Reagent and method for knocking out TRAC and B2M in T cells

Abstract

The present invention relates to TRAC and B2M dual knockout in T cells for CAR-T therapy. In particular, the present invention relates to sgRNA sequences targeting TRAC and B2M with higher knockout efficiency and methods of use thereof. More specifically, the invention provides an sgRNA set, which comprises sgRNA of a targeted B2M gene shown by any one of nucleotide sequences such as sequences 3, 6, 9, 12, 14, 15, 16, 18 and 19, and sgRNA of a targeted TRAC gene shown by any one of nucleotide sequences such as sequences 37 and 41. On the other hand, the invention provides a method for generating the TRAC / B2M double-negative T cell, which comprises the step of treating the T cell by using the sgRNA set, so that the B2M gene and the TRAC gene in the T cell are knocked out.

Description

[0001] This application is a divisional application of the Chinese invention patent application with application number 202310869844.9 filed on July 17, 2023 and invention name “Reagents and methods for knocking out TRAC and B2M in T cells”. Technical Field

[0002] The present invention relates to double knockout of TRAC and B2M in T cells. Specifically, the present invention relates to sgRNA sequences targeting TRAC and B2M with high knockout efficiency and methods of using the same. Background Art

[0003] As of June 2021, five CAR-T products have been launched worldwide. All of these five products belong to autologous CAR-T therapy. Their preparation requires collecting peripheral blood from cancer patients, isolating T cells, genetically modifying them, and returning them to patients after in vitro culture. It is a "tailor-made" individualized treatment method. Autologous CAR-T therapy is completely changing the way and method of cancer treatment, but there are also some obvious limitations. First, the production cycle of autologous CAR-T is long, patients need a long waiting time, and some patients may miss the best treatment window. Secondly, the quality consistency of autologous CAR-T products is relatively poor. Inconsistent T cell status of patients will affect the efficacy of the product, and some patients face the risk of preparation failure. Therefore, not all patients with indications can receive treatment. In general, the number and quality consistency of cells prepared each time cannot be fully guaranteed. In addition, the preparation of autologous CAR-T is limited by the starting materials, and it is difficult to carry out secondary preparation and treatment. Finally, the logistics of autologous CAR-T are complex and the scale efficiency is relatively low, which leads to high costs for this individualized treatment.

[0004] Allogeneic CAR-T, also known as universal CAR-T (UCAR-T) and ready-to-use CAR-T, refers to the extraction and separation of T cells from healthy volunteers, and the relevant transformation to prepare CAR-T cells, so that it can not only avoid the immune rejection reaction after transplantation, but also play the established anti-cancer effect. A large number of CAR-T cells can be prepared and stored at one time, and when patients need CAR-T cells, the purpose of "take and use" can be achieved. Compared with autologous CAR-T, allogeneic CAR-T can deliver products on demand from inventory, and faster treatment time can enable more patients to receive treatment and obtain potential beneficial results. At the same time, multiple doses can be given as needed. Secondly, allogeneic CAR-T uses unified PBMC from healthy volunteers, with better cell viability and state, better quality consistency, more predictable safety and efficacy, and can treat all suitable patients. Finally, allogeneic CAR-T can treat a large number of patients in one production, and expanding the production scale can further reduce costs and reduce drug prices.

[0005] The above advantages of allogeneic CAR-T make it the main trend in the field of CAR-T cell therapy in the future. According to statistics from Nature magazine, the five most popular indications for blood malignancies are relapsed and refractory NHL (DLBCL, FL, MCL and CLL) and MM. If CAR-T therapy achieves important breakthroughs in solid tumors, more patients will benefit. The successful development of allogeneic CAR-T will make CAR-T cell immunotherapy a drug that cancer patients can use at any time and afford, and gain huge clinical and market application value.

[0006] The biggest scientific obstacle to allogeneic CAR-T lies in "graft-versus-host disease (GVHD)" and "host-versus-graft disease (HVGD)". T cells in the body recognize antigenic peptides bound to HLA molecules on the surface of antigen-presenting cells through TCR, thereby killing allogeneic cells. GVHD is caused by T lymphocytes in the allogeneic donor graft after transplantation, which launch cytotoxic attacks on the recipient's target cells. In the field of transplantation, HVGD refers to the recipient's rejection of donor tissues and organs, mainly due to the recognition of non-self HLA molecules in the graft. For allogeneic CAR-T, it means that the host T cells kill the donor's T cells.

[0007] Genes related to HVGD and GVHD include genes related to TCR and HLA molecules. T lymphocytes with these genes knocked out at the same time will not cause graft-versus-host disease (GVHD) when they are re-introduced into allogeneic patients, so they can be called "universal T cells." For example, a single TRAC gene is a gene encoding the TCRα chain and two TRBC genes encoding TCRβ form a complete and functional TCR complex. Knocking out TRAC can cause TCR inactivation, and B2M is an MHCI-related gene. T lymphocytes with these two genes knocked out at the same time will not cause HVGD and GVHD when they are re-introduced into allogeneic patients.

[0008] T cell receptor (TCR) is a specific receptor on the surface of T cells, responsible for recognizing antigens presented by the major histocompatibility complex (MHC). T cell receptors are heterodimers composed of two different subunits. The receptors of 95% of T cells are composed of α subunits (TCRα chain-TRAC gene encoding) and β subunits (TCRβ chain-TRBC gene encoding). In T cells, T cell receptors (TCR, including α chain and β chain), CD3 complex (including CD3γ, CD3δ and 2 CD3ε chains) and 2 ζ chains together form the T cell receptor complex (also known as TCR-CD3 complex), forming a complete cell surface antigen receptor to perform functions.

[0009] The major histocompatibility complex (MHC), also known as the major histocompatibility complex gene, is highly polymorphic. Its encoded product (major histocompatibility antigen) is an antigen presentation and T cell activation molecule, which is closely related to immune response and immune regulation, and is also an antigen that causes rapid and strong rejection reactions; among them, the human MHC glycoprotein is also called human leukocyte antigen (HLA). The MHC gene family is divided into three subgroups, encoding three types of molecules: MHC class I molecules, MHC class II molecules, and MHC class III molecules. The first class of major histocompatibility complex (MHC class I molecule) consists of an α chain that spans the cell membrane and an extracellular β2 microglobulin attached to this chain. The entire molecule consists of four regions, of which three regions are located on the α chain (α1-α3), and β2 microglobulin constitutes the fourth region. In humans, the first class of MHC, also known as the first type of human leukocyte antigen molecule, is distributed on the surface of almost all nucleated cells. These molecules can be further divided into HLA-A, HLA-B and HLA-C. "β2 microglobulin (B2M)" is the β chain (light chain) part of the human leukocyte antigen (HLA) on the cell surface. If the B2M gene is knocked out, the cell will not express β2 microglobulin, and MHC class I molecules cannot be formed on the cell surface.

[0010] The existing allogeneic CAR-T process is small in scale and cannot meet market demand. There are major defects in large-scale cell sorting, large-volume T cell culture, and magnetic bead removal, which hinder the industrial production progress of allogeneic CAR-T. Summary of the invention

[0011] The technical problem to be solved by the present invention is to overcome the problems of GVHD and HVGD caused by allogeneic CAR-T.

[0012] The technical solution of the present invention is to provide sgRNA with high knockout efficiency targeting TRAC (TCR α chain) and B2M (β-2-microglobulin in HLA) and a method for using the sgRNA.

[0013] In order to overcome the immune rejection reaction that may be caused by allogeneic CAR-T, we used gene editing methods to knock out the TRAC and B2M genes in T cells through CRISPR / Cas9, so that TCR complexes and HLA molecules cannot be formed on the surface of T cells, thereby avoiding GVHD and HVGD rejection reactions caused by allogeneic CAR-T.

[0014] We screened sgRNA with high knockout efficiency to obtain high-purity TRAC / B2M double-negative cells, improve the efficiency of double-negative cell sorting, and lay a good foundation for the purity of double-negative cells in the final product. At the same time, we improved the methods and processes of cell sorting to achieve the sorting of T cells from large quantities of PBMCs and the sorting of TRAC / B2M double-negative cells from a large number of gene-edited T cells. At the same time, we sorted double-negative T cells through intermediate steps and continued to culture them after sorting, reducing the difficulty and cost of cell sorting.

[0015] In a first aspect, the present invention relates to an sgRNA targeting the B2M gene, wherein the nucleotide sequence is as shown in any one of sequences 1-21, in particular as shown in any one of sequences 3, 6, 9, 12, 14, 15, 16, 18 and 19, and in particular as shown in sequence 18.

[0016] In a second aspect, the present invention relates to an sgRNA targeting the TRAC gene, wherein the nucleotide sequence thereof is shown in any one of sequences 22-41, in particular in any one of sequences 37 and 41, and in particular in sequence 37.

[0017] In a third aspect, the present invention relates to an sgRNA set comprising one or more sgRNAs of the first aspect of the present invention and one or more sgRNAs of the second aspect of the present invention. In one embodiment, the sgRNA set comprises the sgRNA of the first aspect of the present invention as shown in SEQ ID NO: 18 and the sgRNA of the second aspect of the present invention as shown in SEQ ID NO: 37.

[0018] In a fourth aspect, the present invention relates to a method for generating TRAC / B2M double negative T cells (particularly TRAC / B2M double negative CAR-T cells), comprising: treating T cells with the sgRNA kit of the present invention so that the B2M gene and TRAC gene therein are knocked out. In one embodiment, the treatment of T cells with the sgRNA kit is performed by electroporating the Cas9 protein and the sgRNA kit with the RNP complex. In one embodiment, each 100 μL electroporation system contains 2.5 to 9 μg of each sgRNA, 5 to 10 μg of Cas9, and 5.0E+06 to 2.0E+07 T cells. In one embodiment, each 100 μL electroporation system contains 5 μg of each sgRNA, 10 μg of Cas9, and 5.0E+06 to 2.0E+07 T cells, such as 5.0E+06, 7.5E+06, 1.0E+07, 1.25E+07, 1.5E+07, 1.75E+07, or 2.0E+07 T cells. In one embodiment, sgRNA targeting the B2M gene, sgRNA targeting the TRAC gene, or sgRNA kit is introduced by electroporation, lentivirus, or AAV. In one embodiment, Cas9 is introduced by electroporation, lentivirus, or AAV. In one embodiment, the way to introduce the sgRNA kit is the same as the way to introduce Cas9. In one embodiment, the way to introduce the sgRNA kit is different from the way to introduce Cas9. In one embodiment, the way to introduce the sgRNA targeting the B2M gene is the same as the way to introduce the sgRNA targeting the TRAC gene. In one embodiment, the method of introducing sgRNA targeting the B2M gene is different from the method of introducing gRNA targeting the TRAC gene. In one embodiment, before or after treating T cells with the sgRNA set, the T cells are treated with nucleic acids encoding CAR polypeptides so that the CAR polypeptides are expressed on the surface of T cells. In one embodiment, the treatment of T cells with nucleic acids encoding CAR polypeptides is carried out by lentiviral infection. In one embodiment, after treating T cells with sgRNA sets, TRAC / B2M double negative cells are sorted and / or expanded. In one embodiment, after treating T cells with sgRNA sets, TRAC / B2M double negative cells are expanded after sorting TRAC / B2M double negative cells. In one embodiment, after treating T cells with sgRNA sets, TRAC / B2M double negative cells are sorted after expansion. In one embodiment, the CAR targets CD19. In one embodiment, the CAR targets IL-13Ra2. In one embodiment, the CAR targets BCMA.In one embodiment, the CAR comprises an antigen (e.g., CD19, IL-13Ra2, or BCMA) binding region (e.g., scFv), a hinge region (e.g., from CD8, CD28, IgG1, or IgG4), a transmembrane region (e.g., from CD28, CD8, CD4, or ICOS), one or more intracellular co-stimulatory domains (e.g., from CD28, 4-1BB, ICOS, CD27, or OX40), and an intracellular signaling domain (e.g., from CD3ξ). In one embodiment, the CAR targeting CD19 is encoded by sequence 42. In one embodiment, the CAR targeting IL-13Ra2 is encoded by sequence 43. In one embodiment, the CAR targeting BCMA is encoded by sequence 44.

[0019] In a fifth aspect, the present invention relates to TRAC / B2M double-negative T cells obtained by the method of the present invention, in particular TRAC / B2M double-negative CAR-T cells.

[0020] In a sixth aspect, the present invention relates to a composition comprising TRAC / B2M double-negative T cells obtained by the method of the present invention, in particular TRAC / B2M double-negative CAR-T cells.

[0021] In the seventh aspect, the present invention relates to a method for treating a disease, comprising: administering to a patient TRAC / B2M double negative CAR-T cells obtained by the method of the present invention. In one embodiment, the present invention relates to a method for treating B cell leukemia (e.g., acute B cell leukemia), comprising: administering to a patient TRAC / B2M double negative CAR-T cells targeting CD19 obtained by the method of the present invention. In one embodiment, the present invention relates to a method for treating glioma (e.g., glioblastoma), comprising: administering to a patient TRAC / B2M double negative CAR-T cells targeting IL-13Ra2 obtained by the method of the present invention. In one embodiment, the present invention relates to a method for treating myeloma (e.g., multiple myeloma), comprising: administering to a patient TRAC / B2M double negative CAR-T cells targeting BCMA obtained by the method of the present invention.

[0022] In an eighth aspect, the present invention relates to the use of TRAC / B2M double-negative CAR-T cells obtained by the method of the present invention for preparing drugs.

[0023] In one embodiment, the TRAC / B2M double negative CAR-T cells obtained by the method of the present invention can be used to treat malignant blood tumors, malignant solid tumors or autoimmune diseases, or for the preparation of related drugs. In one embodiment, the malignant blood tumor is leukemia, polycythemia vera, lymphoma, multiple myeloma, Waldenstrom's macroglobulinemia, heavy chain disease, myelodysplastic syndrome or myelodysplasia. In one embodiment, the autoimmune disease is systemic lupus erythematosus or anti-synthetase antibody syndrome. In one embodiment, the malignant solid tumor is glioblastoma, liver cancer, gastric cancer, colorectal cancer, melanoma or lung cancer.

[0024] In one embodiment, the TRAC / B2M double negative CAR-T cells targeting CD19 obtained by the method of the present invention can be used to treat B cell leukemia (e.g., acute B cell leukemia), or for the preparation of related drugs. In one embodiment, the TRAC / B2M double negative CAR-T cells targeting CD19 obtained by the method of the present invention can be used to treat malignant blood tumors or autoimmune diseases, or for the preparation of related drugs. In one embodiment, the malignant blood tumor is leukemia, polycythemia vera, lymphoma, multiple myeloma, Waldenstrom's macroglobulinemia, heavy chain disease, myelodysplastic syndrome or myelodysplasia. In one embodiment, the leukemia is acute leukemia or chronic leukemia. In one embodiment, the acute leukemia is acute lymphocytic leukemia, acute myeloid leukemia, acute myeloid leukemia, acute myeloblastic leukemia, acute promyelocytic leukemia, acute granulocytic-monocytic leukemia, acute monocytic leukemia or acute erythroleukemia. In one embodiment, the chronic leukemia is chronic myeloid leukemia, chronic myeloid leukemia, or chronic lymphocytic leukemia. In one embodiment, the lymphoma is Hodgkin's lymphoma or non-Hodgkin's lymphoma. In one embodiment, the autoimmune disease is systemic lupus erythematosus or anti-synthetase antibody syndrome.

[0025] In one embodiment, the TRAC / B2M double-negative CAR-T cells targeting IL-13Ra2 obtained by the method of the present invention can be used to treat glioma (e.g., glioblastoma), or to prepare related drugs.

[0026] In one embodiment, the TRAC / B2M double negative CAR-T cells targeting BCMA obtained by the method of the present invention can be used to treat myeloma (e.g., multiple myeloma), or for the preparation of related drugs. In one embodiment, the TRAC / B2M double negative CAR-T cells targeting BCMA obtained by the method of the present invention can be used to treat plasma cell leukemia, autoimmune diseases, or neuromyelitis optica spectrum diseases, or for the preparation of related drugs.

[0027] The present invention provides a kit comprising one or more containers, wherein the sgRNA of the first aspect of the present invention and the sgRNA of the second aspect of the present invention are separately or in any combination, and optionally Cas9 protein. In one embodiment, the present invention provides a kit comprising at least one container, wherein the Cas9 protein, the sgRNA of the first aspect of the present invention and the sgRNA of the second aspect of the present invention are contained. In one embodiment, the present invention provides a kit comprising at least one container, wherein the sgRNA of the first aspect of the present invention and the sgRNA of the second aspect of the present invention are contained. In one embodiment, the present invention provides a kit comprising at least two containers, wherein the first container is filled with the Cas9 protein, and the second container is filled with the sgRNA of the first aspect of the present invention and the sgRNA of the second aspect of the present invention. In one embodiment, the present invention provides a kit comprising at least two containers, wherein the first container is filled with the sgRNA of the first aspect of the present invention, and the second container is filled with the sgRNA of the second aspect of the present invention. In one embodiment, the present invention provides a kit comprising at least two containers, wherein the first container is filled with the sgRNA of the first aspect of the present invention, and the second container is filled with the sgRNA of the second aspect of the present invention. In one embodiment, the present invention provides a kit comprising at least three containers, wherein the first container contains Cas9 protein, the second container contains sgRNA of the first aspect of the present invention, and the third container contains sgRNA of the second aspect of the present invention. The kit of the present invention may also include instructions, providing information about the method of generating TRAC / B2M double negative CAR-T cells of the present invention using Cas9 protein, sgRNA of the first aspect of the present invention, and sgRNA of the second aspect of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 Screening of sgRNA targeting TRAC is shown. sgRNA-TRAC and Cas9 protein complexes were introduced into T cells by electroporation, and then cultured in a 37°C, CO2 cell culture incubator for 96 hours, and the knockout efficiency was detected by flow cytometry.

[0029] Figure 2Screening of sgRNA targeting B2M is shown. The mixture of sgRNA-B2M and Cas9 protein was introduced into T cells by electroporation, and then cultured in a 37°C, CO2 cell culture incubator for 96 hours, and the knockout efficiency was detected by flow cytometry.

[0030] Figure 3 The validation of double gene knockout is shown. The selected sgRNA combination and Cas9 protein complex were introduced into T cells by electroporation, and then cultured in a 37°C, CO2 cell culture incubator for 96 hours, and the knockout efficiency was detected by flow cytometry.

[0031] Figure 4 The results of electroporation optimization are shown. The selected sgRNA and Cas9 protein complex were introduced under different electroporation density conditions, and then cultured in a 37°C, CO2 cell culture incubator for 96 hours, and the knockout efficiency was detected by flow cytometry.

[0032] Figure 5 The results of sorting double-negative cells are shown. The gene editing efficiency of UCAR-T and the proportion of double-negative cells after sorting are shown.

[0033] Figure 6 Functional detection of double-negative UCAR-T cells is shown. The killing effect of T, CAR-T, and double-negative CAR-T cells on target antigen-negative cells (K562) and target antigen-positive cells (K562-CD19, Daudi) is shown after 6 hours of co-incubation.

[0034] Figure 7 Showing the safety test of double-negative UCAR-T cells.

[0035] Figure 8 HLA knockout validation is shown. Allogeneic PBMCs were co-cultured with irradiated control T cells and irradiated UCAR-T cells to detect the expression of cell activation marker CD25.

[0036] Fig. 9 CD3 knockout validation is shown. Control T cells and UCAR-T cells were co-cultured with irradiated allogeneic PBMCs to detect the expression of cell activation marker CD25.

[0037] Fig.10 The results showed that UCAR-T cells targeting CD19 significantly inhibited the growth of mouse tumors. After NCG mice were loaded with human acute B-lymphocytic leukemia cells Nalm-6, UCAR-T19 cells and control CAR-T19 cells without gene knockout were injected to observe the ability to clear tumor cells.

[0038] Fig.11The results showed that UCAR-T cells targeting CD19 significantly prolonged the survival of tumor-bearing mice. After NCG mice were loaded with human acute B-lymphocytic leukemia cells Nalm-6, UCAR-T19 cells and control CAR-T19 cells without gene knockout were injected, and the survival of mice in each group was monitored.

[0039] Fig.12 It showed that UCAR-T can significantly reduce the GVHD reaction in mice. After sublethally irradiated NCG mice, normal saline, spleen cells and bone marrow cells of B6 mice, human CAR-T cells, and UCAR-T cells were injected into the tail vein, and the clinical symptoms of the mice were observed and the GVHD scores of each group of mice were performed.

[0040] Fig.13 It showed that UCAR-T can significantly slow down the weight loss of mice. NCG mice were given sublethally irradiated, and the weight changes of mice were observed after the tail vein injection of normal saline, spleen cells and bone marrow cells of B6 mice, human CAR-T cells, and UCAR-T cells.

[0041] Fig.14 The efficacy evaluation of UCAR-T cells targeting IL-13Ra2 is shown. UCAR-T cells targeting IL-13Ra2 significantly inhibited the growth of mouse tumors. NCG mice were subcutaneously inoculated with U251-LAE, followed by tail vein CAR-T and UCAR-T cells, and the ability of each group of mice to clear tumor cells was observed.

[0042] Fig.15 The efficacy evaluation of UCAR-T cells targeting BCMA is shown. UCAR-T21 can alleviate the weight loss of mice.

[0043] Fig.16 The efficacy evaluation of UCAR-T cells targeting BCMA is shown. UCAR-T21 can significantly inhibit the proliferation of tumor cells in mice.

[0044] Fig.17 The efficacy evaluation of UCAR-T cells targeting BCMA is shown. UCAR-T21 can significantly inhibit the proliferation of tumor cells in mice.

[0045] Fig.18 The efficacy evaluation of UCAR-T cells targeting BCMA is shown. UCAR-T21 cells can significantly prolong the survival time of tumor-bearing mice. DETAILED DESCRIPTION

[0046] 1. Isolation and activation of T cells

[0047] After obtaining PBMC from healthy volunteers, they can be frozen and stored, and cells can be revived when preparing allogeneic CAR-T cells, and CD3 / CD28 magnetic beads can be used to separate and activate T cells. Freshly obtained PBMC can also be screened by magnetic beads to obtain unactivated T cells, which can be frozen and stored, and T cells can be revived when preparing allogeneic CAR-T cells, and CD3 / CD28 magnetic beads can be used to separate and activate T cells.

[0048] 2. Lentivirus infection

[0049] 0-3 days after T cell activation, lentivirus infection is performed to introduce specific genes into T cells by lentivirus infection, and cell culture is replaced 24 hours after lentivirus infection. The genes expressed by lentivirus include CAR molecules that recognize specific tumor antigens. The targets recognized by CAR molecules include but are not limited to CD19, BCMA, CD22, CD20, ROR1, Igκ, CD30, CD123, CD33, LeY, CD138, PSMA, mesothelin, FAP, EGFRvⅢ, CEA, CD171, GD2, GPC3, HER2, IL-13, FLT3, NKG2D, and IL-13Rα2.

[0050] The genes expressed by lentivirus can also include genes that affect T cell function (IL7, IL15, etc.), suicide switch genes that control T cell proliferation and survival (CD52, icaspase9, EGFR, etc.), and genes that affect the persistence of allogeneic CAR-T cells in vivo (CD47, cadherin, NKG2A, UL18, CD48, etc.).

[0051] The genes expressed by lentivirus can also include sgRNA targeting specific genes. The sgRNA is combined with the Cas9 protein introduced by other methods (electroporation or AAV) to edit the T cell genome and knock out specific genes in T cells. The knocked-out genes include genes related to T cell immune rejection (TRAC, TRBC, B2M, etc.) and genes affecting T cell function (PD1, TET2, HPK1, etc.).

[0052] 3. Gene Editing

[0053] The expression of TCR and HLA on the surface of T cells is knocked out by CRISPR / Cas9 gene editing, thereby solving the GVHD and HVGD reactions that may be produced by allogeneic CAR-T in patients. The knocked-out genes include TRAC, B2M, etc. The transduction of sgRNA can be done by electroporation (electroporation instruments include but are not limited to LONZA 4D-Nucleofector TMSystem, 4D-NucleofectorX Unit, 4D-Nucleofector LV Unit, MaxCyte GT, MaxCyte STX), lentivirus, adenovirus or adeno-associated virus. Cas9 transduction can be performed by adenovirus or adeno-associated virus to express Cas9 protein, electroporation of Cas9 protein or electroporation of Cas9 mRNA. In the non-viral transfection method, Cas9 mRNA is chemically synthesized or transcribed in vitro by RNA polymerase, and sgRNA is chemically synthesized or transcribed in vitro by RNA polymerase.

[0054] 4. Screening of sgRNA

[0055] The knockout efficiency of TRAC and B2M on the surface of T cells has a great influence on the production process of allogeneic CAR-T. The higher the knockout efficiency, the more target cells, and the fewer cells that need to be removed in the double-negative cell sorting step, the greater the production efficiency. In order to obtain sgRNA with higher knockout efficiency, we established a CRISPR / Cas9 screening and evaluation system. First, establish an sgRNA design method. The sgRNA design method can refer to the website: https: / / zlab.bio / guide-design-resources. You can also follow the steps below to find the CDS sequence (Coding sequence) of the target gene in the NCBI database, determine the exons of the gene translation, and then enter the CDS sequence into the website https: / / crispr.dbcls.jp / to obtain potential sgRNA sequences, and then preliminarily screen the potential sgRNA sequences. The screening principles include: 1. Exclude sgRNA sequences with a GC content of less than or equal to 40%, and preferably sgRNA sequences with a GC content of about 60%; 2. Exclude sgRNA sequences containing TTTT in the sequence; 3. The fewer potential off-target sites, the better. After preliminary screening, potential sgRNA sequences with higher cutting efficiency and lower off-target probability were obtained, and sgRNA was synthesized in vitro. Then, T cells were electroporated with RNP complexes. Five days after electroporation, the knockout efficiency of TCR (TRAC) and HLA (B2M) on the surface of T cells was detected by flow cytometry, and finally sgRNA sequences targeting the TRAC gene and sgRNA sequences targeting the B2M gene with high knockout efficiency were screened.

[0056] 5. Double negative cell sorting

[0057] After gene editing, CAR-T cells are cultured for 3-25 days. Cytokines that promote T cell proliferation (IL7, IL10, IL17, IL15, etc.) can be added during the culture process, and then double-negative cells are sorted. Double-negative cells refer to cells that do not express TRAC and B2M. Double-negative cells can be sorted by negative screening with immunomagnetic beads, using CD3 and / or B2M magnetic beads combined with cells that have not been knocked out to obtain high-purity and high-activity TCR (TRAC) negative or TRAC / B2M double-negative T cells. The sorted cells can be concentrated as the final product, sampled for quality inspection, and frozen. They can also continue to be cultured, concentrated after a certain number of cells are cultured, sampled for quality inspection, and the product is frozen.

[0058] The quality standards of allogeneic CAR-T products are similar to those of autologous CAR-T products, including: pH, osmotic pressure, identification, T cell purity, infection efficiency, cell viability, number of viable cells, CAR expression rate, dosage, IFN-γ secretion, sterility, mycoplasma, endotoxin and replicating lentivirus. Unlike autologous CAR-T products, allogeneic CAR-T products undergo gene editing and negative cell sorting. In the final product, the quality standards also include the proportion of TCR-negative cells and the proportion of HLA-negative cells. In the final product, TCR-positive cells will attack the normal cells of the subject and produce immune rejection. In the final product, HLA-positive cells will be cleared by the subject's immune system. The industry believes that the proportion of TCR-negative cells needs to be greater than 97%, at which time the reinfused product is considered safe and will not produce immune rejection. The proportion of HLA-negative cells mainly affects the active ingredients of the product. If the gene editing efficiency is high enough, negative cell sorting can be omitted.

[0059] At present, the industry generally uses the endpoint method to sort double-negative cells, that is, the gene-edited cells are sorted for TCR (TRAC) negative or TRAC / B2M double-negative T cells at the end of culture. At this time, the number of cells is large, and the difficulty and cost of sorting are high. Our research shows that sorting TCR (TRAC) negative or TRAC / B2M double-negative T cells during the culture process, when the number of cells is small, can effectively reduce the difficulty of sorting and reduce the cost of sorting. The sorted cells continue to be cultured, and the proportion of TCR (TRAC) negative or TRAC / B2M double-negative T cells will not decrease, which is consistent with the cell purity quality of the endpoint sorting method. The proportion of TCR negative cells and HLA negative cells are both greater than 97%.

[0060] 6. Expansion and cultivation of allogeneic CAR-T cells

[0061] Depending on the culture volume, culture the T cells before or after sorting in the corresponding WAVE Bioreactor system. The culture system is WAVE Bioreactor 2 / 10system, WAVE Bioreactor 20 / 50system, WAVE Bioreactor 200system, WAVE Bioreactor 500 / 1000system, etc. The culture system can also be B with RM 200Rocker or TideCell bioreactor. The culture system can also be Wilson Wolf Manufacturing's G-Rex gas permeable cell culture flask.

[0062] Example

[0063] Example 1: Design and screening of sgRNAs targeting TRAC and B2M

[0064] The knockout efficiency of TCR and HLA on the surface of T cells has a great influence on the production process of UCAR-T. The higher the knockout efficiency, the more target cells, and the fewer cells that need to be removed in the double-negative cell sorting step, the greater the production efficiency. In order to obtain sgRNA with higher knockout efficiency, we established a screening and evaluation system for CRISPR / Cas9 (evaluation criteria: the target gene can be knocked out by flow cytometry, the cell viability ≥70% 48 hours after electroporation, the negative cell ratio ≥10%, and the flow cytometric clustering is obvious). First, sgRNA is designed and screened. After preliminary screening, potential sgRNA sequences with higher cutting efficiency and lower off-target probability were obtained (sequence 1-sequence 21 targeting the B2M gene and sequence 22-sequence 41 targeting the TRAC gene), and GenScript Biotech Co., Ltd. was commissioned to synthesize sgRNA. Then the knockout efficiency of sgRNA was verified by electroporation of RNP complex. 96 hours after electroporation, the knockout efficiency was detected by flow cytometry. The antibodies for flow cytometry detection were APC-CD3 (Biolegend, 300439) and FITC-HLA-ABC (BD, 555552). Finally, the sgRNA sequences targeting the B2M gene with high knockout efficiency were screened (sgRNA-B2M 3, 6, 9, 12, 14, 15, 16, 18, 19, corresponding to sequences 3, 6, 9, 12, 14, 15, 16, 18, 19, respectively) ( Figure 2 ) and sgRNA sequences targeting the TRAC gene (sgRNA-TRAC 16, 20; corresponding to sequences 37, 41, respectively) ( Figure 1). sgRNA-TRAC16, sgRNA-TRAC20 were selected and cross-combined with sgRNA-B2M14, sgRNA-B2M18 for double gene knockout, and then cultured in a 37°C, CO2 cell culture incubator for 96 hours. The knockout efficiency was detected by flow cytometry to verify the effect of simultaneous double gene knockout on the knockout efficiency. The groups are as follows:

[0065] Group 1: sgRNA-B2M14+sgRNA-TRAC16;

[0066] Group 2: sgRNA-B2M18+sgRNA-TRAC16;

[0067] Group 3: sgRNA-B2M14+sgRNA-TRAC20;

[0068] Group 4: sgRNA-B2M18+sgRNA-TRAC20.

[0069] The experimental results are as follows Figure 3 As shown, all four sgRNA combinations can achieve high gene knockout efficiency, among which sgRNA-B2M18 and sgRNA-TRAC16 combinations can achieve the highest gene knockout efficiency.

[0070] Example 2: Optimization of electroporation conditions

[0071] The knockout efficiency of TCR and HLA on the surface of T cells is mainly affected by two factors, first, the sequence of sgRNA-TRAC and sgRNA-B2M, and second, the electroporation conditions (i.e., cell density and the amount of sgRNA / Cas9). The sequence screening of sgRNA-TRAC and sgRNA-B2M is shown in Example 1, and the optimization of electroporation conditions is performed using two sgRNAs, sgRNA-B2M18 and sgRNA-TRAC16.

[0072] The experimental groups are as follows:

[0073] Group 1 Group 2 Group 3 Group 4 Cell density (cells / mL) <![CDATA[5.0*10 7 ]]> <![CDATA[7.5*10 7 ]]> <![CDATA[10.0*10 7 ]]> <![CDATA[20.0*10 7 ]]>

[0074] RNP dosage: Cas9 (10 μg, i.e. 62.4 pmol), sgRNA1 (5 μg, i.e. 160 pmol), sgRNA2 (5 μg, i.e. 160 pmol).

[0075] Note: The electroporation volume is 100 μL.

[0076] See Example 5 for the specific experimental steps.

[0077] The experimental results are as follows Figure 4 As shown in Figure 2, all four groups can achieve high knockout efficiency, with the cell density ranging from 7.5 to 20.0*107 When the number of cells / mL was 100, the proportion of double-negative cells was >80%. Therefore, the electroporation conditions were determined as follows: (1) RNP dosage: Cas9 (10 μg), sgRNA1 (5 μg), sgRNA2 (5 μg), that is, the molar ratio was Cas9:sgRNA1:sgRNA2 = 0.39:1:1; (2) Cell density: 7.5-20.0*10 7 Pieces / mL.

[0078] Example 3: Cryopreserved PBMC recovery and T cell sorting and activation

[0079] Prepare physiological saline and 50mL centrifuge tubes for washing the resuscitated PBMCs. Take out the cells from the liquid nitrogen tank and gently shake them in a 37°C water bath until the frozen cells are liquid. Take out the resuscitated cells from the water bath, wipe them clean with paper, spray them with alcohol, wipe them clean, put them in the clean bench, add them to the prepared 40-45mL physiological saline, and centrifuge them at 400g for 5 minutes at room temperature. After centrifugation, discard the supernatant, add 40-45mL physiological saline, resuspend, and centrifuge them at 400g for 5 minutes at room temperature. After centrifugation, discard the supernatant, add 5-10mL X-VIVO (Lonza, 04-418Q) culture medium, take 10μL of cells to count the total cell number and cell viability, and estimate the number of T cells (the number of T cells is approximately the number of PBMCs × 50%). According to the estimated number of T cells, take the corresponding volume of CD3 / 28 magnetic beads (Thermo, 40203D) in a 15mL centrifuge tube, add 5mL X-VIVO medium, place on the magnetic rack for 2min, and aspirate X-VIVO. Add 3mL X-VIVO, place on the magnetic rack for 2min, and aspirate X-VIVO. Mix the PBMC suspension and add it to the 15mL centrifuge tube with magnetic beads. Wash the bottom of the tube with 1mL X-VIVO and add an appropriate amount of X-VIVO medium. Place the 15mL centrifuge tube on the Hula Mixer and mix for 30min. Then place the 15mL centrifuge tube on the magnetic rack for 5min. Aspirate the medium, resuspend the cells bound to the magnetic beads with an appropriate amount of X-VIVO medium containing IL2, and take 10μL to count the cell number and cell viability. Add an appropriate amount of X-VIVO medium containing IL2 to the cell culture flask, then add the cells bound to the magnetic beads, mix gently, and culture in a 5% CO2, 37°C cell culture incubator.

[0080] Example 4: Lentivirus infection of T cells

[0081] After T cells were cultured for 48 hours, a lentiviral vector carrying a CAR coding sequence (e.g., targeting CD19, IL-13Ra2, or BCMA) was added to the T cells at an MOI of 0.5, and then an appropriate amount of X-VIVO medium was added to a certain cell concentration, mixed gently, and cultured in a 5% CO2, 37°C cell culture incubator.

[0082] 24 hours after lentiviral infection, the cells were cultured in a fresh culture system containing 500 IU / mL IL-2 in X-VIVO medium.

[0083] After 96 hours of lentiviral infection, appropriate amount of cells were taken out and the expression level of CAR was detected by flow cytometry.

[0084] Example 5: Generation of double negative CAR-T cells

[0085] After the CAR-T cells prepared in Example 4 above were cultured for 72 hours, UCAR-T cells were prepared by electroporation of RNP complex (Cas9+sgRNA). TRAC and B2M genes were knocked out by electroporation of RNP complex (using sgRNA-TRAC16 and sgRNA-B2M18). X-VIVO+IL2 medium was preheated in a 37°C incubator. T cells were collected in a 15mL centrifuge tube, placed in a magnetic rack, placed for 5 minutes, and the supernatant was carefully drawn into a new centrifuge tube to remove the magnetic beads. Centrifuge at 100g for 10 minutes, resuspend the T cells in physiological saline, take 10μL of cell counts, take the corresponding number of T cells in a 15mL centrifuge tube according to the amount used, centrifuge at 100g for 10 minutes, and remove the supernatant. Cas9 protein (5μg) and related sgRNA (4μg) were mixed with electroporation buffer and allowed to stand at room temperature for 15 minutes. Resuspend T cells in electroporation buffer and transfer T cells (100 μL, 2.0E+07 cells) and RNP complex incubation solution to the LONZA 4D-Nucleofector TM System electroporation system, according to the system setting program EO148 to complete the electroporation. After the electroporation is completed, the cells are resuspended in preheated X-VIVO + IL2 medium and added to the cell culture flask pre-supplemented with X-VIVO + IL2 medium, gently mixed, and placed in a 5% CO2 37℃ incubator for culture. After 4 days of culture, the gene knockout efficiency is detected by flow cytometry, such as Figure 5 As shown in Figure 2, 83.55% of the cells are double negative cells, that is, the gene editing efficiency is 83.55%. The proportion of double negative cells was detected after sorting using a cell sorter, as shown in Figure 2. Figure 5 As shown, 99.31% of the cells were double-negative cells, with a high purity of target cells.

[0086] Example 6: Sorting and expansion of double negative CAR-T cells

[0087] Take a small amount of gene-edited cells, use flow cytometry to detect gene knockout efficiency and double-negative cell ratio, and calculate the number of double-negative cells in pre-isolated cells. The double-negative cell sorting method is as follows: After collecting the cells, resuspend them in PBS and adjust the cell concentration to 1×10 7 cells / 100 μL (1×10 8 / mL). The cells must be a single cell suspension. If necessary, use a vortex or pipette to blow the cells apart before continuing. Add CD3 and B2M positive selection antibodies (biotin-labeled). Vortex and mix 5 times. Incubate at room temperature for 10-20 minutes. Centrifuge at 300g for 5 minutes, remove the supernatant, wash the cells, and use X-VIVO to thoroughly resuspend the cells to their original volume. Add positive selection magnetic beads (avidin-labeled). Vortex and mix 5 times. Incubate at room temperature for 20 minutes. Transfer to the sorting bag of the cell sorter (CliniMACS Plus) and sort the cells according to the set program. The cells bound to the magnetic beads are discarded. Collect the cells that flow through the magnetic rack, that is, the target cells that do not express CD3 and HLA. Take a small amount of cells and use flow cytometry to detect the proportion of double-negative cells, and calculate the purity and sorting efficiency of double-negative cells.

[0088] Double negative cells can be sorted at the end of culture (D21), and the finished product can be prepared after sorting. Cell sorting can also be performed during the culture process (for example, D8-D21). After sorting, the cells continue to be cultured, and the finished product is collected and prepared at the end point (D21). When using the endpoint method for double negative cell sorting, we detected the changes in the proportion of double negative cells and the proportion of TCR (TRAC) and HLA (B2M) positive cells during the culture process. As shown in Table 1, during the cell culture process, the proportion of double negative cells gradually increased from 77.36% at D8 to 88.30% at D21, and the proportion of TCR (TRAC) positive cells and the proportion of HLA (B2M) positive cells gradually decreased during the culture process. After cell sorting at D8, the WAVE Bioreactor system was used to continue culture until D21, and the proportion of double negative cells was always greater than 97% (Table 2). The above conclusions prove the feasibility of negative cell sorting during culture. Because the proportion of TCR (TRAC) positive cells and HLA (B2M) positive cells tends to decrease during the culture process, that is, TCR (TRAC) negative cells and HLA (B2M) negative cells belong to the proliferation advantage group in the culture system, and their proportion will increase. Therefore, after negative cell sorting during the culture process, the proportion of remaining TCR (TRAC) positive cells and HLA (B2M) positive cells in the system will not increase, and will not cause the proportion of TCR (TRAC) negative cells and HLA (B2M) negative cells in the final product to be lower than 97%.

[0089] Table 1: Changes in the proportion of positive cells during unsorted cell culture

[0090] time TCR positive cell ratio (%) B2M positive cell ratio (%) D8 16.18 20.30 D10 15.96 19.69 D12 13.57 15.84 D14 12.30 14.92 D19 8.17 11.18 D21 7.70 10.05

[0091] Table 2: Changes in the proportion of double-negative cells during culture after cell sorting

[0092] time Double negative cell ratio (%) D8, after sorting 98.17 D10 97.79 D12 97.84 D14 97.94 D19 97.13 D21 98.00

[0093] Example 7: UCAR-T killing effect in vitro

[0094] CD19 positive K562 cells (K562-CD19) were prepared as follows. The lentiviral vector carrying the CD19 coding sequence was transfected into K562 cells at an MOI of 0.5. After 24 hours of lentiviral infection, the cells were replaced with medium and inoculated with 1640 medium containing 10% FBS for 4 days. The lentiviral infection efficiency (i.e., K562-CD19) was then detected by flow cytometry. + Cell ratio), and then multiple cell sorting was performed using a flow cytometry sorter. + When the cell ratio stabilizes to above 99.0%, the culture is expanded and then the cells are frozen for future use.

[0095] Take the target cells K562 (National Laboratory Cell Resource Sharing Platform, 3111C0001CCC000039), K562-CD19 and Daudi cells (National Laboratory Cell Resource Sharing Platform, 3111C0001CCC000134) cultured to the logarithmic growth phase, collect the cells by centrifugation at 400g for 5 minutes, and wash the target cells twice with saline. Resuspend the above cells with an appropriate amount of saline, add an appropriate amount of calcein-AM (invitrogen, C3100MP), mix gently, and then incubate in a 37°C water bath for 5 to 20 minutes. Wash the above cells twice with an appropriate amount of saline, and then resuspend the cells with culture medium. Count the cells, resuspend the cells to a certain cell density, and finally plate the target cells.

[0096] Take the cultured CAR-T or UCAR-T cells in Example 5, centrifuge at 400g for 5 minutes to collect the cells, resuspend the cells in an appropriate amount of culture medium and count them. Dilute the CAR-T or UCAR-T cells according to a certain ET ratio, and then add the diluted CAR-T or UCAR-T cells. Cell incubation: Gently mix the above cells and transfer them to a 37°C, 5% CO2 cell culture incubator for 4 to 8 hours. Result detection and calculation of killing efficiency:

[0097] Killing efficiency = [(CART-NC) / (PC-NC)] × 100%,

[0098] Wherein: CART represents the fluorescence value of the experimental group, NC represents the fluorescence value of the negative control group (target cells only), and PC represents the fluorescence value of the positive control group (i.e., target cells are completely lysed).

[0099] The results showed that TCR and HLA double-negative CAR-T cells have specific killing effect on CD19-positive target cells ( Figure 6 ), indicating that gene editing has no effect on the killing effect of CAR-T cells.

[0100] Example 8: Verification of the effect of PHA on double-negative UCAR-T cells

[0101] Phytohaemagglutinin (PHA) is a type of hemagglutinin found in plants, mostly in certain legumes. PHA is actually two closely related proteins, called leukocytic lectin (PHA-L) and erythrocery lectin (PHA-E). These proteins cause blood cells to clump together. PHA-E causes erythrocytes to agglutinate. PHA-L causes leukocytic lectins to agglutinate. Phytohaemagglutinin has multiple effects on cell metabolism; it induces mitosis and affects the transport and permeability of cell membranes to proteins. Phytohaemagglutinin can promote the transformation of lymphocytes into lymphoblasts, which then divide and proliferate, release lymphokines, and enhance the phagocytic function of macrophages. PHA acts on T cells through the CD3-TCR complex on the surface of T cells, activating T cells and inducing mitosis. When the CD3-TCR complex is not expressed on the surface of T cells, PHA cannot activate T cells. Therefore, we treated T cells or UCAR-T cells with PHA, and then detected the activation of T cells to reflect the knockout of CD3-TCR complex and the immune stimulation caused by UCAR-T. We treated T and UCAR-T cells with a certain concentration of PHA, respectively, in a cell culture incubator at 37°C and 5% CO2 for 24 to 96 hours, and then detected the expression of activation marker molecule CD25 by flow cytometry (PE Anti-human CD25, Biolegend, 356104). Figure 7 As shown, the experimental results showed that the expression of CD25 in double-negative T cells treated with PHA was the same as that in double-negative T cells not treated with PHA, and was significantly lower than that in the control T cell group.

[0102] Example 9: Alloreactivity

[0103] T cell receptors can recognize allogeneic MHC molecules. When mononuclear cells (PBMC) from two different individuals are mixed in vitro, they can stimulate each other and cause proliferation. The intensity of proliferation is proportional to the degree of difference in MHC between the two individuals. Therefore, the intensity of the allogeneic mixed lymphocyte reaction reflects the degree of difference in MHC between the two individuals, and because of mutual recognition and proliferation, the result is the sum of the proliferation capacity of lymphocytes from the two individuals. This test is a two-way mixed lymphocyte culture test. At the same time, when we irradiate the mononuclear cells of one party participating in the reaction with radionuclides, making them lose their ability to respond, but still retain their ability to stimulate and become stimulating cells, the reaction results at this time only reflect the proliferation capacity of the other party (the responding party). That is, a one-way mixed lymphocyte culture reaction. We used this method to detect the activation ability of UCAR-T cells after gene editing when they were co-cultured with allogeneic PBMC. By detecting the activation of T cells, the knockout of HLA and TCR and the immune stimulation caused by UCAR-T are reflected.

[0104] HLA(B2M) knockout validation

[0105] T cells and double-negative UCAR-T cells were irradiated and then co-cultured with allogeneic PBMCs (in a 37°C, 5% CO2 cell culture incubator for 24 to 96 hours), and then the expression of the activation marker CD25 on the surface of PBMCs was detected by flow cytometry. Figure 8 As shown in the figure, after co-incubation of irradiated double-negative T cells and allogeneic PBMCs, the activation of PBMCs was consistent with that of the control group (PBMCs only), and was significantly lower than that of the T cell group (HLA not knocked out), indicating that knocking out HLA (B2M) in double-negative T cells would not stimulate the activation of allogeneic PBMCs (Table 3).

[0106] TCR (TRAC) knockout validation

[0107] Allogeneic PBMCs were irradiated and then co-cultured with T cells and double-negative UCAR-T cells (in a 37°C, 5% CO2 cell culture incubator for 24 to 96 hours), and then the expression of CD25, an activation marker molecule on the surface of T or UCAR-T cells, was detected by flow cytometry. Fig. 9 As shown, after co-incubation of irradiated allogeneic PBMC and double-negative T cells, double-negative T cells could not be activated. In the control group, after co-incubation of irradiated allogeneic PBMC and T cells, T cell activation was significantly stimulated. This indicates that after knocking out TCR (TRAC) in double-negative T cells, allogeneic cells will not be recognized (Table 3).

[0108] The results of allogeneic reaction experiments showed that the knockout of TCR (TRAC) and HLA (B2M) could prevent double-negative T cells from being recognized and eliminated by the allogeneic immune system, and at the same time prevent double-negative T cells from causing immune rejection in patients.

[0109] Table 3: Allogeneic response-activation efficiency comparison

[0110]

[0111] Example 10: Evaluation of the efficacy of UCAR-T targeting CD19 (UCAR-T19)

[0112] The cells were derived from frozen volunteer PBMCs. After recovery, T cells were sorted using CD3 / CD28 magnetic beads and activated. After static culture, lentivirus expressing CAR (sequence 42) molecules targeting CD19 was introduced. After 3 days of culture, the magnetic beads were removed from the cells and LONZA 4D-Nucleofector was used. TMSystem electroporation system, RNP complex electroporation, introduction of Cas9 protein and sgRNA (sgRNA-TRAC16 and sgRNA-B2M18). After 3 days of culture, magnetic beads and CliniMACSPlus clinical-grade cell sorter were used for cell sorting. After sorting, 97% of the cells were double-negative T cells with a high purity of target cells. The sorted cells continued to be cultured, and UCAR-T cells were obtained after 14 days of culture. The cells were frozen.

[0113] NCG mice (Jicui Yaokang, catalog number T001475) were used to bear human acute B lymphoblastic leukemia cells Nalm-6 (ATCC, catalog number CRL-3273) tumors (1.0E+06 cells / mouse injected through the tail vein), and then injected with UCAR-T19 cells (5.0E+06 cells injected through the tail vein) and control CAR-T19 cells without gene knockout. The tumor inhibition effect and safety of UCAR-T19 cells and control CAR-T19 cells in tumor-bearing mice were compared. The experimental results are shown in Figure 2. Fig.10 As shown in the figure, compared with the vehicle control and T cell control groups, UCAR-T19 cells can significantly inhibit the proliferation of tumor cells in mice. At the same time, its tumor inhibition effect is better than that of the control CAR-T19 cells. Fig.11 The mouse survival time shown also indicates that UCAR-T19 cells can significantly prolong the survival time of tumor-bearing mice.

[0114] Example 11: Safety evaluation of UCAR-T

[0115] After we gave NCG mice sublethal irradiation, the negative control group was injected with normal saline, and the positive control group was injected with spleen and bone marrow cells of B6 mice (Vitamin E, catalog number 219), and the proliferation of peripheral blood mouse T cells was detected by flow cytometry; other test groups were injected with human CAR-T cells or UCAR-T cells (Example 10), and the proliferation of peripheral blood human T cells was detected by flow cytometry. The mice were weighed, clinically observed for GVHD symptoms and scored (see the table below for scoring criteria), and their survival was observed. This is to evaluate whether the UCAR-T cells after gene knockout will produce GVHD reactions in mice. The experimental results are as follows Fig.12 As shown in the figure, the GVHD score of the positive control group (bone marrow + spleen) increased significantly over time, indicating that the mice had a severe GVHD reaction. The GVHD score of the CAR-T cell group also began to increase from day 40, indicating that a GVHD reaction began to occur in the body. The UCAR-T cell group was similar to the negative control group, and no obvious GVHD reaction occurred in the later stage. Fig.13The weight changes of mice in each group are shown. The weight of the positive control group (bone marrow + spleen) decreased significantly after the GVHD reaction occurred. The weight of mice in the CAR-T cell group also decreased in the later stage. The UCAR-T cell group was similar to the negative control group, and no weight loss occurred. The above experimental results all show that UCAR-T cells after TRAC and B2M gene knockout can significantly avoid the occurrence of GVHD reaction. The results of this experiment preliminarily prove that the allogeneic reinfusion of UCAR-T cells is safe and will not produce GVHD reaction.

[0116] Table 4: GVHD scoring table

[0117]

[0118] Example 12: Evaluation of the therapeutic efficacy of UCAR-T cells targeting IL-13Ra2 (UCAR-T91).

[0119] In order to verify that our UCAR-T process can be applied to CAR-T cells with different targets as a platform technology, we constructed UCAR-T cells targeting IL-13Ra2 (the construction method is the same as in Example 10, sequence 43), and evaluated the efficacy of UCAR-T cells in a tumor-bearing mouse model. In NCG mice, 1.0E+06 U251-LAE cells overexpressing luciferase, P2A and EGFP constructed on the basis of U251 cells (National Laboratory Cell Resource Sharing Platform, catalog number 1101HUM-PUMC000058) were inoculated subcutaneously per mouse to establish a human glioblastoma mouse model, and then 5.0E+06 CAR-T or UCAR-T cells were injected into each mouse by tail vein injection. The mice were weighed, clinically observed, and the tumor growth was monitored by caliper measurement. The survival period was counted, the changes in CAR-T content in the blood were detected, and pathological examinations were performed on tumor tissues and important organs. Verify the in vivo efficacy and toxicity of CAR-T and UCAR-T (UCAR-T91). Fig.14 As shown in the figure, UCAR-T cells targeting IL-13Ra2 significantly inhibited the growth of mouse tumors, and its tumor suppression effect was similar to that of CAR-T cells, indicating that gene editing does not affect the efficacy of CAR-T cells.

[0120] Example 13: Evaluation of the efficacy of UCAR-T targeting BCMA (UCAR-T21)

[0121] In order to further verify that our UCAR-T is also applicable to the BCMA target, we prepared a UCAR-T targeting BCMA, namely UCAR-T21 (the construction method is the same as Example 10, sequence 44). We established a human multiple myeloma mouse model by inoculating 1.0E+06 NCI H929-LAE cells overexpressing luciferase, P2A and EGFP constructed on the basis of NCI H929 cells (National Laboratory Cell Resource Sharing Platform, catalog number 1101HUM-PUMC000360) per NCG mouse by tail vein injection. Then, 5.0E+06 T, CAR-T or UCAR-T21 cells were injected into each mouse by tail vein injection. Then, the tumor inhibition effect and safety of UCAR-T21 cells and CAR-T cells in tumor-bearing mice were compared. The experimental results are as follows Fig.15 As shown in the figure, after UCAR-T21 is given to tumor-bearing mice, it will recognize tumor cells, proliferate in the mice, and kill tumor cells, thereby alleviating the weight loss of mice caused by tumors. Fig.16 , 17 As shown, compared with the T cell control group, UCAR-T21 can significantly inhibit the proliferation of tumor cells in mice. Fig.18 The results also showed that UCAR-T21 cells could significantly prolong the survival time of tumor-bearing mice.

[0122] Appendix 1: sgRNA sequences.

[0123]

[0124]

[0125] Appendix 2: CAR coding sequence.

[0126] Sequence 42 (UCART19, coding sequence of CAR targeting CD19).

[0127] GACATCCAGATGACACAGACTACATCCTCCCTGTCTGCCTCTCTGGGAGACAGAGT

[0128] CACCATCAGTTGCAGGGCAAGTCAGGACATTAGTAAATATTTAAATTGGTATCAGC

[0129] AGAAACCAGATGGAACTGTTAAACTCCTGATCTACCATACATCAAGATTACACTCA

[0130] GGAGTCCCATCAAGGTTCAGTGGCAGTGGGTCTGGAACAGATTATTCTCTCACCAT

[0131] TAGCAACCTGGAGCAAGAAGATATTGCCACTTACTTTTGCCAACAGGGTAATACG

[0132] CTTCCGTACACGTTCGGAGGGGGGACTAAGTTGGAAATAACAGGCTCCACCTCTG

[0133] GATCCGGCAAGCCCGGATCTGGCGAGGGATCCACCAAGGGCGAGGTGAAACTGCA

[0134] GGAGTCAGGACCTGGCCTGGTGGCGCCCTCACAGAGCCTGTCCGTCACATGCACT

[0135] GTCTCAGGGGTCTCATTACCCGACTATGGTGTAAGCTGGATTCGCCAGCCTCCACG

[0136] AAAGGGTCTGGAGTGGCTGGGAGTAATATGGGGTAGTGAAACCACATACTATAAT

[0137] TCAGCTCTCAAATCCAGACTGACCATCATCAAGGACAACTCCAAGAGCCAAGTTTT

[0138] CTTAAAAATGAACAGTCTGCAAACTGATGACACAGCCATTTACTACTGTGCCAAAC

[0139] ATTATTACTACGGTGGTAGCTATGCTATGGACTACTGGGGTCAAGGAACCTCAGTC

[0140] ACCGTCTCCTCAACCACCACCCCAGCCCCCCGACCACCAACACCCGCCCCCACCAT

[0141] CGCCAGCCAGCCCCTGAGCCTGCGCCCCGAGGCCTGCCGCCCCGCCGCCGGCGGC

[0142] GCCGTGCACACCCGCGGCCTGGACTTCGCCTGCGACATCTACATCTGGGCCCCCCT

[0143] GGCCGGCACCTGCGGCGTGCTGCTGCTGAGCCTGGTGATCACCCTGTACTGCAAGC

[0144] GCGGCCGCAAGAAGCTGCTGTACATCTTCAAGCAGCCCTTCATGCGCCCCGTGCAG

[0145] ACCACCCAGGAGGAGGACGGCTGCAGCTGCCGCTTCCCCGAGGAGGAGGAGGGC

[0146] GGCTGCGAGCTGCGCGTGAAGTTCAGCCGCAGCGCCGACGCCCCCGCCTACAAGC

[0147] AGGGCCAGAACCAGCTGTACAACGAGCTGAACCTGGGCCGCCGCGAGGAGTACG

[0148] ACGTGCTGGACAAGCGCCGCGGCCGCGACCCCGAGATGGGCGGCAAGCCCCGCCG

[0149] CAAGAACCCCCAGGAGGGCCTGTACAACGAGCTGCAGAAGGACAAGATGGCCGA

[0150] GGCCTACAGCGAGATCGGCATGAAGGGCGAGCGCCGCCGCGGCAAGGGCCACGA

[0151] CGGCCTGTACCAGGGCCTGAGCACCGCCACCAAGGACACCTACGACGCCCTGCACATGCAGGCCCTGCCCCCCCGCTAA。

[0152] Sequence 43 (UCART91, coding sequence of the CAR targeting IL-13Ra2).

[0153] GACATCCAGATGACACAGAGCCCTAGCAGCCTGTCTGCCAGCGTGGGAGACAGAG

[0154] TGACCATCACATGCAAGGCCAGCCAGGATGTGGGAACAGCCGTGGCTTGGTATCA

[0155] GCAGAAGCCTGGCAAGGCCCCTAAGCTGCTGATCTACAGCGCCAGCTACAGATCC

[0156] ACAGGCGTGCCCAGCAGATTTTCTGGCAGCGGCTCTGGCACCGACTTCACCCTGAC

[0157] CATATCTAGCCTGCAGCCTGAGGACTTCGCCACCTACTACTGCCAGCACCACTACT

[0158] CTGCCCCTTGGACATTTGGCGGAGGCACCAAGGTGGAAATCAAGGGAAGCACGTC

[0159] CGGCTCAGGGAAGCCGGGCTCCGGCGAGGGAAGCACGAAGGGGGAGGTGCAGCT

[0160] GGTTGAATCTGGCGGAGGACTGGTTCAGCCTGGCGGATCTCTGAGACTGTCTTGTG

[0161] CCGCCAGCGGCTTCACCTTCAGCAGAAATGGCATGAGCTGGGTCCGACAGGCCCC

[0162] TGGCAAAGGACTTGAATGGGTCGCCACAGTGTCTAGCGGCGGCAGCTACATCTAC

[0163] TACGCCGACTCTGTGAAGGGCAGATTCACCATCTCCAGAGACAACGCCAAGAACA

[0164] GCCTGTACCTGCAGATGAACTCCCTGAGAGCCGAGGACACCGCCGTGTACTATTGT

[0165] GCCAGACAGGGCACAACAGCCCTGGCCACCAGATTCTTTGATGTGTGGGGCCAGG

[0166] GCACCCTGGTCACAGTTTCTTCTATTGAAGTTATGTATCCTCCTCCTTACCTAGACA

[0167] ATGAGAAGAGCAATGGAACCATTATCCATGTGAAAGGGAAACACCTTTGTCCAAG

[0168] TCCCCTATTTCCCGGACCTTCTAAGCCCTTTTGGGTGCTGGTGGTGGTTGGGGGAG

[0169] TCCTGGCTTGCTATAGCTTGCTAGTAACAGTGGCCTTTATTATTTTCTGGGTGAGGA

[0170] GTAAGAGGAGCAGGCTCCTGCACAGTGACTACATGAACATGACTCCCCGCCGCCC

[0171] CGGGCCCACCCGCAAGCATTACCAGCCCTATGCCCCACCACGCGACTTCGCAGCCT

[0172] ATCGCTCCAGAGTGAAGTTCAGCAGGAGCGCAGACGCCCCCGCGTACCAGCAGGG

[0173] CCAGAACCAGCTCTATAACGAGCTCAATCTAGGACGAAGAGAGGAGTACGATGTT

[0174] TTGGACAAGAGACGTGGCCGGGACCCTGAGATGGGGGGAAAGCCGAGAAGGAAG

[0175] AACCCTCAGGAAGGCCTGTACAATGAACTGCAGAAAGATAAGATGGCGGAGGCCT

[0176] ACAGTGAGATTGGGATGAAAGGCGAGCGCCGGAGGGGCAAGGGGCACGATGGCC

[0177] TTTACCAGGGTCTCAGTACAGCCACCAAGGACACCTACGACGCCCTTCACATGCAGGCCCTGCCCCCTCGCTAA。

[0178] Sequence 44 (encoding sequence of UCART21, a CAR targeting BCMA).

[0179] GACATTGTGCTCACTCAGTCACCTCCCAGCCTGGCCATGAGCCTGGGAAAAAGGG

[0180] CCACCATCTCCTGTAGAGCCAGTGAGTCCGTCACAATCTTGGGGAGCCATCTTATT

[0181] CACTGGTATCAGCAGAAGCCCGGGCAGCCTCCAACCCTTCTTATTCAGCTCGCGTC

[0182] AAACGTCCAGACGGGTGTACCTGCCAGATTTTCTGGTAGCGGGTCCCGCACTGATT

[0183] TTACACTGACCATAGATCCAGTGGAAGAAGACGATGTGGCCGTGTATTATTGTCTG

[0184] CAGAGCAGAACGATTCCTCGCACATTTGGTGGGGGTACTAAGCTGGAGATTAAGG

[0185] GAAGCACGTCCGGCTCAGGGAAGCCGGGCTCCGGCGAGGGAAGCACGAAGGGGC

[0186] AAATTCAGCTGGTCCAGAGCGGACCTGAGCTGAAAAAACCCGGCGAGACTGTTAA

[0187] GATCAGTTGTAAAGCATCTGGCTATACCTTCACCGACTACAGCATAAATTGGGTGA

[0188] AACGGGCCCCTGGAAAGGGCCTCAAATGGATGGGTTGGATCAATACCGAAACTAG

[0189] GGAGCCTGCTTATGCATATGACTTCCGCGGGAGATTCGCCTTTTCACTCGAGACAT

[0190] CTGCCTCTACTGCTTACCTCCAAATAAACAACCTCAAGTATGAAGATACAGCCACT

[0191] TACTTTTGCGCCCTCGACTATAGTTACGCCATGGACTACTGGGGACAGGGAACCTC

[0192] CGTTACCGTCAGTTCCACCACCACCCCAGCCCCCCGACCACCAACACCCGCCCCCA

[0193] CCATCGCCAGCCAGCCCCTGAGCCTGCGCCCCGAGGCCTGCCGCCCCGCCGCCGG

[0194] CGGCGCCGTGCACACCCGCGGCCTGGACTTCGCCTGCGACATCTACATCTGGGCCC

[0195] CCCTGGCCGGCACCTGCGGCGTGCTGCTGCTGAGCCTGGTGATCACCCTGTACTGC

[0196] AAGCGCGGCCGCAAGAAGCTGCTGTACATCTTCAAGCAGCCCTTCATGCGCCCCGT

[0197] GCAGACCACCCAGGAGGAGGACGGCTGCAGCTGCCGCTTCCCCGAGGAGGAGGA

[0198] GGGCGGCTGCGAGCTGCGCGTGAAGTTCAGCCGCAGCGCCGACGCCCCCGCCTAC

[0199] AAGCAGGGCCAGAACCAGCTGTACAACGAGCTGAACCTGGGCCGCCGCGAGGAG

[0200] TACGACGTGCTGGACAAGCGCCGCGGCCGCGACCCCGAGATGGGCGGCAAGCCCC

[0201] GCCGCAAGAACCCCCAGGAGGGCCTGTACAACGAGCTGCAGAAGGACAAGATGG

[0202] CCGAGGCCTACAGCGAGATCGGCATGAAGGGCGAGCGCCGCCGCGGCAAGGGCC

[0203] ACGACGGCCTGTACCAGGGCCTGAGCACCGCCACCAAGGACACCTACGACGCCCT

[0204] GCACATGCAGGCCCTGCCCCCCCGCTAA。

Claims

1. A sgRNA kit comprising: An sgRNA targeting the B2M gene whose nucleotide sequence is shown in SEQ ID NO: 14 and an sgRNA targeting the TRAC gene whose nucleotide sequence is shown in SEQ ID NO: 37; An sgRNA targeting the B2M gene whose nucleotide sequence is shown in SEQ ID NO: 14 and an sgRNA targeting the TRAC gene whose nucleotide sequence is shown in SEQ ID NO: 41; An sgRNA targeting the B2M gene whose nucleotide sequence is shown in SEQ ID NO: 18 and an sgRNA targeting the TRAC gene whose nucleotide sequence is shown in SEQ ID NO: 37; or The sgRNA targeting the B2M gene has a nucleotide sequence as shown in SEQ ID NO: 18 and the sgRNA targeting the TRAC gene has a nucleotide sequence as shown in SEQ ID NO:

41.

2. A method for generating TRAC / B2M double negative T cells, comprising: The T cells are treated with the sgRNA kit as described in claim 1, so that the B2M gene and the TRAC gene therein are knocked out.

3. The method of claim 2, wherein treating T cells with the sgRNA kit is performed by electroporating the Cas9 protein and the sgRNA kit via an RNP complex.

4. The method as claimed in claim 3, wherein in every 100 μL electroporation system, the amount of sgRNA is 2.5 to 9 μg of each, the amount of Cas9 protein is 5 to 10 μg, and the amount of T cells is 7.5E+06 to 2.0E+07.

5. The method of claim 4, wherein in every 100 μL electroporation system, the amount of sgRNA is 5 μg of each, the amount of Cas9 protein is 10 μg, and the amount of T cells is 7.5E+06, 1.0E+07 or 2.0E+07.

6. The method according to any one of claims 2 to 5, further comprising: After treating T cells with the sgRNA set, TRAC / B2M double negative cells were expanded after sorting TRAC / B2M double negative cells.

7. The method according to any one of claims 2 to 6, further comprising: Before treating T cells with the sgRNA set, T cells are treated with a nucleic acid encoding a CAR polypeptide so that the CAR polypeptide is expressed on the surface of the T cells.

8. The method according to any one of claims 2 to 6, further comprising: After the T cells are treated with the sgRNA set, the T cells are treated with a nucleic acid encoding a CAR polypeptide, so that the CAR polypeptide is expressed on the surface of the T cells.

9. The method of claim 7 or 8, wherein treatment of T cells with nucleic acid encoding a CAR polypeptide is performed by lentiviral infection.

10. The method of any one of claims 7-9 or 8, wherein the CAR targets CD19, IL-13Ra2, or BCMA; Preferably, the CAR targeting CD19 is encoded by sequence 42, the CAR targeting IL-13Ra2 is encoded by sequence 43, and the CAR targeting BCMA is encoded by sequence 44.

Images