Zmmettl3 gene and related biological material in regulating plant drought resistance

By knocking out the ZmMETTL3 gene in maize using CRISPR/Cas9 technology, a mutant was obtained, which solved the problem of reduced maize yield under drought stress and improved maize drought resistance.

CN119320795BActive Publication Date: 2026-01-13SICHUAN AGRI UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202411766848.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-12-04
Publication Date
2026-01-13
Estimated Expiration
2044-12-04

AI Technical Summary

Technical Problem

In existing technologies, maize yields decrease under drought stress, and there is a lack of effective drought-resistant gene resources, which affects the improvement of maize yield.

Method used

By knocking out the ZmMETTL3 gene in maize using CRISPR/Cas9 gene editing technology, a ZmMETTL3 gene knockout mutant was obtained, which enhanced the drought resistance of maize.

Benefits of technology

The ZmMETTL3 gene knockout mutant exhibited superior drought resistance under drought stress, with significantly higher single ear weight and grain weight than the wild type, thus improving the drought resistance of maize.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119320795B_ABST
    Figure CN119320795B_ABST
Patent Text Reader

Abstract

The application discloses application of a ZmMETTL3 gene and related biological materials thereof in regulation and control of drought resistance of plants and belongs to the technical field of genetic engineering. The application finds that the ZmMETTL3 gene can negatively regulate drought resistance of corn plants, and the drought resistance of the corn plants can be enhanced after the ZmMETTL3 gene is knocked out. The application also uses CRISPR / Cas9 gene editing technology to knock out the gene, and three ZmMETTL3 gene knockout mutants are obtained, which provides an epigenetic gene resource for improvement of drought resistance of corn and provides a new biological resource for breeding of new corn varieties with drought resistance.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, and in particular to the application of the ZmMETTL3 gene and related biomaterials in regulating plant drought resistance. Background Technology

[0002] Maize is an important food crop, as well as a vital economic, feed, and energy crop. However, due to uneven terrain and rainfall in my country, maize often suffers from various abiotic stresses during its growth and development, leading to a significant decline in yield. Among these abiotic stresses, drought stress has become one of the key factors restricting maize yield increases. Therefore, identifying drought-resistant genes in maize and breeding new drought-resistant and high-yielding maize varieties is of great significance for ensuring food security.

[0003] N6-methyladenosine (m 6 A) refers to the modification of RNA molecules by adding a methyl group to the N element at the sixth position of the A base. This modification plays a crucial role in regulating the diversity of genetic information in eukaryotes. Studies have shown that m 6 Modification of A can affect plant embryo development, leaf and floral organ growth, as well as apical dominance and callus differentiation. It also participates in processes such as fruit ripening and plant response to abiotic stress.

[0004] m in RNA 6 A-modification is typically a dynamic and reversible process, primarily regulated by three types of proteins: methyltransferases (writers), demethyltransferases (erasers), and methyl recognition proteins (readers). Methyltransferases can add the methyl group (CH3) of S-adenosylmethionine (SAM) to the 6th nitrogen atom of RNA adenine nucleotide, while demethyltransferases can reduce the methyl group (CH3) on RNA to a hydrogen atom. 6 A-methyltransferases are considered a class of large molecular complexes composed of multiple proteins and were isolated and purified from human HeLa cells in 1994. In subsequent studies, researchers used various methods to isolate MT-A and MT-B, with MT-A having a molecular weight of approximately 200 kDa and capable of binding SAM. In recent years, with the continuous development of molecular biology techniques, methyltransferases (MT-A) have been increasingly observed in animals. 6Other components of the RNA methyltransferase complex have been identified, such as METTL3, METTL14, and WTAP. METTL3's functional protein is MT-A, which binds to SAM and catalyzes RNA methylation; it is a core component of RNA methyltransferases. METTL14 is highly homologous to METTL3, and its functional protein is MT-B, which forms a stable heterodimer with MT-A through hydrogen bonding, increasing the catalytic activity of MT-A. Unlike METTL3 and METTL14, WTAP does not directly participate in catalysis, but it helps the METTL3 / METTL14 complex to localize to nuclear plaques, thereby regulating RNA methylation. 6 A. Methylation process.

[0005] Research on RNA methyltransferases in plants has only gradually emerged in the last decade, and studies on their functional role in crop responses to abiotic stress are scarce. Therefore, research on the involvement of RNA methyltransferase-related genes in drought stress responses in maize is of great significance for improving drought-resistant maize germplasm resources. Summary of the Invention

[0006] The purpose of this invention is to provide the application of the ZmMETTL3 gene and related biological materials in regulating plant drought resistance, thereby addressing the problems existing in the prior art. This invention has found that the ZmMETTL3 gene negatively regulates the drought resistance of maize plants, and knocking out the ZmMETTL3 gene enhances the drought resistance of maize plants. This invention also utilizes CRISPR / Cas9 gene editing technology to knock out this gene, obtaining three ZmMETTL3 gene knockout mutants, providing an epigenetic resource for improving the drought resistance of maize and offering new biological resources for breeding new drought-resistant maize varieties.

[0007] To achieve the above objectives, the present invention provides the following solution:

[0008] This invention provides the application of the ZmMETTL3 gene or related biological materials in regulating plant drought resistance, wherein the Gramene ID of the ZmMETTL3 gene is Zm00001d017566; the regulation refers to the enhancement of plant drought resistance by knocking out or inhibiting the ZmMETTL3 gene.

[0009] Optionally, the relevant biomaterials include any one of the following:

[0010] A1. An expression cassette that knocks out or inhibits the ZmMETTL3 gene;

[0011] A2. Recombinant vectors that knock out or inhibit the ZmMETTL3 gene;

[0012] A3. Recombinant microorganisms that knock out or inhibit the ZmMETTL3 gene;

[0013] The A4.ZmMETTL3 gene knockout mutant has the nucleotide sequence shown in any one of SEQ ID NO.4-6;

[0014] The plant mentioned includes corn.

[0015] The present invention also provides the application of the ZmMETTL3 gene or related biological materials in the cultivation of plant varieties with high drought resistance, wherein the Gramene ID of the ZmMETTL3 gene is Zm00001d017566.

[0016] Optionally, the relevant biomaterials include any one of the following:

[0017] A1. An expression cassette that knocks out or inhibits the ZmMETTL3 gene;

[0018] A2. Recombinant vectors that knock out or inhibit the ZmMETTL3 gene;

[0019] A3. Recombinant microorganisms that knock out or inhibit the ZmMETTL3 gene;

[0020] The A4.ZmMETTL3 gene knockout mutant has the nucleotide sequence shown in any one of SEQ ID NO.4-6;

[0021] The plant mentioned includes corn.

[0022] The present invention also provides the application of the ZmMETTL3 gene or related biological materials in the early identification of plant varieties with high drought resistance, wherein the Gramene ID of the ZmMETTL3 gene is Zm00001d017566.

[0023] Optionally, the relevant biomaterials include any one of the following:

[0024] A1. An expression cassette that knocks out or inhibits the ZmMETTL3 gene;

[0025] A2. Recombinant vectors that knock out or inhibit the ZmMETTL3 gene;

[0026] A3. Recombinant microorganisms that knock out or inhibit the ZmMETTL3 gene;

[0027] The A4.ZmMETTL3 gene knockout mutant has the nucleotide sequence shown in any one of SEQ ID NO.4-6;

[0028] The plant mentioned includes corn.

[0029] The present invention also provides a method for enhancing plant drought resistance, including the steps of knocking out the ZmMETTL3 gene in the plant and constructing a ZmMETTL3 gene knockout mutant plant to enhance plant drought resistance.

[0030] The Gramene ID of the ZmMETTL3 gene is Zm00001d017566; the plant includes maize.

[0031] The present invention also provides a ZmMETTL3 gene knockout mutant, the nucleotide sequence of which is shown in any one of SEQ ID NO.4-6.

[0032] The present invention also provides a method for constructing the above-mentioned ZmMETTL3 gene knockout mutant, comprising the steps of constructing a CRISPR / Cas9 knockout vector with the sequence shown in SEQ ID NO.1 as the target, knocking out the ZmMETTL3 gene in the plant through genetic transformation technology, and obtaining the ZmMETTL3 gene knockout mutant.

[0033] The present invention discloses the following technical effects:

[0034] This invention reveals that the ZmMETTL3 gene negatively regulates drought resistance in maize plants, and knocking out the ZmMETTL3 gene in maize leads to enhanced drought resistance. This invention further utilizes CRISPR / Cas9 gene editing technology to knock out specific target sites in the ZmMETTL3 gene, obtaining three ZmMETTL3 gene knockout mutants. By comparing the gene knockout mutants with the KN5585 wild-type plant, it was found that the ZmMETTL3 gene knockout mutants responded positively to drought stress. After drought treatment, the single ear weight and grain weight of the mutant plants were significantly higher than those of the wild type, exhibiting superior drought resistance. This invention studies the regulatory role of the ZmMETTL3 gene in maize drought resistance, providing an epigenetic resource for improving maize drought resistance. The ZmMETTL3 gene knockout mutant provides a new biological resource for the breeding of new drought-resistant maize varieties. Attached Figure Description

[0035] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0036] Figure 1 The structure of the ZmMETTL3 gene and the structure of the ZmMETTL3 gene knockout mutant are shown.

[0037] Figure 2 The results show the drought resistance of ZmMETTL3 mutant plants; where WW represents the drought control group and WS represents the drought treatment group; A shows the phenotypic images of wild-type and ZmMETTL3 mutant ears before and after drought stress; B shows the statistical analysis results of single ear weight in the drought control group of wild-type and ZmMETTL3 mutant; C shows the statistical analysis results of single ear weight in the drought treatment group of wild-type and ZmMETTL3 mutant; D shows the statistical analysis results of grain weight in the drought control group of wild-type and ZmMETTL3 mutant; E shows the statistical analysis results of grain weight in the drought treatment group of wild-type and ZmMETTL3 mutant. Detailed Implementation

[0038] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0039] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0040] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0041] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be readily apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0042] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0043] Unless otherwise specified, the materials or reagents involved in the embodiments of this invention can be purchased through conventional channels.

[0044] Example 1: Preparation and Detection of ZmMETTL3 Gene Knockout Mutant

[0045] The ZmMETTL3 gene knockout line was obtained using CRISPR / Cas9 gene editing technology, and the specific process is as follows:

[0046] The ZmMETTL3 gene contains a core member of a methyltransferase, MT-A70. The ZmMETTL3 gene sequence (Gramene ID: Zm00001d017566) was downloaded from the maizegdb website. An sgRNA target was designed before MT-A70 in this gene, with the target sequence being CTGCAGCAGTCGGATATGTGGGG (SEQ ID NO.1). The expression cassette containing the target was ligated into a CRISPR / Cas9 knockout vector, transformed into Agrobacterium EHA105, and then transformed into the immature embryos of wild-type maize KN5585 using Agrobacterium-mediated transformation. BASTA was used as a selection criterion for resistance. The ZmMETTL3 gene sequence of the progeny plants was sequenced to confirm successful knockout of the ZmMETTL3 gene in vivo. T0 generation materials were cultured and obtained.

[0047] T0 generation mutant seeds were planted in the field, and DNA was extracted from leaves using the CTAB method. This DNA was used as a template to detect ZmMETTL3 gene editing. Identification primers located upstream and downstream of the ZmMETTL3 gene target were designed, with sequences ZmMETTL3-1F: TGGGGGCAAGCAGATGACTA (SEQ ID NO.2) and ZmMETTL3-1R: CTGTAGGCCGGTGAATGAGA (SEQ ID NO.3), respectively. The PCR amplification reaction system consisted of 12.5 μL of 2×Rapid Taq Master PCR Mix, 0.5 μL each of upstream and downstream primers, 1 μL of DNA template, and 10.5 μL of double-distilled water to a final volume of 25 μL. The amplification program was: 95℃ pre-denaturation for 2 min; 95℃ denaturation for 15 s, 55℃ annealing for 15 s, 72℃ extension for 10 s, for a total of 39 cycles; followed by a 5 min incubation at 72℃. The amplified PCR products were detected by electrophoresis on a 1.5% agarose gel and then sent to Shanghai Sangon Biotech for sequencing.

[0048] By comparing the sequencing results of the mutant and the wild-type (KN5585 strain), three homozygous mutant materials were successfully identified, namely ZmMETTL3. KO#1 ZmMETTL3 KO#2 and ZmMETTL3 KO#3 The structures of the three gene mutants are as follows: Figure 1 As shown, ZmMETTL3 KO#1A 6bp base deletion at the target site results in the loss of two amino acid residues in the protein sequence, ZmMETTL3. KO#2 A 42bp base deletion at the target site results in a 14-amino acid residue loss in the protein sequence, ZmMETTL3. KO#3 There is a 57bp base deletion at the target site, resulting in a loss of 19 amino acid residues in the protein sequence.

[0049] ZmMETTL3 KO#1 The nucleotide sequence of the ZmMETTL3 gene mutant in the mutant material is as follows, where 6 bases have been deleted between the two bases with double underscores:

[0050]

[0051]

[0052]

[0053] ZmMETTL3 KO#2 The nucleotide sequence of the ZmMETTL3 gene mutant in the mutant material is as follows, where 42 bases have been deleted between the two bases with double underscores:

[0054]

[0055]

[0056]

[0057]

[0058] ZmMETTL3 KO#3 The nucleotide sequence of the ZmMETTL3 gene mutant in the mutant material is as follows. A total of 57 bases were deleted between the two bases with double underlines. Specifically, 22 bp was deleted to the left of the CAT line marked with a dash, and 35 bp was deleted to the right of it.

[0059]

[0060]

[0061]

[0062] Example 2: Identification of drought resistance in ZmMETTL3 gene knockout mutants

[0063] The drought resistance of the knockout mutant and wild-type KN5585 at the adult stage was evaluated. The specific process is as follows:

[0064] ZmMETTL3 mutant materials were planted in open fields and artificial greenhouses as drought control (WW) and drought treatment (WS), respectively, with wild-type KN5585 maize as the control. Before the jointing stage, both the drought control and drought treatment groups received normal seedling management. When the maize reached the jointing stage, irrigation was stopped in the drought treatment group. Both the drought control and treatment groups underwent natural pollination. After the kernels matured, the weight of each ear and the weight of each kernel were recorded, and the results were analyzed. The results are as follows: Figure 2 As shown, the mutant ZmMETTL3 in the drought control group KO#1 and ZmMETTL3 KO#2 The single ear weight and grain weight were significantly lower than those of the wild type. Figure 2 (A, B, and D, P<0.05), while the single ear weight and grain weight of the three ZmMETTL3 mutants in the drought treatment group were significantly higher than those of the wild type (A, B, and D, P<0.05). Figure 2 (A, C, and E, P<0.05). The above results indicate that the ZmMETTL3 mutant line has better root growth ability than the wild type after drought stress, and its yield is significantly higher than that of the wild type (P<0.05), indicating that inhibiting the ZmMETTL3 gene can significantly improve the resistance of maize to drought stress.

[0065] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

[0066] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. Application of knocking out ZmMETTL3 gene in enhancing drought resistance of plants, characterized in that, The Gramene ID of the ZmMETTL3 gene is Zm00001d017566. The plant is maize.

2. Use of knocking out ZmMETTL3 gene in breeding plant varieties with high drought resistance, characterized in that, The Gramene ID of the ZmMETTL3 gene is Zm00001d017566; and the plant is maize.

3. A method for enhancing drought tolerance in plants, characterized by, The step of constructing a ZmMETTL3 gene knockout mutant plant to enhance the drought resistance of the plant includes knocking out the ZmMETTL3 gene in the plant body. The Gramene ID of the ZmMETTL3 gene is Zm00001d017566; and the plant is maize.

Citation Information

Patent Citations

  • Application of ZmMETTL gene in regulating and controlling phenotype and yield of corn root system

    CN117604017A