be tested 50 ng 2 x Accurate Taq Master Mix 12.5 μl Upstream primer 1 μl Downstream primer 1 μl Add sterile water to 25 μl; The reaction conditions of the PCR amplification are: 94°C pre-denaturation for 5 min; 94°C denaturation for 30 sec, 55°C annealing for 30 sec, 72°C extension for 60 sec, a total of 30 cycles; 72°C extension for 2 min; 4°C storage; the nucleotide sequence of the amplified product is shown in SEQ ID NO: 3 or SEQ ID NO: 4.

Images