Application of haplotype molecular marker of TaACO3 gene in assisted breeding of wheat resistance to stripe rust

Abstract

This invention provides an application of a haplotype molecular marker of the TaACO3 gene in assisting wheat stripe rust resistance breeding, belonging to the field of crop molecular breeding technology. The nucleotide sequence of the haplotype molecular marker described in this invention is shown in SEQ ID NO:1; an insertion polymorphism exists at position 143 of SEQ ID NO:1, as shown in SEQ ID NO:2. This haplotype molecular marker is linked to the wheat stripe rust resistance trait and can be used for the screening and identification of wheat varieties resistant to stripe rust, providing an important technical means to improve the efficiency of stripe rust-resistant wheat breeding.

Description

Technical Field

[0001] This invention belongs to the field of crop molecular breeding technology, specifically involving the application of a haplotype molecular marker of the TaACO3 gene in assisting wheat stripe rust resistance breeding. Background Technology

[0002] Wheat is one of the most important food crops in the world and in my country, with the world's planting area second only to corn and rice, providing food for approximately 35% of the world's population. Stripe rust, caused by the fungus *Puccinia striiformis* f. sp. *tritici* (Pst), is one of the most serious diseases affecting wheat growth. Infection and outbreaks of stripe rust can lead to a significant reduction in wheat yield and quality. In the field, the stripe rust fungus constantly mutates and produces new physiological races, thus overcoming the stripe rust resistance of long-term, monoculture resistant varieties.

[0003] Developing disease-resistant breeding programs and selecting and planting disease-resistant varieties are the most economical, effective, and environmentally friendly measures for controlling wheat stripe rust. To efficiently breed wheat varieties resistant to stripe rust and to provide genetic resources for breeding wheat varieties with durable and stable stripe rust resistance, it is necessary to discover more molecular markers that assist in breeding wheat varieties resistant to stripe rust. Summary of the Invention

[0004] The purpose of this invention is to provide a new application of haplotype molecular markers of the TaACO3 gene, which are associated with disease resistance traits in wheat, thus providing a new screening tool for breeding disease-resistant wheat.

[0005] This invention provides an application of a haplotype molecular marker of the wheat TaACO3 gene in assisting in the breeding of disease-resistant wheat, the nucleotide sequence of which is shown in SEQ ID NO:1;

[0006] The DNA fragment with the nucleotide sequence shown in SEQ ID NO:2 has an insertion polymorphism at position 143 in SEQ ID NO:1.

[0007] Preferably, the nucleotide sequence of the haplotype molecular marker is as shown in SEQ ID NO:3 or SEQ ID NO:4.

[0008] Preferably, the haplotype molecular marker is obtained by primer amplification;

[0009] The primer pair includes an upstream primer with a nucleotide sequence as shown in SEQ ID NO:5 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO:6.

[0010] This invention provides an application of a haplotype molecular marker of the wheat TaACO3 gene in assisting in the breeding of disease-resistant wheat, the nucleotide sequence of which is shown in SEQ ID NO:7;

[0011] The haplotype molecular markers include 15 SNP sites and 2 insertion mutation sites;

[0012] A C / T polymorphic site exists at position 177bp in SEQ ID NO:7;

[0013] A T / C polymorphic site exists at position 252 bp in SEQ ID NO:7;

[0014] An A / T polymorphic site exists at position 609 bp in SEQ ID NO:7;

[0015] A G / C polymorphic site exists at position 651 bp in SEQ ID NO:7;

[0016] A C / G polymorphic site exists at position 690 bp in SEQ ID NO:7;

[0017] A T / G polymorphic site exists at position 810 bp in SEQ ID NO:7;

[0018] An A / C polymorphic site exists at position 845 bp in SEQ ID NO:7;

[0019] An insertion polymorphism of the nucleotide sequence shown in SEQ ID NO:8 exists at position 1418 bp in SEQ ID NO:7.

[0020] An A / G polymorphic site exists at position 1436 bp in SEQ ID NO:7;

[0021] A - / T polymorphic site exists at position 1464bp in SEQ ID NO:7;

[0022] An A / G polymorphic site exists at position 1484 bp in SEQ ID NO:7;

[0023] A - / AG polymorphic site exists at position 1504bp in SEQ ID NO:7;

[0024] A G / A polymorphic site exists at position 1521 bp in SEQ ID NO:7;

[0025] A T / C polymorphic site exists at position 1647bp in SEQ ID NO:7;

[0026] A C / T polymorphic site exists at position 1673bp in SEQ ID NO:7;

[0027] An insertion polymorphism of the nucleotide sequence shown in SEQ ID NO:2 exists at position 1725 bp in SEQ ID NO:7.

[0028] A C / G polymorphic site exists at position 1795 bp in SEQ ID NO:7.

[0029] Preferably, the nucleotide sequence of the haplotype molecular marker is as shown in SEQ ID NO:9 or SEQ ID NO:10.

[0030] Preferably, the haplotype molecular marker is amplified by a first primer pair, the primer pair comprising an upstream primer with a nucleotide sequence as shown in SEQ ID NO:11 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO:12.

[0031] Preferably, the assisted disease-resistant wheat breeding includes assisted screening of wheat disease-resistant traits and / or identification of disease-resistant wheat germplasm resources.

[0032] Preferably, the disease resistance includes stripe rust.

[0033] This invention provides a method for comparing the disease resistance of different wheat varieties, comprising the following steps: performing PCR amplification on the genomic DNA of the wheat variety to be tested using the primer pairs used in the invention, and obtaining PCR amplification products;

[0034] The PCR amplification product was detected to obtain the length of the PCR amplification product;

[0035] Disease resistance was determined based on the length of the PCR amplification product of the wheat variety being tested.

[0036] Wheat varieties with an amplified product length of 560 bp showed better average disease resistance than wheat varieties with an amplified product length of 285 bp.

[0037] This invention provides a method for screening disease-resistant wheat germplasm resources, comprising the following steps: performing PCR amplification on the genomic DNA of the wheat variety to be tested using the primer pairs used in the invention, and obtaining PCR amplification products;

[0038] The PCR amplification product was detected to obtain the length of the PCR amplification product;

[0039] Wheat germplasm resources were screened based on the length of the PCR amplification products of the wheat varieties to be tested:

[0040] Wheat varieties with an amplification product length of 285 bp were eliminated, and wheat varieties with an amplification product length of 560 bp were selected as disease-resistant wheat germplasm resources.

[0041] Beneficial effects:

[0042] This invention provides an application of haplotype molecular markers of the wheat TaACO3 gene in marker-assisted breeding of disease-resistant wheat. Using these haplotype molecular markers, the haplotypes of the TaACO3 gene in wheat varieties at any stage and in any tissue can be distinguished and / or identified. The presence and homozygous or heterozygous status of the TaACO3 gene in individual plants of hybrid breeding generations can be detected. The method is convenient, rapid, and not limited by weather or environmental conditions, and has high accuracy. Furthermore, it can be used for screening and identifying phenotypic traits, including stripe rust resistance, in wheat varieties, providing an important technical means for marker-assisted breeding of the TaACO3 gene. Attached Figure Description

[0043] Figure 1 This is a sequence alignment diagram of two haplotypes of TaACO3-Pro derived from common wheat;

[0044] Figure 2 The image shows the results of haplotype detection of 12 wheat varieties TaACO3 using haplotype molecular markers.

[0045] Figure 3 The results of haplotype molecular marker detection for the homozygous or heterozygous haplotype status of wheat variety TaACO3;

[0046] Figure 4 This is a graph showing the difference in average disease index between Hap2 and Hap1 varieties. Detailed Implementation

[0047] This invention provides the application of a haplotype molecular marker of the wheat TaACO3 gene in assisting in the breeding of disease-resistant wheat. The nucleotide sequence of the haplotype molecular marker is shown in SEQ ID NO:1 (5'-AGAAGGCAAGCCTTTTCTTACTAGTTCTCTCTCCTCCACCTCATTATTT ATCCTACGTGGCACT[T / C]CTAAGATAGCATCATTGTATATGCC[C / T]TTAGGG TAAGCTACTTGAAGTTGCGGCCCTCACGCTGATCCGTTTAGCTAA[- / GGGCA TGTACAATGGTCGATAAGGTAGTCTTATCTTAAATCTTGCATGTAATTTAGAGATGACAAAAAAACATGTCTACAATGGGTCATCTCTTAGCCTTATCTTCAATAGCTAGTTATTCCTAAAAACATGGTGAGACATATTGTGCTAAGAGATCATCTCTTGCCTTCTCTTAATTAAGAGAAGAC AAGCCTTATCTTATGATTTCTCTCCTCCACCTCATCATTTATCTTATGTGGCATTGCTAAGATAGAACCATTGTATATGCCCTAA]CTAACTGGGGCATATCTCGCTTGCTTTGGTCCCTACAGTTTTGTTTTGTACGTCCAGACAGCTTTGTTC[C / G]CCGTTCCATACTGACGATTGA CCAAAGTGATTTATAACAAATTAAGCTGTGTCGTAATTTCCTACGTCCCGGC-3'); there is a nucleotide sequence at position 143 in SEQ ID NO:1 such as SEQ ID NO:2(GGGCATGTACAATGGTCGATAAGGTAGTCTTATCTTAAATCTTGCATGTAA TTTAGAGATGACAAAAAAACATGTCTACAATGGGTCATCTCTTAGCCTTATCTTCAATAGCTAGTTATTCCTAAAAACATGGTGAGACATATTGTGCTAAGAGATCATCTCTTGCCTTCTCTTAATTAAGAGAAGACAAGCCTTATCTTATGATTTCTCTCTCCTCCACCTCATCATTTATCTTATGTGGCATTGCTAAGATAGAACCATTGTATATGCCCTAA) Insertion polymorphism of the DNA fragment shown.

[0048] In the present invention, the nucleotide sequence of the haplotype molecular marker is as shown in SEQ ID NO:3 (AGAAGGCAAGCCTTTTCTTACTAGTTCTCTCTCCTCCACCTCATTATTTAT CCTACGTGGCACTCCTAAGATAGCATCATTGTATATGCCTTTAGGGTAAGCTACTTGAAGTTGCGGCCCTCACGCTGATCCGTTTAGCTAAGGGCATGTACAATGGTCGATAAGGTAGTCTTATCTTAAATCTTGCATGTAATTTAGAGATGACAAAAAAACATGTCTACAATGGGTCATCTCTTAGCCTTATCTTCAATAGCTAGTTATTCCTAAAAACATGGTGAGACATATTGTGCTAAGAGATCATCTCTTGCCTTCTCTTAATTAAGAGAAGACAAGCCTTATCTTATGATTTCTCTCTCCTCCACCTCATCATTTATCTTATGTGGCATTGCTAAGATAGAACCATTGTATATGCCCTAACTAACTGGGGCATATCTCGCTTGCTTTGGTCCCTACAGTTTTGTTTTGTACGTCCAGACAGCTTTGTTCGCCGTTCCATACTGACGATTGACCAAAGTGATTTATAACAAATTAAGCTGTGTCGTAATTTCCTACGTCCCGGC) or SEQ ID NO:4

[0049] (AGAAGGCAAGCCTTTTCTTACTAGTTCTCTCTCCTCCACCTCATTATTTAT CCTACGTGGCACTTCTAAGATAGCATCATTGTATATGCCCTTAGGGTAAGCTACTTGAAGTTGCGGCCCTCACGCTGATCCGTTTAGCTAACTAACTGGGGCATATCTCGCTTGCTTTGGTCCCTACAGTTTTGTTTTGTACGTCCAGACAGCTTTGTTCCCCGTTCCATACTGACGATTGACCAAAGTGATTTATAACAAATTAAGCTGTGTCGTAATTTCCTACGTCCCGGC).

[0050] In this invention, the nucleotide sequence of SEQ ID NO:3 represents haplotype Hap2 of the TaACO3 gene, with a nucleotide sequence length of 560 bp, and is associated with wheat resistance to stripe rust. The nucleotide sequence of SEQ ID NO:4 represents haplotype Hap1 of the TaACO3 gene, with a nucleotide sequence length of 285 bp, and is associated with wheat susceptibility to stripe rust. The haplotype molecular marker is preferably obtained by amplification using a first primer pair. The first primer pair includes an upstream primer with a nucleotide sequence as shown in SEQ ID NO:5 (5'-AGAAGGCAAGCCTTTTCTTACTAG-3') and a downstream primer with a nucleotide sequence as shown in SEQ ID NO:6 (5'-GCCGGGACGTAGGAAATTACG-3'). This invention does not impose any special restrictions on the source of the primer pair; primer pairs well-known in the art can be used. In this embodiment, the primer pair was synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0051] In this invention, the first primer pair is used in assisting in the breeding of disease-resistant wheat. The first primer pair amplifies the haplotype molecular marker of wheat. When the sequence length of the amplified product is 560 bp, the haplotype of the TaACO3 gene in the wheat variety being tested is Hap2, which has strong resistance to stripe rust, and the wheat variety is selected as breeding material for disease-resistant wheat breeding. When the sequence length of the amplified product is 285 bp, the haplotype of the TaACO3 gene in the wheat variety being tested is Hap1, and the wheat variety being tested is discarded.

[0052] In one embodiment of the present invention, the resistance to stripe rust of 154 wheat varieties was identified based on the haplotype molecular markers, including 49 varieties of type Hap1 and 105 varieties of type Hap2. Combined with the results of wheat stripe rust phenotypic identification, the varieties containing Hap2 (average disease index of 15.37 for 105 varieties) showed a significantly lower rate than those containing Hap1 (average disease index of 45.01 for 49 varieties). Furthermore, analysis of stripe rust infection patterns in different varieties revealed that most wheat varieties containing TaACO3-Hap1 were susceptible to stripe rust, while wheat varieties containing TaACO3-Hap2 were resistant. When screening for disease-resistant wheat germplasm resources, wheat varieties containing TaACO3-Hap1 can be eliminated, and wheat varieties containing TaACO3-Hap2 can be selected as disease-resistant wheat germplasm resources. Therefore, the haplotype molecular markers described in this invention are linked to wheat stripe rust resistance traits and can be used for screening and identification of stripe rust resistance in wheat varieties, improving wheat breeding efficiency and providing an important technical means to assist in breeding disease-resistant wheat.

[0053]

[0054] The haplotype molecular marker includes 15 SNP sites and 2 insertion mutation sites; a C / T polymorphism site exists at position 177bp in SEQ ID NO:7;

[0055] A T / C polymorphic site exists at position 252 bp in SEQ ID NO:7;

[0056] An A / T polymorphic site exists at position 609 bp in SEQ ID NO:7;

[0057] A G / C polymorphic site exists at position 651 bp in SEQ ID NO:7;

[0058] A C / G polymorphic site exists at position 690 bp in SEQ ID NO:7;

[0059] A T / G polymorphic site exists at position 810 bp in SEQ ID NO:7;

[0060] An A / C polymorphic site exists at position 845 bp in SEQ ID NO:7;

[0061] An insertion polymorphism of the nucleotide sequence shown in SEQ ID NO:8 (AGACAACTTGG) exists at position 1418 bp in SEQ ID NO:7.

[0062] An A / G polymorphic site exists at position 1436 bp in SEQ ID NO:7;

[0063] A - / T polymorphic site exists at position 1464bp in SEQ ID NO:7;

[0064] An A / G polymorphic site exists at position 1484 bp in SEQ ID NO:7;

[0065] A - / AG polymorphic site exists at position 1504bp in SEQ ID NO:7;

[0066] A G / A polymorphic site exists at position 1521 bp in SEQ ID NO:7;

[0067] A T / C polymorphic site exists at position 1647bp in SEQ ID NO:7;

[0068] A C / T polymorphic site exists at position 1673bp in SEQ ID NO:7;

[0069] An insertion polymorphism of the nucleotide sequence shown in SEQ ID NO:2 exists at position 1725 bp in SEQ ID NO:7.

[0070] A C / G polymorphic site exists at position 1795 bp in SEQ ID NO:7.

[0071] In this invention, the haplotype molecular marker is preferably located 2 kb upstream of the TaACO3 gene, whose Gene ID in the Chinese Spring Genome Database is TraesCS6A02G325600. All mutation sites in the haplotype molecular marker are tightly linked, classifying wheat varieties into two haplotypes, Hap2 and Hap1.

[0072]

[0073] In this invention, the haplotype molecular marker is amplified using a second primer pair. The second primer pair comprises an upstream primer with the nucleotide sequence shown in SEQ ID NO:11 (CTTTTCTTGAGGGAAAGGGC) and a downstream primer with the nucleotide sequence shown in SEQ ID NO:12 (CTCTGTATGTGTGCTTGTGC). This invention does not impose any particular limitation on the source of the second primer pair; primer pairs well-known in the art can be used. In this embodiment, the primer pair was synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0074] In this invention, the second primer pair can amplify and sequence the haplotype molecular markers described in the above-mentioned technical solution in wheat, and the haplotypes of the TaACO3 gene promoter in wheat varieties are identified as Hap1 and Hap2 based on the sequencing results.

[0075] In another embodiment of the present invention, the haplotype molecular markers were used to identify the TaACO3 haplotypes in 88 wheat varieties. Sequencing results showed that the differentially expressed sites of the two haplotypes were closely linked, and the haplotype molecular markers classified the wheat varieties into two haplotypes, Hap1 and Hap2. The sequence structure diagrams of haplotypes Hap1 and Hap2 are shown below. Figure 1 .Depend on Figure 1 It is known that the TaACO3-Pro gene includes 15 SNP sites and 2 insertion mutation sites, and all mutation sites are closely linked. Analysis of wheat stripe rust phenotypic identification results shows that wheat varieties containing Hap2 have better average disease resistance than those containing Hap1. Most varieties containing Hap1 are susceptible to stripe rust, while varieties containing Hap2 are more resistant. When screening for disease-resistant wheat germplasm resources, varieties containing Hap1 can be eliminated, and wheat varieties containing Hap2 can be selected as disease-resistant wheat germplasm resources. Therefore, the haplotype molecular marker described in this invention is linked to the wheat stripe rust resistance trait and can be used for screening and identifying wheat varieties' resistance to stripe rust, improving wheat breeding efficiency and providing an important technical means for assisting in the breeding of disease-resistant wheat.

[0076] In this invention, the assisted disease-resistant wheat breeding preferably includes assisted screening of wheat for disease resistance traits and / or identification of disease-resistant wheat germplasm resources. The disease resistance preferably includes stripe rust.

[0077] This invention provides a method for comparing the disease resistance of different wheat varieties, comprising the following steps: performing PCR amplification on the genomic DNA of the wheat variety to be tested using the first primer pair used in the invention, and obtaining the PCR amplification product;

[0078] The PCR amplification product was detected to obtain the length of the PCR amplification product;

[0079] Disease resistance was determined based on the length of the PCR amplification product of the wheat variety being tested.

[0080] Wheat varieties with an amplified product length of 560 bp showed better average disease resistance than wheat varieties with an amplified product length of 285 bp.

[0081] This invention provides a method for screening disease-resistant wheat germplasm resources, comprising the following steps: performing PCR amplification on the genomic DNA of the wheat variety to be tested using the primer pairs used in the invention, and obtaining PCR amplification products;

[0082] The PCR amplification product was detected to obtain the length of the PCR amplification product;

[0083] Wheat germplasm resources were screened based on the length of the PCR amplification products of the wheat varieties to be tested:

[0084] Wheat varieties with an amplification product length of 285 bp were eliminated, and wheat varieties with an amplification product length of 560 bp were selected as disease-resistant wheat germplasm resources.

[0085] In this invention, the first primer pair used in the application is used to perform PCR amplification on the genomic DNA of the wheat variety to be tested, and the PCR amplification product is obtained.

[0086] This invention does not specifically limit the method for extracting genomic DNA from the wheat variety to be tested; conventional plant genomic DNA extraction methods in the art or commercial kits can be used. This invention also does not specifically limit the tissue from which the genomic DNA is extracted; genomic DNA extracted from any tissue at any stage of wheat growth is suitable for this method. The preferred PCR amplification reaction program of this invention is: 95℃ pre-denaturation for 5 min; 95℃ pre-denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 40 s, 35 cycles; 72℃ extension for 5 min. The preferred total volume of the PCR amplification reaction system is 20 μl, comprising the following components: 1 μL of 100 ng / μL template DNA, 10 μL of 2×3G TaqMasterMix, 0.4 μL each of 10 μmol / L forward and reverse primers, and 8.2 μL of ddH2O. After amplification, the PCR product is obtained.

[0087] The PCR amplification product was detected to obtain the length of the PCR amplification product.

[0088] This invention does not specifically limit the method for detecting the length of PCR amplification products; any conventional method in the art for obtaining the length of PCR amplification products, such as sequencing and electrophoresis, can be used. In this embodiment, agarose gel electrophoresis is used for detection; the specific steps of the gel electrophoresis detection are not specifically limited, and any conventional gel electrophoresis detection steps in the art can be used.

[0089] After obtaining the length of the PCR amplification product, wheat germplasm resources were screened based on the length of the PCR amplification product of the wheat variety to be tested: wheat varieties with an amplification product length of 285 bp were eliminated, and wheat varieties with an amplification product length of 560 bp were selected as disease-resistant wheat germplasm resources.

[0090] This invention utilizes the haplotype molecular markers to differentiate and / or identify the haplotypes of the TaACO3 gene in wheat varieties at any time and in any tissue, detect the presence of the TaACO3 gene in each individual plant of hybrid breeding generations, and determine its homozygous or heterozygous status. The method is convenient, rapid, and not limited by weather or environmental conditions, and has high accuracy. The haplotypes of the TaACO3 gene are haplotypes Hap1 and Hap2, which are highly conserved in wheat, and can therefore be used for screening and identifying phenotypic traits of stripe rust resistance in wheat varieties.

[0091] To further illustrate the present invention, the technical solutions provided by the present invention will be described in detail below with reference to the accompanying drawings and embodiments, but these should not be construed as limiting the scope of protection of the present invention.

[0092] Example 1

[0093] Acquisition and Sequence Analysis of TaACO3-Pro

[0094] Based on the Chinese Spring genome database (Chinese Spring RefSeq v1.1, http: / / plants.ensembl.org / Triticum_aestivum / Info / Index), specific primers TaACO3-Pro-f / r (Table 1) were designed for the 2kb upstream sequence of the TaACO3 (Gene ID: TraesCS6A02G325600) gene. TaACO3-Pro analysis was performed on 88 wheat varieties. Primer design was performed using SnapGene 4.1.9 (…). https: / / www.snapgene.com / ).

[0095] Table 1 Primer sequences used for amplifying TaACO3-Pro

[0096]

[0097] Extraction of genomic DNA from wheat grains:

[0098] (1) Crush about 1g of wheat seeds with a hammer and put them into a 2mL centrifuge tube containing a 5mm steel ball. Label the seed variety on the tube cap and add 700μL of seed extract (prepared as follows). Place the tube in a shaker at 37℃ for 30min. (Alternatively, place the tube in a shaker at 50-60℃ for 30min, but shake it occasionally).

[0099] (2) The formulation of wheat grain DNA extraction solution is shown in Table 2:

[0100] Table 2. Formula for Wheat Grain DNA Extraction Solution

[0101] Components Original concentration Final concentration Dosage SDS 10％ 0.5％ 25mL NaCl 5M 288mM 28.8mL EDTA (pH 8.0) 0.5M, pH 8.0 25mM 25mL Tris-HCl (pH 8.0) 1M, pH 8.0 200mM 100mL

[0102] (3) Add 700 μL of phenol:chloroform (1:1, volume ratio) reagent to a centrifuge tube, shake on a shaker for 10-20 min, and then centrifuge at 12000 rpm for 10 min.

[0103] (4) Transfer the supernatant (about 500 μL) to a 1.5 mL tube, add the same volume of chloroform:isoamyl alcohol (24:1, volume ratio), shake on a shaker for 10-20 min, centrifuge at 12,000 rpm for 10 min.

[0104] (5) Transfer the supernatant to a new 1.5 mL tube, add 0.7 times the volume of pre-cooled isopropanol, mix well, and place at -20℃ for 30 min.

[0105] (6) Centrifuge at 12,000 rpm for 10 min. Discard the supernatant and wash the precipitate with 70% alcohol.

[0106] (7) Repeat step 6.

[0107] (8) Discard the alcohol, place it in a ventilated place for 5-10 minutes to dry the alcohol, and finally dissolve the DNA with an appropriate amount of sterile water.

[0108] Using the DNA extracted by the above method as a template, PCR amplification was performed using the primers described in Table 1. The PCR reaction system was 20 μL, including 1 μL of template DNA, 10 μL of 2×3G TaqMasterMix premix (Nanjing Novizan Biotechnology Co., Ltd.), 0.4 μL each of upstream and downstream primers, and sterile water was added to make up to 20 μL.

[0109] PCR reaction procedure: 95℃ pre-denaturation for 5 min, 95℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension at a rate of 1 kb / min, 35 cycles; 72℃ extension for 5 min, storage at 4℃. PCR products were separated by agarose gel electrophoresis, excised, and sequenced by Shanghai Shangya Gene Co., Ltd.

[0110] Sequencing results showed that the TaACO3-Pro gene from 88 wheat varieties was divided into two haplotypes, Hap2 and Hap1 (Table 3). Sequence alignments of the two haplotypes of ACO-6A-Pro derived from common wheat are shown below. Figure 1 .Depend on Figure 1 It is known that the TaACO3-Pro gene includes 15 SNP sites and 2 insertion mutation sites, and all mutation sites are closely linked.

[0111] Table 3. Statistical table of TaACO3-Pro haplotypes of 88 varieties

[0112]

[0113]

[0114]

[0115]

[0116] Example 2

[0117] Identification of TaACO3-Pro-GSM haplotypes in common wheat variety TaACO3 and association analysis of stripe rust resistance

[0118] Based on the results of Example 1, the mutation sites in the TaACO3-Pro gene are closely linked to the wheat rust resistance trait. The TaACO3-Pro gene contains an insertion site mutation, TaACO3-Pro-GSM, which is also closely linked to the wheat rust resistance trait. Furthermore, primers were designed based on the insertion site in the TaACO3 gene to verify the stripe rust resistance of different wheat varieties.

[0119] The strains identified in the mixed stripe rust nursery were the main stripe rust races or pathogenic types currently observed. A mixed strain composed of eight physiological races—CYR17, CYR25, CYR29, CYR30, CYR31, CYR32, CYR33, and CYR34—was used in equal proportions. Stripe rust disease index and infection type evaluation were performed according to the "Evaluation Standard for Wheat Resistance to Stripe Rust" in the National Standard NY_T2953-2016, Technical Specifications for Identification of Stripe Rust Resistance in Wheat Regional Trials.

[0120] Table 4. Primer sequences for TaACO3-Pro-GSM

[0121] Tag Name Primer sequence (5'-3') serial number TaACO3-Pro-GSM-f AGAAGGCAAGCCTTTTCTTACTAG SEQ ID NO:5 TaACO3-Pro-GSM-r GCCGGGACGTAGGAAATTACG SEQ ID NO:6

[0122] Using DNA from different wheat varieties as templates, PCR amplification was performed using the primers described in Table 4. The PCR reaction system consisted of 20 μL, including 1 μL of template DNA, 10 μL of 2×3G TaqMasterMix premix (Nanjing Novizan Biotechnology Co., Ltd.), 0.4 μL each of forward and reverse primers, and sterile water to make up to 20 μL.

[0123] PCR reaction procedure: 95℃ pre-denaturation for 5 min, 95℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension rate 1 kb / min, 35 cycles; 72℃ extension for 5 min, store at 4℃.

[0124] After the PCR products are separated by agarose gel electrophoresis, the haplotype of TaACO3 can be identified based on the band size. If the length of the amplified product is 560 bp, the haplotype of TaACO3 in the wheat variety being tested is Hap2; if the length of the amplified product is 285 bp, the haplotype of TaACO3 in the wheat variety being tested is Hap1.

[0125] The above method was used to amplify and analyze the TaACO3 gene haplotypes of 154 wheat varieties.

[0126] The results are shown in Tables 5 and 6. The gel electrophoresis results for some wheat varieties are as follows: Figure 2 As shown.

[0127] The molecular marker was used to identify the TaACO3 haplotypes in 154 wheat varieties, including 49 haplotypes of type Hap1 and 105 haplotypes of type Hap2.

[0128] According to molecular marker detection, the proportion of superior haplotypes of Hap2 is higher in the main varieties and backbone breeding parents that are widely promoted in the Huang-Huai wheat region and the middle and lower reaches of the Yangtze River in my country, which is the result of long-term selection by breeders.

[0129] Table 5. Statistical table of TaACO3 genotypes from 154 varieties

[0130]

[0131]

[0132]

[0133]

[0134]

[0135]

[0136] Table 6 shows the statistical table of TaACO3 genotypes for 154 varieties.

[0137] haplotype number Hap1 49 Hap2 105

[0138] Meanwhile, the homozygous and heterozygous status of the TaACO3 haplotypes of each individual plant in the wheat F2 segregating population was identified using the primers in Table 4. The parents of the F2 population were Kexing 3302 (Hap1) and Xinong 161 (Hap2), respectively. The results are as follows: Figure 3 As shown, if the wheat plant has one electrophoretic band with an amplification product length of 560 bp, then the TaACO3-Pro haplotype of the tested wheat plant is homozygous Hap2; if it has one electrophoretic band with an amplification product length of 285 bp, then the TaACO3-Pro haplotype of the tested wheat plant is homozygous Hap1; if it has one electrophoretic band with an amplification product length of 560 bp and one electrophoretic band with an amplification product length of 285 bp, then the TaACO3-Pro haplotype of the tested wheat plant is heterozygous.

[0139] Further correlation analysis was conducted between wheat stripe rust resistance and haplotype. Based on the stripe rust phenotypic identification results of varieties participating in the 2022-23 National Huang-Huai-Nan Regional Variety Comparison Trial, and combined with the haplotype identification results of the TaACO3 gene in different varieties using the aforementioned detection methods, statistical analysis revealed that varieties containing Hap2 (average disease index of 15.37 for 105 varieties) had a significantly lower disease index than varieties containing Hap1 (average disease index of 45.01 for 49 varieties). Figure 4 Meanwhile, analysis of stripe rust infection types in different varieties revealed that all 20 stripe rust-immune varieties were Hap2, among the highly resistant varieties, 9 were Hap2 and 1 was Hap1, and among the moderately resistant varieties, 14 were Hap2 and 2 were Hap1 (Table 7).

[0140] Table 7. Statistics on the number of wheat varieties infected with different stripe rust types among 154 wheat varieties.

[0141] Stripe rust infection type Hap1 Hap2 IM 0 20 HR 1 9 MR 2 14 MS 38 58 HS 8 4

[0142] Correlation analysis of wheat stripe rust resistance and haplotypes led to the conclusion that Hap2 type varieties are more resistant to stripe rust. The molecular markers of this invention can identify the haplotype of the TaACO3 gene in wheat varieties, assisting in the screening of wheat varieties with different haplotypes and stripe rust resistance. This detection method is convenient, rapid, and highly accurate, providing an important technical means for marker-assisted breeding of the TaACO3 gene.

[0143] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. Other embodiments can be obtained based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A type of wheat TaACO3 The application of haplotype molecular markers of genes in assisting wheat breeding for resistance to stripe rust, wherein the nucleotide sequence of the haplotype molecular marker is shown in SEQ ID NO:3 or SEQ ID NO:4; The nucleotide sequence shown in SEQ ID NO:3 represents TaACO3 The haplotype Hap2, with a nucleotide sequence length of 560 bp, is associated with wheat resistance to stripe rust. The nucleotide sequence shown in SEQ ID NO:4 represents TaACO3 The haplotype Hap1, with a nucleotide sequence length of 285 bp, is associated with wheat susceptibility to stripe rust.

2. The application according to claim 1, characterized in that, The haplotype molecular marker was obtained by amplification using the first primer pair; The first primer pair includes an upstream primer with a nucleotide sequence as shown in SEQ ID NO:5 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO:

6.

3. A type of wheat TaACO3 The application of haplotype molecular markers of genes in assisting wheat breeding for resistance to stripe rust, wherein the nucleotide sequence of the haplotype molecular marker is shown in SEQ ID NO:9 or SEQ ID NO:10; The nucleotide sequence shown in SEQ ID NO:9 represents TaACO3 The haplotype Hap2 is associated with wheat resistance to stripe rust. The nucleotide sequence shown in SEQ ID NO:10 represents TaACO3 The haplotype Hap1 is associated with wheat susceptibility to stripe rust.

4. The application according to claim 3, characterized in that, The haplotype molecular marker is amplified by a second primer pair, which includes an upstream primer with a nucleotide sequence as shown in SEQ ID NO:11 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO:

12.

5. The application according to any one of claims 1 to 4, characterized in that, The assisted breeding of wheat resistant to stripe rust includes assisted screening of wheat varieties resistant to stripe rust and / or identification of wheat germplasm resources resistant to stripe rust.

6. A method for comparing the resistance of different wheat varieties to stripe rust, characterized in that, The process includes the following steps: performing PCR amplification on the genomic DNA of the wheat variety to be tested using the first primer pair as described in claim 2, to obtain the PCR amplification product; The PCR amplification product was detected to obtain the length of the PCR amplification product; The resistance to stripe rust was determined based on the length of the PCR amplification product of the wheat variety being tested. Wheat varieties with an amplified product length of 560 bp showed better average resistance to stripe rust than wheat varieties with an amplified product length of 285 bp.

7. A method for screening wheat germplasm resources resistant to stripe rust, characterized in that, The steps include: performing PCR amplification on the genomic DNA of the wheat variety to be tested using the first primer pair as described in claim 2, to obtain the PCR amplification product; The PCR amplification product was detected to obtain the length of the PCR amplification product; Wheat germplasm resources were screened based on the length of the PCR amplification products of the wheat varieties to be tested: Wheat varieties with an amplification product length of 285 bp were eliminated, and wheat varieties with an amplification product length of 560 bp were selected as stripe rust resistant wheat germplasm resources.

Images