Cloning and application of gene ZmPAB1 for regulating and controlling corn kernel size

Abstract

The invention belongs to the field of molecular biology, and particularly relates to a gene ZmPAB1 capable of regulating and controlling the size of a corn kernel as well as a mutant and application of the gene ZmPAB1. The invention specifically discloses application of a protein, a substance for regulating and controlling the expression of a coding gene of the protein or a substance for regulating and controlling the activity or content of the protein in regulating and controlling the size of a plant seed and / or preparing a product for regulating and controlling the size of the plant seed and / or plant breeding and / or preparing a plant breeding product. The protein is a protein as shown in SEQ ID NO.3 or SEQ ID NO.6 in a sequence table. It is found that the corn ZmPAB1 gene can regulate and control the size of corn kernels, specifically, a ZmPAB1 gene mutant is prepared, and the mutant shows that the length, the width, the thickness and the hundred-kernel weight of the kernels are all obviously reduced. The invention not only provides a theoretical basis for analyzing the development mechanism of the grains, but also plays an important role in corn grain size variety improvement and biological breeding.

Description

Technical Field

[0001] The invention belongs to the field of molecular biology and relates to the cloning and application of a corn kernel size gene ZmPAB1. Background Art

[0002] As an important food, feed and industrial raw material, corn (Zea mays) plays a vital role in ensuring national food security. Corn grain yield is the first goal of corn breeding. Grain yield is a multi-factor trait, among which the number of grains and 100-grain weight are important components of single-plant yield, and the 100-grain weight mainly depends on the grain size and grain bulk density. Grain size mainly includes grain length, grain width, and grain thickness. Many studies have shown that these three traits are synergistically regulated by multiple biological processes and directly affect corn grain yield. Therefore, studying the genetic basis of corn grain size will accelerate the breeding process for increasing corn yield.

[0003] The dry matter accumulation of corn kernels is a continuous biological process involving a series of complex physiological and biochemical processes, which can be divided into three stages. The first stage is 0-15 days after pollination, which is the storage capacity construction period. During this stage, the embryo and endosperm cells divide rapidly, which determines the size of the "sink" in the biological sense; the second stage is about 15-40 days after pollination, which is the rapid filling period, forming 90% of the dry matter accumulation in the kernels, which is the main determining period of kernel weight; the third stage is about 40-70 days after pollination, which is the dehydration and maturity period, and the kernels begin to dehydrate and mature rapidly. The first two stages together determine the size and weight of the kernels, which is an important period for determining kernel yield. Kernel development is a complex and finely regulated process, which not only involves cell proliferation and expansion processes, including material accumulation, transportation, distribution and storage, but also involves many molecular biological processes, including transcriptional regulation, epigenetic modification, etc.

[0004] In recent years, a large number of researchers have successfully cloned many genes related to corn kernel size through different methods. For example, the corn kernel mutant defective kernel 2 (dek2) is a small kernel mutant that affects kernel development by affecting the splicing of mitochondrial nad1 intron 1. Defective kernel 10 (dek10) encodes a group E PPR protein localized in mitochondria, which is essential for the site editing of nad3 and cox2. The dek10 mutant also exhibits a small kernel phenotype. Defective kernel 35 (dek35) is similar to dek2 and also encodes a P-type PPR protein localized in mitochondria. The dek35 mutant affects the cis splicing of mitochondrial nad4 intron 1, exhibiting a small kernel phenotype.

[0005] The genetic regulation of corn kernel size has a very complex mechanism network. Research on the genetic basis of corn kernel size can provide a basis for molecular marker-assisted breeding and germplasm resource improvement of high-yield corn. Corn kernel size directly affects corn yield. Elucidating the genetic basis of corn kernel size and discovering new genes related to corn yield will help understand the genetic regulation mechanism of corn kernel development and provide genetic resources and theoretical basis for improving corn yield. Summary of the invention

[0006] The purpose of the present invention is to provide a gene ZmPAB1 capable of regulating corn kernel size and its mutants and applications, which not only provide a theoretical basis for analyzing the development mechanism of kernels, but also play an important role in corn kernel size variety improvement and biological breeding.

[0007] The present invention firstly protects the application of ZmPAB1 protein, which can be divided into S1) or S2):

[0008] S1) Regulates plant seed size;

[0009] S2) Cultivating transgenic plants with altered grain size.

[0010] In the above application, the ZmPAB1 protein is derived from Zea mays L. of the genus Zea and is the following a1) or a2) or a3):

[0011] a1) the amino acid sequence is the protein shown in SEQ ID NO.3 or SEQ ID NO.6;

[0012] a2) a fusion protein obtained by connecting a tag to the N-terminus or / and the C-terminus of the protein shown in SEQ ID NO.3 or SEQ ID NO.6;

[0013] a3) A protein associated with plant seed size obtained by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in SEQ ID NO.3 or SEQ ID NO.6.

[0014] Among them, SEQ ID NO.3 consists of 654 amino acid residues, and SEQ ID NO.6 consists of 656 amino acid residues.

[0015] In order to facilitate the purification of the protein in a1), a tag as shown in Table 1 may be connected to the amino terminus or carboxyl terminus of the protein shown in SEQ ID NO. 3 or SEQ ID NO. 6.

[0016] Table 1. Sequences of tags

[0017] Label Residue sequence Poly-Arg 5-6 (usually 5) RRRRR FLAG 8 DYKDDDDK Strep-tag II 8 WSHQ c-myc 10 EQKLISEEDL

[0018] In the protein described in a3) above, the substitution and / or deletion and / or addition of one or several amino acid residues is a substitution and / or deletion and / or addition of no more than 10 amino acid residues.

[0019] The protein in a3) above can be artificially synthesized, or its encoding gene can be synthesized first and then expressed biologically.

[0020] The coding gene of the protein in a3) above can be obtained by deleting one or several codons of amino acid residues in the DNA sequence shown in SEQ ID NO.2 or SEQ ID NO.5, and / or performing missense mutation of one or several base pairs, and / or connecting the coding sequence of the tag shown in Table 1 to its 5′ end and / or 3′ end.

[0021] The present invention also protects the use of nucleic acid molecules encoding the ZmPAB1 protein, which can be S1) or S2):

[0022] S1) Regulates plant seed size;

[0023] S2) Cultivating transgenic plants with altered grain size.

[0024] In the above application, the nucleic acid molecule encoding the ZmPAB1 protein may be a DNA molecule as shown in b1) or b2) or b3) or b4) or b5) below:

[0025] b1) the coding region is a DNA molecule shown in SEQ ID NO.2 or SEQ ID NO.5;

[0026] b2) the nucleotide sequence is a DNA molecule shown in SEQ ID NO.2 or SEQ ID NO.5;

[0027] b3) the nucleotide sequence is a DNA molecule shown in SEQ ID NO.1 or SEQ ID NO.4;

[0028] b4) a DNA molecule that has 75% or more identity with the nucleotide sequence defined in b1) or b2) or b3) and encodes the ZmPAB1 protein;

[0029] b5) A DNA molecule that hybridizes with the nucleotide sequence defined in b1) or b2) or b3) under stringent conditions and encodes the ZmPAB1 protein.

[0030] The nucleic acid molecule may be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule may also be RNA, such as mRNA or hnRNA.

[0031] Among them, SEQ ID NO.2 consists of 1965 nucleotides, and the nucleotides of SEQ ID NO.2 encode the amino acid sequence shown in SEQ ID NO.3; SEQ ID NO.5 consists of 1971 nucleotides, and the nucleotides of SEQ ID NO.5 encode the amino acid sequence shown in SEQ ID NO.6.

[0032] Those skilled in the art can easily mutate the nucleotide sequence encoding the ZmPAB1 protein of the present invention by using known methods, such as directed evolution and point mutation. Those artificially modified nucleotides having 75% or higher identity with the nucleotide sequence of the ZmPAB1 protein isolated from the present invention are derived from the nucleotide sequence of the present invention and are equivalent to the sequence of the present invention as long as they encode the ZmPAB1 protein.

[0033] The term "identity" as used herein refers to sequence similarity with a natural nucleic acid sequence. "Identity" includes nucleotide sequences that have 75% or more, or 80% or more, or 85% or more, or 90% or more, or 95% or more identity with the nucleotide sequence of the ZmPAB1 protein of the present invention encoding the amino acid sequence shown in SEQ ID NO.3 or SEQ ID NO.6. Identity can be evaluated by the naked eye or by computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0034] In any of the above applications, regulating the plant grain size may be increasing the grain size or decreasing the grain size.

[0035] In any of the above applications, the cultivation of transgenic plants with altered grain size may be cultivation of transgenic plants with increased grain size or cultivation of transgenic plants with reduced grain size.

[0036] The present invention also protects a method for cultivating transgenic plants, which may include the following steps: reducing the expression level and / or activity of the ZmPAB1 protein in the starting plant to obtain a transgenic plant; compared with the starting plant, the grain size of the transgenic plant becomes smaller.

[0037] In the above method, the "reducing the expression level and / or activity of the ZmPAB1 protein in the starting plant" can be achieved by methods well known in the art such as RNA interference, homologous recombination, and site-directed gene editing to reduce the expression level and / or activity of the ZmPAB1 protein in the starting plant.

[0038] In the above method, the “reducing the expression level and / or activity of the ZmPAB1 protein in the starting plant” can be specifically achieved by introducing a plant genome editing vector into the starting plant;

[0039] The plant genome editing vector contains a sgRNA encoding gene;

[0040] The target DNA recognized by the sgRNA in the plant is a DNA fragment encoding the ZmPAB1 protein.

[0041] In the above method, the plant genome editing vector may also contain a gene encoding the Cas9 protein. BRIEF DESCRIPTION OF THE DRAWINGS

[0042] Figure 1 The phylogenetic tree, sequence alignment, domain structure and expression pattern analysis of ZmPAB1. A is the phylogenetic tree analysis of PAB1 protein in plants. Maize (Zm; Zea mays); Arabidopsis thaliana (At; Arabidopsis thaliana); Rice (Os; Oryza sativa); Sorghum bicolor (Sb; Sorghum bicolor); Millet (Si; Setaria italica); Brachypodium distachyon (Bd; Brachypodium distachyon); Poplar (Pt; Populus trichocarpa). B is the sequence homology comparison of ZmPAB1A / 1B proteins. C is the domain structure analysis of ZmPAB1A / 1B. D is the expression analysis of ZmPAB1A / 1B in different tissues of maize.

[0043] Figure 2 Schematic diagram of the mutation sites of ZmPAB1A and ZmPAB1B in the maize mutant zmpab1.

[0044] Figure 3The phenotype comparison diagram of the maize mutant zmpab1 and the wild type. Among them, A is the phenotype of the self-pollinated mature ear of zmpab1 (genotype aaBb). The red arrow indicates the zmpab1 mutant grain, Bar = 1 cm. B is the wild type (WT) and mutant (zmpab1) grain length phenotype from the same F2 separated ear. Bar = 1 cm. C is the wild type (WT) and mutant (zmpab1) grain width phenotype from the same F2 separated ear. Bar = 1 cm. D is the wild type (WT) and mutant (zmpab1) grain thickness phenotype from the same F2 separated ear. Bar = 1 cm. E is the statistics of the mature grain length of the wild type (WT) and mutant (zmpab1) on the same F2 separated ear randomly selected. The results are from three biological replicates. The significance analysis was performed using Student's t test; *, P﹤0.05. F is the statistics of the width of mature grains of the wild type (WT) and mutant (zmpab1) randomly selected from the same F2 separated fruit ear. The results are from three biological replicates. The significance analysis was performed using Student's t test; *, P﹤0.05. G is the statistics of the thickness of mature grains of the wild type (WT) and mutant (zmpab1) randomly selected from the same F2 separated fruit ear. The results are from three biological replicates. The significance analysis was performed using Student's t test; *, P﹤0.05. H is the statistics of the 100-grain weight of mature grains of the wild type (WT) and mutant (zmpab1) randomly selected from the same F2 separated fruit ear. The results are from three biological replicates. The significance analysis was performed using Student's t test; ***, P﹤0.001. DETAILED DESCRIPTION

[0045] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0046] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0047] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0048] The maize mutant zmpab1 was collected and stored in our laboratory. The maize genome sequencing information is referenced to the MaizeGDB database, the link of which is as follows: http: / / www.maizegdb.org / .

[0049] Example 1: Homologous alignment and conserved domain analysis of gene ZmPAB1

[0050] The complete amino acid sequence encoded by the maize ZmPAB1 gene was retrieved from the maize genome annotation database MaizeGDB (https: / / www.maizegdb.org / ), and phylogenetic tree analysis was performed with the amino acid sequences of this gene family in Arabidopsis, rice, and sorghum using MEGA software. It was found that ZmPAB1 has two copies in maize, namely ZmPAB1A and ZmPAB1B ( Figure 1 A). ZmPAB1A and ZmPAB1B sequences are highly similar, with 98% homology ( Figure 1 B). Protein domain analysis using SMART software (http: / / smart.embl-heidelberg.de / ) showed that both ZmPAB1A and ZmPAB1B have a conserved poly(A) binding protein domain at the C-terminus and four RNA binding domains ( Figure 1 C). From Yi et al. (2019)( https: / / academic.oup.com / plcell / article / 31 / 5 / 974 / 5985622?login=false ) The expression data of ZmPAB1A and ZmPAB1B in root, stem, leaf, female ear, male ear, embryo and endosperm tissues were extracted from the appendix of the article. The analysis results showed that ZmPAB1A and ZmPAB1B were expressed in most tissues, and the expression level of ZmPAB1A was higher than that of ZmPAB1B in most tissues ( Figure 1 D).

[0051] Example 2: Construction of mutant material of gene ZmPAB1

[0052] 1. From the maize EMS-induced mutant library (MEMD: http: / / maizeems.qlnu.edu.cn / ), one EMS mutant of gene Zm00001d005276 (ZmPAB1A) and one EMS mutant of gene Zm00001d019824 (ZmPAB1B) with B73 as background were obtained, namely EMS4-1eb4b2 and EMS4-146428, which are sold by the mutant library MEMD and are available to the public. From the MEMD website, it can be seen that the two homologous chromosomes of the EMS mutant EMS4-1eb4b2 of ZmPAB1A have the following mutations: the 4468th base C of sequence 1 (SEQ ID No.1) mutated to T, causing the translation of the encoded protein to terminate prematurely, resulting in the loss of function of the gene, and the sequencing results were consistent with the description. The EMS mutant EMS4-1eb4b2 of ZmPAB1A has three genotypes. The genotype of the 4468th base of sequence 1 (SEQ ID No.1) of both homologous chromosomes is C is defined as AA, the genotype of the 4468th base of sequence 1 (SEQ ID No.1) of both homologous chromosomes is T is defined as aa, and the genotype of the 4468th base of sequence 1 (SEQ ID No.1) of both homologous chromosomes is C and T is defined as Aa. The EMS mutant EMS4-146428 of ZmPAB1B has the following mutations on both homologous chromosomes: the 2337th base of sequence 4 (SEQ ID No.4) is mutated from C to T, causing the translation of the encoded protein to terminate prematurely, resulting in loss of function of the gene. The sequencing results are consistent with the description. The EMS mutant EMS4-146428 of ZmPAB1B has three genotypes. The genotype in which the 2337th base of sequence 4 (SEQ ID No.4) of both homologous chromosomes is C is defined as BB, the genotype in which the 2337th base of sequence 4 (SEQ ID No.4) of both homologous chromosomes is T is defined as bb, and the genotype in which the 2337th base of sequence 4 (SEQ ID No.4) of both homologous chromosomes is C and T respectively is defined as Bb.

[0053] ZmPAB1A sequencing primers:

[0054] ZmPAB1A-EMS-1F:GGTCCATATTAATGCCATTG

[0055] ZmPAB1A-EMS-1R:GGTCCATATTAATGCCATTG

[0056] ZmPAB1B sequencing primers:

[0057] ZmPAB1B-EMS-1F:ACAATATCAAATTCAGTAATGTG

[0058] ZmPAB1B-EMS-1R:CCACAACTACAAAACATCCC

[0059] 2. The wild-type B73 material was used as the recurrent parent, and EMS4-1eb4b2 and EMS4-146428 obtained from the maize EMS-induced mutant library were used as donor parents. During the pollination period, the male tassel pollen of the B73 material was taken to pollinate the female ears of EMS4-1eb4b2 and EMS4-146428, respectively, to obtain the F1 materials of ZmPAB1A and ZmPAB1B, respectively; then the F1 materials of ZmPAB1A and ZmPAB1B were sown, and during the pollination period, the male tassel pollen of the B73 material was taken to pollinate the female ears of the F1 materials of ZmPAB1A and ZmPAB1B, respectively, to obtain BC1F1 materials; in this way, backcrossing and self-pollination with the B73 material were performed repeatedly to obtain BC3F2 generation seeds. Then the homozygous mutant material zmpab1a (genotype aaBB) of ZmPAB1A and the homozygous mutant material zmpab1b (genotype AAbb) of ZmPAB1B were hybridized to obtain the material with the genotype AaBb. The material with the genotype AaBb was then self-pollinated, and the offspring with the genotype Aabb or aaBb were screened and used for subsequent experiments.

[0060] Example 3: Functional verification of gene ZmPAB1

[0061] Compared with normal corn kernels, the kernel length, kernel width, and kernel thickness of the corn mutant zmpab1 (genotype aabb) were significantly reduced ( Figure 3 A to 3G), and the 100-grain weight was only 68% of that of the wild type ( Figure 3 H). The phenotype of this phenomenon was consistent in Beijing and Hainan for three consecutive years, and the characteristic of grain size reduction was stable, indicating that the gene ZmPAB1 is involved in regulating the development of corn grain size.

[0062] Based on the research results of the above embodiments, it can be seen that the ZmPAB1 gene in the present invention is a gene that controls the size of corn kernels. Its mutation can cause the corn kernels to become smaller, and can be used in the corn seed production process.

Claims

1. Application of ZmPAB1 protein, S1) or S2): S1) Regulates plant seed size; S2) Cultivating transgenic plants with altered grain size.

2. The use according to claim 1, characterized in that: The ZmPAB1 protein is a1) or a2) or a3): a1) the amino acid sequence is the protein shown in SEQ ID NO.3 or SEQ ID NO.6; a2) a fusion protein obtained by connecting a tag to the N-terminus or / and the C-terminus of the protein shown in SEQ ID NO.3 or SEQ ID NO.6; a3) A protein associated with grain size obtained by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in SEQ ID NO.3 or SEQ ID NO.

6.

3. Use of a nucleic acid molecule encoding the ZmPAB1 protein according to claim 1 or 2, which is S1) or S2): S1) Regulates plant seed size; S2) Cultivating transgenic plants with altered grain size.

4. The use according to claim 3, characterized in that: The nucleic acid molecule encoding the ZmPAB1 protein is a DNA molecule as shown in the following b1) or b2) or b3) or b4) or b5): b1) the coding region is a DNA molecule shown in SEQ ID NO.2 or SEQ ID NO.5; b2) the nucleotide sequence is a DNA molecule shown in SEQ ID NO.2 or SEQ ID NO.5; b3) the nucleotide sequence is a DNA molecule shown in SEQ ID NO.1 or SEQ ID NO.4; b4) a DNA molecule having 75% or more identity with the nucleotide sequence defined in b1) or b2) or b3) and encoding the ZmPAB1 protein of claim 1 or 2; b5) A DNA molecule which hybridizes with the nucleotide sequence defined in b1) or b2) or b3) under stringent conditions and encodes the ZmPAB1 protein of claim 1 or 2.

5. The use according to any one of claims 1 to 4, characterized in that: The regulating plant grain size may be increasing the grain size or decreasing the grain size; The cultivating of transgenic plants with altered grain size can be cultivating transgenic plants with increased grain size or cultivating transgenic plants with reduced grain size.

6. A method for cultivating transgenic plants, comprising the following steps: reducing the expression level and / or activity of the ZmPAB1 protein of claim 1 or 2 in a starting plant to obtain a transgenic plant; compared with the starting plant, the grain size of the transgenic plant becomes smaller.

7. A plant breeding method, comprising the following steps: reducing the expression level and / or activity of the ZmPAB1 protein of claim 1 or 2 in a starting plant, thereby reducing the grain size.

8. The use according to any one of claims 1 to 5 or the method according to any one of claim 6, characterized in that: The plant is any one of the following c1) to c6): c1) dicotyledonous plant; c2) monocotyledonous plant; c3) grass plant; c4) corn; c5) corn B104; c6) corn variety B73.

Images