Methods and compositions for altering root configuration and / or improving plant yield traits

Abstract

The present invention relates to compositions and methods for modifying an endogenous LONELY GUY (LOG) nucleic acid in a plant, optionally resulting in altered root configuration, improved yield traits and / or increased tolerance / resistance to abiotic stress. The invention further relates to plants produced using the methods and compositions of the invention.

Description

[0001] Statement Regarding Electronic Submission of Sequence Listings

[0002] The disclosed content of the sequence listing in XML format named 1499-95_ST26.xml and 299,623 bytes in size, generated and submitted on May 3, 2023, is hereby incorporated by reference into the specification.

[0003] Priority declaration

[0004] This application claims the benefit of U.S. Provisional Application No. 63 / 338,467, filed on May 5, 2022, under 35 U.S.C. §119(e), the entire contents of which are incorporated herein by reference. Technical Field

[0005] The present invention relates to compositions and methods for modifying endogenous LONELY GUY (LOG) nucleic acids in plants, optionally resulting in altered root architecture, improved yield traits and / or increased tolerance / resistance to abiotic stresses. The present invention further relates to plants produced using the methods and compositions of the present invention. Background Art

[0006] The development of roots and vascular systems was important in plant evolution during the Early Devonian (Boyce, CK The evolutionary history of roots and leaves. In: Holbrook NM, Zwieniecki MA (eds.), Vascular transport in plants :479–499. Elsevier, Amsterdam). As sessile organisms, plants have adapted their root systems for optimal nutrient and water acquisition.

[0007] The yield of crop and horticultural plants is limited by many factors, including their ability to absorb water and nutrients. Therefore, one strategy to increase yield is to breed plants with improved root architecture, and artificial selection has exploited variation generated by natural selection to improve root architecture. However, additional strategies are needed to continue crop improvement.

[0008] The present invention overcomes the shortcomings of the prior art by providing improved methods and compositions for altering root architecture and improving yield traits. Summary of the invention

[0009] One aspect of the present invention provides a plant or plant part thereof, comprising at least one (e.g., one or more) mutation in an endogenous LONELY GUY (LOG) gene encoding a cytokinin-activated polypeptide, wherein the cytokinin-activated polypeptide is a cytokinin nucleoside 5-monophosphate phosphoribosylhydrolase polypeptide, optionally wherein the at least one mutation may be a non-natural mutation.

[0010] Another aspect of the present invention provides a plant cell, which comprises an editing system, which comprises: (a) a CRISPR-Cas associated effector protein; and (b) a guide nucleic acid (gRNA, gDNA, crRNA, crDNA, sgRNA, sgDNA), which comprises a spacer sequence complementary to an endogenous target gene encoding a cytokinin nucleoside 5-monophosphate phosphoribosylhydrolase polypeptide in the plant cell.

[0011] Another aspect of the present invention provides a plant cell comprising a base editing system, the base editing system comprising: (a) a CRISPR-Cas associated effector protein; (b) a guide nucleic acid (gRNA) having a spacer sequence complementary to a region of an endogenous LOG target gene encoding a cytokinin nucleoside 5-monophosphate phosphoribosylhydrolase polypeptide, optionally wherein the editing system further comprises a cytidine deaminase or an adenosine deaminase.

[0012] Another aspect of the invention provides a plant cell comprising at least one (e.g., one or more) mutation in the cis-regulatory region of an endogenous LONELY GUY (LOG) gene, wherein the at least one mutation is a base substitution, base insertion or base deletion introduced using an editing system comprising a nucleic acid binding domain that binds to a target site in the LOG gene, the LOG gene (a) comprising a nucleotide sequence having at least 80% sequence identity to the nucleotide sequence of any one of SEQ ID NOs:72, 73, 79 or 80; (b) comprising a region having at least 80% sequence identity to any one of the nucleotide sequences of SEQ ID NOs:75-78, 82-120 or 139-151; and / or (c) encoding a sequence having at least 80% sequence identity to any one of the amino acid sequences of SEQ ID NO:74 or SEQ ID NO:81, optionally wherein the at least one mutation may be a non-natural mutation.

[0013] Also provided is a method of providing a plurality of plants with enhanced root architecture and / or one or more improved yield traits, the method comprising planting two or more plants of the invention in a growing area, thereby providing a plurality of plants with enhanced root architecture and / or improved yield traits compared to a plurality of control plants not comprising the at least one mutation, optionally wherein the plurality of plants with altered root architecture and / or improved yield traits exhibit increased root biomass, steeper root angles, increased lateral root branching and / or longer roots in any combination, improved yield traits such as increased kernel row number (KRN), increased flower number, increased ear length and / or substantially unchanged ear width, and / or increased tolerance / resistance to abiotic stress, optionally wherein the abiotic stress is water stress (e.g., drought or salt stress) or limited nitrogen, optionally wherein the mutation may be a non-natural mutation.

[0014] The present invention also provides a method for producing / cultivating a transgene-free genome-edited plant, the method comprising: (a) hybridizing the plant of the present invention with a transgene-free plant, thereby introducing the mutation into the transgene-free plant; and (b) selecting progeny plants that contain the mutation but are free of transgenes, thereby producing a transgene-free genome-edited plant.

[0015] Another aspect of the present invention provides a method for editing a specific site in the genome of a plant cell, the method comprising: cleaving a target site within an endogenous LONELY DOG (LOG) gene in the plant cell in a site-specific manner, the endogenous LOG gene: (a) comprising a nucleotide sequence having at least 80% sequence identity to the nucleotide sequence of any one of SEQ ID NO:72, 73, 79 or 80; (b) comprising a region having at least 80% sequence identity to any one of the nucleotide sequences of SEQ ID NO:75-78, 82-120 or 139-151; and / or (c) encoding a sequence having at least 80% sequence identity to any one of the amino acid sequences of SEQ ID NO:74 or SEQ ID NO:81, thereby producing an edit in the endogenous LOG gene of the plant cell.

[0016] Another aspect of the present invention provides a method for preparing a plant, the method comprising: (a) contacting a population of plant cells comprising an endogenous gene LOG with a nuclease targeted to the endogenous LOG gene, wherein the nuclease is linked to a nucleic acid binding domain that binds to a target site in the endogenous LOG gene, the endogenous LOG gene: (i) comprising a nucleotide sequence having at least 80% sequence identity to the nucleotide sequence of any one of SEQ ID NOs:72, 73, 79 or 80; (ii) comprising a region having at least 80% sequence identity to any one of the nucleotide sequences of SEQ ID NOs:75-78, 82-120 or 139-151; and / or (iii) encoding a sequence having at least 80% sequence identity to any one of the amino acid sequences of SEQ ID NOs:74 or SEQ ID NOs:81; (b) selecting a plant cell from the population comprising a mutation in the endogenous LOG gene, wherein the mutation is a substitution and / or a deletion; and (c) growing the selected plant cell into a plant comprising the mutation in the endogenous LOG gene.

[0017] In another aspect, a method for altering / enhancing / improving root architecture and / or at least one yield trait of a plant comprises (a) contacting a plant cell comprising an endogenous LONELY GUY (LOG) gene with a nuclease targeted to the endogenous gene, wherein the nuclease is linked to a nucleic acid binding domain that binds to a target site in the endogenous gene, the endogenous LOG gene: (i) comprising a nucleotide sequence having at least 80% sequence identity to the nucleotide sequence of any one of SEQ ID NOs:72, 73, 79 or 80; (ii) comprising a region having at least 80% sequence identity to any one of the nucleotide sequences of SEQ ID NOs:75-78, 82-120 or 139-151; and / or (iii) encoding a sequence having at least 80% sequence identity to any one of the amino acid sequences of SEQ ID NO:74 or SEQ ID NO:81; and (b) growing the plant cell into a plant, thereby altering the root architecture and / or at least one yield trait of the plant.

[0018] In another aspect, a method for producing a plant or part thereof comprising at least one (e.g., one or more) cells having a mutation in an endogenous LONELY GUY (LOG) gene is provided, the method comprising contacting a target site in an endogenous LOG gene in the plant or plant part with a nuclease comprising a cleavage domain and a nucleic acid binding domain, wherein the nucleic acid binding domain of the nuclease binds to the target site in the endogenous LOG gene, wherein the endogenous LOG gene: (a) comprises a nucleotide sequence having at least 80% sequence identity to the nucleotide sequence of any one of SEQ ID NOs:72, 73, 79 or 80; (b) comprises a region having at least 80% sequence identity to any one of the nucleotide sequences of SEQ ID NOs:75-78, 82-120 or 139-151; and / or (c) encodes a sequence having at least 80% sequence identity to any one of the amino acid sequences of SEQ ID NO:74 or SEQ ID NO:81, thereby producing a plant or part thereof comprising at least one cell having a mutation in an endogenous LOG gene.

[0019] In another aspect, a method for producing a plant or part thereof comprising a mutation in an endogenous LONELY GUY (LOG) gene having altered root architecture and / or improved yield traits is provided, the method comprising contacting a target site in an endogenous LOG gene in the plant or plant part with a nuclease comprising a cleavage domain and a nucleic acid binding domain, wherein the nucleic acid binding domain of the nuclease binds to the target site in the endogenous LOG gene, wherein the endogenous LOG gene: (a) comprises a nucleotide sequence having at least 80% sequence identity to the nucleotide sequence of any one of SEQ ID NOs:72, 73, 79 or 80; (b) comprises a region having at least 80% sequence identity to any one of the nucleotide sequences of SEQ ID NOs:75-78, 82-120 or 139-151; and / or (c) encodes a nucleotide sequence having at least 80% sequence identity to any one of the nucleotide sequences of SEQ ID NOs:74 or 75; A sequence having at least 80% sequence identity to any of the amino acid sequences of NO:81, thereby producing a plant or part thereof having a mutated endogenous LOG gene and altered root architecture and / or improved yield traits.

[0020] Another aspect of the present invention provides a guide nucleic acid, which is consistent with the coding LONELYGUY The invention relates to a target site in an endogenous gene of (LOG), wherein the endogenous gene: (a) comprises a nucleotide sequence having at least 80% sequence identity to the nucleotide sequence of any one of SEQ ID NO:72, 73, 79 or 80; (b) comprises a region having at least 80% sequence identity to any one of the nucleotide sequences of SEQ ID NO:75-78, 82-120 or 139-151; and / or (c) encodes a sequence having at least 80% sequence identity to any one of the amino acid sequences of SEQ ID NO:74 or SEQ ID NO:81.

[0021] Another aspect of the present invention provides a system comprising a guide nucleic acid of the present invention and a CRISPR-Cas effector protein associated with the guide nucleic acid.

[0022] Another aspect of the present invention provides a gene editing system, which comprises a CRISPR-Cas effector protein associated with a guide nucleic acid, wherein the guide nucleic acid comprises a spacer sequence that is complementary to and binds to the LONELYGUY (LOG) gene.

[0023] Another aspect of the present invention provides a complex comprising a CRISPR-Cas effector protein, the CRISPR-Cas effector protein comprising a cleavage domain and a guide nucleic acid, wherein the guide nucleic acid binds to a target site in a LONELY GUY (LOG) gene, the LOG gene (a) comprising a nucleotide sequence having at least 80% sequence identity to the nucleotide sequence of any one of SEQ ID NO:72, 73, 79 or 80; (b) comprising a region having at least 80% sequence identity to any one of the nucleotide sequences of SEQ ID NO:75-78, 82-120 or 139-151; and / or (c) encoding a sequence having at least 80% sequence identity to any one of the amino acid sequences of SEQ ID NO:74 or SEQ ID NO:81, wherein the cleavage domain cleaves the target strand in the LOG gene.

[0024] On the other hand, an expression cassette is provided, which comprises: (a) a polynucleotide encoding a CRISPR-Cas effector protein comprising a cleavage domain, and (b) a guide nucleic acid that binds to a target site in a LONELY GUY (LOG) gene, wherein the guide nucleic acid comprises a spacer sequence that is complementary to and binds to the target site in the LOG gene, the LOG gene: (i) comprises a nucleotide sequence having at least 80% sequence identity to the nucleotide sequence of any one of SEQ ID NOs: 72, 73, 79 or 80; (ii) comprises a region having at least 80% sequence identity to any one of the nucleotide sequences of SEQ ID NOs: 75-78, 82-120 or 139-151; and / or (iii) encodes a sequence having at least 80% sequence identity to any one of the amino acid sequences of SEQ ID NO: 74 or SEQ ID NO: 81.

[0025] Another aspect of the present invention provides a mutant nucleic acid encoding a cytokinin nucleoside 5-monophosphate phosphoribohydrolase polypeptide, which mutant nucleic acid comprises a cis-regulatory region having a mutation, optionally wherein the mutation reduces or eliminates the negative regulation of the mutant nucleic acid, and / or wherein the mutation causes increased expression of the mutant nucleic acid.

[0026] Also provided are plants comprising in their genome one or more LONELY GUY (LOG) genes having a mutation produced by the method of the invention, as well as polypeptides, polynucleotides, nucleic acid constructs, expression cassettes and vectors for preparing the plants of the invention.

[0027] These and other aspects of the invention will be described in more detail in the following description of the invention.

[0028] A brief description of the sequence

[0029] SEQ ID NOs: 1-17 are exemplary Cas12a amino acid sequences that can be used in the present invention.

[0030] SEQ ID NOs: 18-20 are exemplary Cas12a nucleotide sequences that can be used in the present invention.

[0031] SEQ ID NOs: 21-22 are exemplary regulatory sequences encoding promoters and introns.

[0032] SEQ ID NOs: 23-29 are exemplary cytosine deaminase sequences that can be used in the present invention.

[0033] SEQ ID NOs: 30-40 are exemplary adenine deaminase amino acid sequences that can be used in the present invention.

[0034] SEQ ID NO: 41 is an exemplary uracil-DNA glycosylase inhibitor (UGI) sequence that can be used in the present invention.

[0035] SEQ ID NOs: 42-44 provide examples of the locations of the protospacer-adjacent motifs of type V CRISPR-Cas12a nucleases.

[0036] SEQ ID NOs:45-47 provide exemplary peptide tags and affinity polypeptides that can be used in the present invention.

[0037] SEQ ID NOs:48-58 provide exemplary RNA recruitment motifs and corresponding affinity polypeptides that can be used in the present invention.

[0038] SEQ ID NOs:59-60 are exemplary Cas9 polypeptide sequences that can be used in the present invention.

[0039] SEQ ID NOs:61-71 are exemplary Cas9 polynucleotide sequences that can be used in the present invention.

[0040] SEQ ID NO:72 is an exemplary LOG1 genomic sequence.

[0041] SEQ ID NO:73 is an exemplary LOG1 coding (cds) sequence.

[0042] SEQ ID NO:74 is an exemplary LOG1 polypeptide sequence.

[0043] SEQ ID NOs: 75-78 and 139-151 are exemplary regions of LOG1 genomic sequences.

[0044] SEQ ID NO:79 is an exemplary LOG5 genomic sequence.

[0045] SEQ ID NO:80 is an exemplary LOG5 coding (cds) sequence.

[0046] SEQ ID NO:81 is an exemplary LOG5 polypeptide sequence.

[0047] SEQ ID NOs:82-120 are exemplary regions of LOG5 genomic sequences.

[0048] SEQ ID NO: 121-124, 138 or 139 are exemplary spacer sequences for targeting the LOG gene.

[0049] SEQ ID NOs: 125, 127, and 129-136 are exemplary LOG genes edited as described herein.

[0050] SEQ ID NO: 126 and SEQ ID NO: 128 are mutant polypeptides encoded by the LOG gene edited as described herein, specifically encoded by the nucleic acid sequences of SEQ ID NO: 125 and SEQ ID NO: 127, respectively.

[0051] SEQ ID NO: 152 and SEQ ID NO: 153 are example regions or portions deleted from the endogenous LOG1 gene (SEQ ID NO: 72).

[0052] SEQ ID NOs: 154-156 are exemplary regions or portions deleted from the endogenous LOG5 gene (SEQ ID NO: 79). DETAILED DESCRIPTION

[0053] The present invention will now be described hereinafter with reference to the accompanying drawings and examples, in which embodiments of the present invention are shown. This specific embodiment is not intended to be a detailed catalog of all different ways in which the present invention can be implemented or all features that can be added to the present invention. For example, the features shown in one embodiment may be incorporated into other embodiments, and the features shown in a specific embodiment may be deleted from the embodiment. Therefore, the present invention contemplates that in some embodiments of the present invention, any feature or combination of features set forth herein may be excluded or omitted. In addition, it will be apparent to those skilled in the art, in accordance with the present disclosure, that many changes and additions to the various embodiments proposed herein will not deviate from the present invention. Therefore, the following description is intended to illustrate some specific embodiments of the present invention, rather than to describe in detail all its permutations, combinations and variations.

[0054] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention belongs. The terms used in the description of the present invention are for the purpose of describing particular embodiments only and are not intended to be limiting of the present invention.

[0055] All publications, patent applications, patents, and other references cited herein are incorporated by reference in their entirety for the teachings relevant to the sentence and / or paragraph in which the reference is presented.

[0056] Unless the context indicates otherwise, it is specifically intended that the various features of the invention described herein may be used in any combination. In addition, the present invention also contemplates that in some embodiments of the present invention, any feature or combination of features set forth herein may be excluded or omitted. For illustration, if the specification states that a composition comprises components A, B, and C, it is specifically intended that any one of A, B, or C or a combination thereof may be omitted and abandoned, either individually or in any combination.

[0057] As used in the description of the invention and the appended claims, the singular forms "a", "an" and "the" are intended to include the plural forms as well, unless the context clearly indicates otherwise.

[0058] Also as used herein, "and / or" refers to and encompasses any and all possible combinations of one or more of the associated listed items, as well as the lack of a combination when interpreted in the alternative ("or").

[0059] As used herein, the term "about" when referring to a measurable value such as an amount or concentration, is intended to encompass variations of ±10%, ±5%, ±1%, ±0.5%, or even ±0.1% of the specified value as well as the specified value. For example, "about X," where X is a measurable value, is intended to include X as well as variations of ±10%, ±5%, ±1%, ±0.5%, or even ±0.1% of X. The ranges of measurable values ​​provided herein may include any other ranges and / or individual values ​​therein.

[0060] Unless otherwise defined, the term "at least one" has the same meaning as "one or more" (eg, 1, 2, 3, 4, 5, etc.).

[0061] As used herein, phrases such as "between X and Y" and "between about X and Y" should be interpreted to include X and Y. As used herein, phrases such as "between about X and Y" mean "between about X and about Y," and phrases such as "from about X to Y" mean "from about X to about Y."

[0062] Recitation of ranges of values ​​herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range, unless otherwise indicated herein, and each separate value is incorporated into the specification as if it were individually recited herein. For example, if a range of 10 to 15 is disclosed, 11, 12, 13, and 14 are also disclosed.

[0063] As used herein, the terms “comprising,” “including,” and “having” specify the presence of stated features, integers, steps, operations, elements, and / or components, but do not preclude the presence or addition of one or more other features, integers, steps, operations, elements, components, and / or groups thereof.

[0064] As used herein, the transitional phrase "consisting essentially of" means that the scope of the claim should be interpreted to encompass the specified materials or steps recited in the claim as well as those materials or steps that do not materially affect the basic and novel characteristics of the claimed invention. Therefore, when used in the claims of the present invention, the term "consisting essentially of" is not intended to be interpreted as being equivalent to "comprising".

[0065] As used herein, the terms "increase," "increasing," "increased," "enhance," "enhanced," "enhancing," and "enhancement" (and grammatical variations thereof) describe an increase of at least about 15%, 20%, 25%, 50%, 75%, 100%, 150%, 200%, 300%, 400%, 500% or more compared to a control.

[0066] As used herein, the terms "reduce", "reduced", "reducing", "reduction", "decrease" and "lower" (and grammatical variations thereof) describe, for example, a reduction of at least about 5%, 10%, 15%, 20%, 25%, 35%, 50%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or 100% as compared to a control. In some embodiments, the reduction can result in no or substantially no (i.e., a negligible amount, e.g., less than about 10% or even 5%) detectable activity or amount.

[0067] As used herein, the term "expression" ("express", "expresses", "expressed" or "expression"), etc., with respect to nucleic acid molecules and / or nucleotide sequences (e.g., RNA or DNA) means that the nucleic acid molecules and / or nucleotide sequences are transcribed and optionally translated. Thus, the nucleic acid molecules and / or nucleotide sequences can express a polypeptide of interest or, for example, a functional non-translated RNA.

[0068] A "heterologous" or "recombinant" nucleotide sequence is a nucleotide sequence that is not naturally associated with a host cell into which it is introduced, including non-naturally occurring multiple copies of a naturally occurring nucleotide sequence.

[0069] A "native" or "wild-type" nucleic acid, nucleotide sequence, polypeptide, or amino acid sequence refers to a naturally occurring or endogenous nucleic acid, nucleotide sequence, polypeptide, or amino acid sequence. Thus, for example, a "wild-type mRNA" is an mRNA that occurs naturally in or is endogenous to a reference organism.

[0070] As used herein, the term "heterozygous" refers to a genetic state in which different alleles are located at corresponding loci on homologous chromosomes.

[0071] As used herein, the term "homozygous" refers to a genetic state in which identical alleles are located at corresponding loci on homologous chromosomes.

[0072] As used herein, the term "allele" refers to one of two or more different nucleotides or nucleotide sequences occurring at a particular locus.

[0073] A "null allele" is a non-functional allele caused by a gene mutation that results in no production of the corresponding protein or production of a non-functional protein.

[0074] A "dominant negative mutation" is a mutation that produces an altered gene product (e.g., one that has an abnormal function relative to the wild type) that adversely affects the function of the wild type allele or gene product. For example, a "dominant negative mutation" can block the function of a wild type gene product. A dominant negative mutation may also be referred to as a "reversal allele mutation."

[0075] A "semidominant mutation" is a mutation in which the penetrance of the phenotype in a heterozygous organism is less than the penetrance of the phenotype observed in a homozygous organism.

[0076] A "weak loss-of-function mutation" is a mutation that results in a gene product that has partial function or reduced function (partial inactivation) compared to the wild-type gene product.

[0077] A "hypofunctional allele mutation" is a mutation that results in a partial loss of gene function, which may occur through reduced expression (e.g., reduced protein and / or reduced RNA) or reduced functional performance (e.g., reduced activity), but not a complete loss of function / activity. A "hypofunctional" allele is a semi-functional allele caused by a gene mutation that results in the production of a corresponding protein that functions at anywhere between 1% and 99% of normal efficiency.

[0078] A "hyperallelic mutation" is a mutation that results in increased expression of a gene product and / or increased activity of a gene product.

[0079] A "locus" is the location on a chromosome where a gene or marker or allele is located. In some embodiments, a locus may encompass one or more nucleotides.

[0080] As used herein, "non-natural mutation" refers to a mutation produced by human intervention that is different from a naturally occurring (e.g., naturally occurring) mutation found in the same gene. As used herein, "non-natural" mutations do not include mutations produced by human intervention in a gene of a plant species if the same mutation is also a naturally occurring mutation in the gene and the plant species.

[0081] As used herein, the terms "desired allele," "target allele," and / or "allele of interest" are used interchangeably to refer to an allele associated with a desired trait. In some embodiments, a desired allele may be associated with an increase or decrease (relative to a control) in a given trait, depending on the nature of the desired phenotype. In some embodiments of the invention, the phrase "desired allele," "target allele," or "allele of interest" refers to an allele associated with increased plant yield under non-water stress conditions relative to a control plant without the target allele.

[0082] A marker is "associated with" a trait when it is linked to the marker and when the presence of the marker is an indication of whether and / or to what extent the desired trait or trait form occurs in the plant / germplasm containing the marker. Similarly, a marker is "associated with" an allele or chromosomal interval when it is linked to the allele or chromosomal interval and when the presence of the marker is an indication of whether the allele or chromosomal interval is present in the plant / germplasm containing the marker.

[0083] As used herein, the terms "backcross" and "backcrossing" refer to the process of crossing a progeny plant back to one of its parents one or more times (e.g., 1, 2, 3, 4, 5, 6, 7, 8 times, etc.). In a backcrossing protocol, the "donor" parent refers to the parent plant that has the desired gene or locus to be introgressed. The "recipient" parent (used one or more times) or the "recurrent" parent (used two or more times) refers to the parent plant into which the gene or locus is introgressed. For example, see Ragot, M. et al., Marker-assisted Backcrossing: A Practical Example, in TECHNIQUES ETUTILISATIONS DE MARQUEURS MOLECULAIRES LES COLLOQUES, Vol. 72, pp. 45-56 (1995); and Openshaw et al., Marker-assisted Selection in Backcross Breeding, in PROCEEDINGS OF THE SYMPOSIUM "ANALYSIS OF MOLECULAR MARKER DATA," pp. 41-43 (1994). The initial hybridization produces the F1 generation. The term "BC1" refers to the second use of the recurrent parent, "BC2" refers to the third use of the recurrent parent, and so on.

[0084] As used herein, the term "cross" or "crossed" refers to the production of offspring (e.g., cells, seeds, or plants) by the fusion of gametes through pollination. The term encompasses sexual crossing (pollination of one plant to another) and selfing (self-pollination, e.g., when pollen and ovules are from the same plant). The term "crossing" refers to the act of fusion of gametes through pollination to produce offspring.

[0085] As used herein, the terms "introgression", "introgressing" and "introgressed" refer to the natural and artificial transmission of a desired allele or combination of desired alleles of one or more genetic loci from one genetic background to another genetic background. For example, the desired allele at a given locus can be transmitted to at least one progeny by sexual hybridization between two parents of the same species, wherein at least one parent has the desired allele in its genome. Alternatively, for example, the transmission of the allele can occur by recombination between two donor genomes, such as in fused protoplasts, wherein at least one donor protoplast has the desired allele in its genome. The desired allele can be a selected allele of a marker, QTL, transgenic, etc. The offspring containing the desired allele can be backcrossed one or more times (e.g., 1, 2, 3, 4 or more times) with a strain having a desired genetic background, selecting the desired allele, with the result that the desired allele is fixed in the desired genetic background. For example, a marker associated with increased yield under non-water stress conditions can be introgressed from a donor into a recurrent parent that does not contain the marker and does not exhibit increased yield under non-water stress conditions. The resulting offspring can then be backcrossed one or more times and selected until the progeny possess the genetic marker associated with increased yield under non-water stress conditions in the recurrent parent background.

[0086] A "genetic map" is a description of the genetic linkage relationships between loci on one or more chromosomes within a given species, usually depicted in a graphical or tabular form. For each genetic map, the distances between loci are measured by the frequencies of recombination between them. A variety of markers can be used to detect recombination between loci. A genetic map is a product of the mapping population, the type of markers used, and the polymorphic potential of each marker between different populations. The order and genetic distance between loci can vary from genetic map to genetic map.

[0087] As used herein, the term "genotype" refers to the genetic constitution of an individual (or individual population) at one or more genetic loci, in contrast to observable and / or detectable and / or phenotype traits (phenotypes). Genotype is defined by the alleles of one or more known loci inherited by an individual from its parents. The term genotype can be used to refer to the genetic constitution of an individual at a single locus, a plurality of loci, or more generally, the term genotype can be used to refer to the genetic constitution of all genes in an individual genome. Genotype can be, for example, indirectly characterized using a mark and / or directly characterized by nucleic acid sequencing.

[0088] As used herein, the term "germplasm" refers to the genetic material of an individual (e.g., plant), a group of individuals (e.g., plant strains, varieties or families), or clones derived from strains, varieties, species or cultures, or from an individual (e.g., plant), a group of individuals (e.g., plant strains, varieties or families), or clones derived from strains, varieties, species or cultures. Germplasm can be a part of an organism or cell or can be separated from an organism or cell. In general, germplasm provides genetic material with a specific genetic composition, providing a basis for some or all of the genetic qualities of an organism or cell culture. As used herein, germplasm includes cells, seeds or tissues that can grow new plants, and plant parts (e.g., leaves, stems, buds, roots, pollen, cells, etc.) that can be cultured into complete plants.

[0089] As used herein, the terms "cultivar" and "variety" refer to a group of similar plants distinguishable from other varieties within the same species by structural or genetic characteristics and / or performance.

[0090] As used herein, the terms "exotic", "exotic strains" and "exotic germplasm" refer to any plant, strain or germplasm that is not superior. Generally speaking, the exotic plant / germplasm is not derived from any known superior plant or germplasm, but is selected to introduce one or more desired genetic elements into a breeding program (e.g., introducing new alleles into a breeding program).

[0091] As used herein, the term "hybrid" in the context of plant breeding refers to a plant that is the offspring of genetically distinct parents produced by crossing plants of different lines or varieties or species, including but not limited to a cross between two inbred lines.

[0092] As used herein, the term "inbred" refers to a substantially homozygous plant or variety. The term can refer to a plant or plant variety that is substantially homozygous throughout the genome, or a plant or plant variety that is substantially homozygous for a portion of the genome of particular interest.

[0093] A "haplotype" is the genotype of an individual at multiple genetic loci, i.e., a combination of alleles. Typically, the genetic loci that define a haplotype are physically and genetically linked, i.e., on the same chromosome segment. The term "haplotype" may refer to a polymorphism at a specific locus, such as a single marker locus, or a polymorphism at multiple loci along a chromosome segment.

[0094] As used herein, the term "heterologous" refers to a nucleotide / polypeptide derived from a foreign species, or, if derived from the same species, a nucleotide / polypeptide that is substantially modified from its native form in composition and / or genomic locus by deliberate human intervention.

[0095] Plants in which at least one (e.g., one or more) LOG genes are modified as described herein (e.g., comprise modifications as described herein) can have improved yield traits compared to plants that do not comprise the modifications in the at least one LOG gene. As used herein, "improved yield trait" refers to any plant trait associated with growth, such as biomass, yield, nitrogen use efficiency (NUE), inflorescence size / weight, fruit yield, fruit quality, fruit size, seed size, seed number, leaf tissue weight, nodule number, nodule quality, nodulation activity, seed ear number, tiller number, number of branches, flower number, tuber number, tuber quality, bulb quality, seed number, total seed mass, leaf emergence rate, tiller / branch emergence rate, seedling emergence rate, and / or altered root architecture, including but not limited to root length, root number, root mass size and / or weight (root biomass), steeper root angle, or increased lateral root branching, or any combination thereof. In some aspects, improved yield traits include, but are not limited to, increased KRN, increased number of flowers, increased ear length and / or substantially unchanged ear width. In some aspects, "improved yield traits" may include, but are not limited to, increased tolerance / resistance to abiotic stress (optionally wherein the abiotic stress is water stress (e.g., drought or salt stress) or limited nitrogen), increased inflorescence yield, increased fruit yield (e.g., increased fruit number, weight and / or size; e.g., increased number, weight and / or size of ears (e.g., corn)), increased fruit quality, increased number, size and / or weight of roots, increased meristem size, increased seed size, increased biomass, increased leaf size, increased nitrogen use efficiency, increased height, increased number of internodes and / or increased internode length compared to a control plant or part thereof (e.g., a plant that does not contain a mutated endogenous LOG nucleic acid (e.g., a mutated LOG gene, e.g., a mutated LOG1 gene and / or a mutated LOG5 gene)). Improved yield traits can also be caused by the increase of planting density of plant of the present invention.Therefore, in some respects, plant of the present invention can be planted with the density that increases (due to the plant configuration of the change caused by endogenous mutation), and this causes improved yield traits compared with the control plant planted with the same density.In some respects, improved yield traits can be expressed as the quantity of the grain produced per unit land area (for example, bushel number of every acre of land).

[0096] In some embodiments, the plants of the invention comprise an altered root architecture, wherein the altered root architecture is characterized by increased root biomass, steeper root angles, increased lateral root branching and / or longer roots in combination, optionally wherein the plant with the altered root architecture exhibits improved yield traits and / or increased tolerance / resistance to abiotic stress, optionally wherein the abiotic stress may be water stress (e.g., drought or salt stress) or limited nitrogen.

[0097] As used herein, "an increase in root biomass" refers to an increase in root biomass of about 5% to 150% (e.g., about 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 110%, 111 , 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, %, 130%, 135%, 140%, 145% or 150%, or any range or value therebetween).

[0098] As used herein, "steeper root angle" means that the root angle is at least 5 degrees, up to 90 degrees (e.g., about 5 degrees, 6 degrees, 7 degrees, 8 degrees, 9 degrees, 10 degrees, 11 degrees, 12 degrees, 13 degrees, 14 degrees, 15 degrees, 16 degrees, 17 degrees, 18 degrees, 19 degrees, 20 degrees, 21 degrees, 22 degrees, 23 degrees, 24 degrees, 25 degrees, 26 degrees, 27 degrees, 28 degrees, 29 degrees, 30 degrees, 31 degrees, 32 degrees, 33 degrees, 34 degrees, 35 degrees, 36 degrees, 37 degrees, 38 degrees, 39 degrees, 40 degrees, 41 degrees, 42 degrees, 43 degrees, 44 degrees, 45 degrees, 46 degrees, 47 degrees, 48 ​​degrees, 49 degrees, 50 degrees, 51 degrees, 52 degrees, 53 degrees, 54 degrees, 55 degrees, 56 degrees, 57 degrees, 58 degrees, 59 degrees, 60 degrees, 61 degrees, 62 degrees, 63 degrees, 64 degrees, 65 degrees, 66 degrees, 67 degrees, 68 degrees, 69 degrees, 70 degrees, 71 degrees, 72 degrees, 73 degrees, 74 degrees, 75 degrees, 76 degrees, 77 degrees, 78 degrees, 79 degrees, 80 degrees, degrees, 45 degrees, 46 degrees, 47 degrees, 48 ​​degrees, 49 degrees, 50 degrees, 51 degrees, 52 degrees, 53 degrees, 54 degrees, 55 degrees, 56 degrees, 57 degrees, 58 degrees, 59 degrees, 60 degrees, 61 degrees, 62 degrees, 63 degrees, 64 degrees, 65 degrees, 66 degrees, 67 degrees, 68 degrees, 69 degrees, 70 degrees, 71 degrees, 72 degrees, 73 degrees, 74 degrees, 75 degrees, 76 degrees, 77 degrees, 78 degrees, 79 degrees, 80 degrees, 81 degrees, 82 degrees, 83 degrees, 84 degrees, 85 degrees, 86 degrees, 87 degrees, 88 degrees, 89 degrees or 90 degrees, or any value or range in between).

[0099] As used herein, "increase in lateral root branching" refers to an increase in lateral root branching of about 30% to about 200% (e.g., about 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 110%, 111%, 112%, 113%, 114%, 115%, 116%, 117%, 118%, 119%, 120%, 121%, 122%, 123%, 124%, 125 1%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 110%, 111%, 112%, 113%, 114%, 115%, 116%, 117%, 118%, 119%, 120%, 121%, 122%, 123%, 124%, 125%, 126%, 127%, 128%, 129%, 130%, 131%, 132%, 133%, 134%, 135%, 136%, 137%, 138%, 139%, 140%, 141%, 142%, 143%, 144%, 145%, 146%, 147%, 148%, 149%, 150%, 151%, 152%, 153%, 154%, 155%, 156%, 157%, 158%, 159%, 160%, 161%, 162%, 163%, 164%, 165%, 166%, 167%, 168%, 169%, 170%, 171%, 172%, 173%, 174%, 175%, 176%, 177%, 178%, 179%, 180%, %, 114%, 115%, 116%, 117%, 118%, 119%, 120%, 125%, 130%, 135%, 140%, 145%, 150%, 155%, 160%, 165%, 170%, 175%, 180%, 185%, 190%, 195% or 200%, or any range or value therebetween).

[0100] As used herein, “longer roots” refers to roots that have increased length by about 15% to about 100% (e.g., about 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, or any range or value therebetween) as compared to control plants.

[0101] As used herein, plants of the present invention may comprise one or more improved yield traits, which may include, but are not limited to, increased kernel row number (KRN), increased flower number, increased ear length, and / or substantially unchanged ear width.

[0102] As used herein, an “increase in KRN” refers to an increase in KRN by about 5% to about 35% (e.g., about 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, or 35%, or any range or value therebetween) compared to control plants.

[0103] As used herein, an “increase in flower number” refers to an increase in flower number of about 15% to about 85% (e.g., about 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 110%, 111%, 112%, 113%, 114%, 115%, %, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84% or 85%, or any range or value therebetween).

[0104] As used herein, an “increase in ear length” refers to an increase in ear length by about 10% to about 50% (e.g., about 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, or 50%, or any range or value therebetween).

[0105] In some embodiments, "substantially unchanged ear width" refers to an ear width that does not vary by more than about 10% (e.g., a variation of less than or equal to 10%, e.g., less than or equal to 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9% or 10%, or any range or value therein) compared to control plants.

[0106] As used herein, "control plant" means a plant that does not contain one or more edited LOG genes (e.g., LOG1, LOG5) as described herein, which confers enhanced / improved traits (e.g., yield traits) or altered phenotypes, including altered root architecture and / or improved yield traits. Control plants are used to identify and select plants edited as described herein and having enhanced traits or altered phenotypes. Suitable control plants can be parental line plants used to produce plants containing mutated LOG genes (e.g., LOG1, LOG5), for example, wild-type plants lacking editing in endogenous LOG genes as described herein. Suitable control plants can also be plants containing recombinant nucleic acids that confer other traits, for example, transgenic plants with enhanced herbicide tolerance. In some cases, suitable control plants can be progeny of heterozygous or hemizygous transgenic plant lines lacking mutated LOG genes as described herein, referred to as negative segregants or negative isogenic lines.

[0107] The enhanced traits can be, for example, reduced days from planting to maturity, increased stem size, increased leaf number, increased vegetative stage plant height growth rate, increased ear size, increased dry weight per plant ear, increased number of grains per ear, increased per grain weight, increased number of grains per plant, reduced empty ear grains, extended grain filling period, reduced plant height, increased root branch number, increased total root length, increased yield, improved nitrogen use efficiency, and improved water use efficiency compared to control plants. The altered phenotype can be, for example, plant height, biomass, canopy area, anthocyanin content, chlorophyll content, water application, water content, and water use efficiency.

[0108] As used herein, " traits " are physiology, morphology, biochemistry or physical characteristics of plants or specific plant materials or cells. In some cases, this feature is visible to the human eye and can be measured mechanically, such as the size, weight, shape, form, length, height, growth rate and developmental stage of seeds or plants, or can be measured by biochemical techniques, such as protein, starch, some metabolites or the oil content of detection seeds or leaves, or by observing metabolism or physiological processes, for example, by measuring the tolerance to lack of water or specific salt or sugar concentration, or by measuring the expression level of one or more genes, for example, by adopting Northern analysis, RT-PCR, microarray gene expression array or reporter gene expression system, or by agricultural observation such as high osmotic stress tolerance or yield. However, any technology can be used for measuring any selected chemical compound or macromolecular amount, comparative level or difference in transgenic plants.

[0109] As used herein, "enhanced traits" means plant characteristics caused by mutations in LOG genes (e.g., LOG1, LOG5) as described herein. Such traits include, but are not limited to, enhanced agronomic traits, characterized in that enhanced plant morphology, physiology, growth and development, yield, nutritional enhancement, disease or pest resistance, or environmental or chemical tolerance. In some embodiments, the phenotype of enhanced traits / changes can be, for example, reduced days from planting to maturity, increased stem size, increased leaf number, increased nutrient stage plant height growth rate, increased ear size, increased per plant ear dry weight, increased per ear grain number, increased per grain weight, increased per plant grain number, reduced ear empty grains, extended filling period, reduced plant height, increased root branch number, increased total root length, drought tolerance, improved water use efficiency, cold tolerance, improved nitrogen use efficiency and increased yield. In some embodiments, traits are the yield increased under non-stress conditions or the yield increased under environmental stress conditions. Stress conditions can include biotic and abiotic stresses, such as drought, shading, fungal diseases, viral diseases, bacterial diseases, insect infestation, nematode infestation, low temperature exposure, heat exposure, osmotic stress, nitrogen nutrient availability reduction, phosphorus nutrient availability reduction and high plant density. "Yield" can be affected by many characteristics, including but not limited to plant height, plant biomass, pod number, pod position on plant, internode number, pod cracking incidence, grain size, ear size, ear tip filling degree, grain abortion, nodulation and nitrogen fixation efficiency, nutrient assimilation efficiency, biotic and abiotic stress resistance, carbon assimilation, plant configuration, lodging resistance, seed germination percentage, seedling vigor and juvenile traits. Yield can also be affected by the following factors: germination efficiency (including germination under stress conditions), growth rate (including growth rate under stress conditions), flowering time and duration, ear number, ear size, ear weight, number of seeds per ear or per pod, seed size, composition (starch, oil, protein) of seed and the characteristics of seed filling.

[0110] As also used herein, the term "trait modification" encompasses altering a naturally occurring trait by producing a detectable characteristic difference in a plant comprising a mutation in an endogenous LOG gene (e.g., LOG1, LOG5) as described herein relative to a plant that does not comprise the mutation (such as a wild-type plant, or a negative segregant). In some cases, the trait modification can be evaluated quantitatively. For example, a trait modification can result in an increase or decrease in an observed trait characteristic or phenotype compared to a control plant. It is well known that a modified trait may have natural variation. Thus, an observed trait modification results in a normal distribution and a change in magnitude of the trait characteristic or phenotype in a plant compared to a control plant.

[0111] The present disclosure relates to plants with improved economically important characteristics, more specifically increased yield. More specifically, the present disclosure relates to a plant comprising a mutation in a LOG gene (e.g., LOG1, LOG5) as described herein, wherein the plant has increased yield compared to a control plant lacking the mutation. In some embodiments, the plant produced as described herein exhibits increased yield or improved yield trait components compared to a control plant. In some embodiments, the plants of the present disclosure exhibit improved traits associated with yield, including but not limited to increased nitrogen use efficiency, increased nitrogen stress tolerance, increased water use efficiency, and increased drought tolerance, as defined and discussed below.

[0112] Yield can be defined as a measurable product with economic value from crops. Yield can be defined in the range of quantity and / or quality. Yield can directly depend on several factors, for example, the number and size of organs, plant configuration (such as the number of branches, plant biomass, for example, the root biomass of any combination of increase, steeper root angle, increased lateral root branching and / or longer roots, etc.), flowering time and duration, filling period. Root configuration and development, photosynthetic efficiency, nutrient absorption, stress tolerance, early vigor, delayed senescence and functional stay-green phenotype may be the factors determining yield. Therefore, optimizing the above factors can help increase crop yield.

[0113] The increase / improvement of the yield correlated traits mentioned herein also can be considered to refer to the increase of the biomass (weight) of one or more parts of plant, and these one or more parts can comprise above-ground and / or underground (can gather in the crops) plant parts.Particularly, this type of part that can gather in the crops is seed, and the execution of the disclosed method produces the plant of the seed yield with the yield of increase, particularly with respect to the seed yield of suitable control plant.The " yield " of term plant can relate to the nutrient biomass (root and / or seedling biomass), reproductive organ and / or propagule (such as seed) of this plant.

[0114] The increased yield of the plants of the present disclosure can be measured in a variety of ways, including test weight, number of seeds per plant, seed weight, number of seeds per unit area (e.g., number of seeds per acre or seed weight), bushels per acre, tons per acre, or kilograms per hectare. The increased yield can be attributed to improved utilization of key biochemical compounds (such as nitrogen, phosphorus, and carbohydrates), or to improved responses to environmental stresses (such as cold, heat, drought, salt, shade, high plant density, and pest or pathogen attack).

[0115] "Increased yield" can be manifested as one or more of the following: (i) increased plant biomass (weight) of one or more parts of the plant, in particular the aboveground (harvestable) parts of the plant, increased root biomass (increased number of roots, increased root thickness, increased root length) or increased biomass of any other harvestable part; or (ii) increased early vigour, defined herein as increased aboveground area of ​​seedlings about three weeks after germination.

[0116] "Early vigor" refers to active and healthy plant growth, especially in the early stages of plant growth, and can be due to, for example, plant better adapting to its environment (for example, optimizing the utilization of energy, nutrient absorption and carbon distribution between seedling and root) caused by the increase in plant fitness. For example, early vigor can be a combination of the ability of seeds to germinate and emerge after planting and the ability of seedlings to grow and develop after emergence. Plants with early vigor also show increased seedling survival rate and better crop planting, which can usually make the field highly uniform, wherein most plants basically reach each development stage at the same time, thereby usually increasing output. Therefore, early vigor can be determined by measuring various factors, such as grain weight, germination percentage, emergence percentage, seedling growth, seedling height, root length, root and seedling biomass, canopy size and color, etc.

[0117] In addition, increased yield can also be manifested as increased total seed yield, which can be attributed to one or more of the following: an increase in seed biomass (seed weight) due to an increase in seed weight per plant and / or individual seed, e.g., an increased number of flowers / panicles per plant; an increased number of pods; an increased number of nodes; an increased number of flowers ("florets") per panicle / plant; an increased seed filling rate; an increased number of filled seeds; an increased seed size (length, width, area, girth), which can also affect seed composition; and / or an increased seed volume, which can also affect seed composition. In one embodiment, the increased yield can be increased seed yield, e.g., increased seed weight; an increased number of filled seeds; and an increased harvest index.

[0118] Increased production may also result in configurational changes or may be due to

[0119] Occurs due to changes in plant architecture.

[0120] Increased yield can also be expressed as an increased harvest index, which is expressed as

[0121] The ratio of the yield of harvestable parts (such as seeds) to the total biomass

[0122] The present disclosure also extends to harvestable parts of plants, such as, but not limited to, seeds, leaves, fruits, flowers, pods, pods, siliques, nuts, stems, rhizomes, tubers and bulbs. The present disclosure also relates to products derived from harvestable parts of such plants, such as dry pellets, powders, oils, fats and fatty acids, starch or proteins.

[0123] The present disclosure provides a method for increasing the "yield" of a plant or the "broadacre yield" of a plant or plant part, which is defined as the harvestable plant part per unit area, such as number of seeds per acre or seed weight, pounds per acre, bushels per acre, tons per acre, tons per acre, kilograms per hectare.

[0124] As used herein, "nitrogen use efficiency" refers to the processes that lead to increased plant yield, biomass, vigor, and growth rate per unit of nitrogen applied. These processes may include plant absorption, assimilation, accumulation, signal transduction, sensing, retransfer (within the plant), and utilization of nitrogen.

[0125] As used herein, "increased nitrogen use efficiency" refers to the ability of a plant to grow, develop or produce faster or better than normal when subjected to the same available / applied amount of nitrogen as under normal or standard conditions; the ability of a plant to grow, develop or produce normally, or the ability to grow, develop or produce faster or better when subjected to less than optimal available / applied amounts of nitrogen or under nitrogen limiting conditions.

[0126] As used herein, "nitrogen limiting conditions" refers to growing conditions or environments that provide less than the optimal amount of nitrogen required for adequate or successful metabolism, growth, reproductive success, and / or survival of a plant.

[0127] As used herein, "increased nitrogen stress tolerance" refers to the ability of a plant to grow, develop or produce normally, or to grow, develop or produce faster or better, when subjected to less than optimal available / applied amounts of nitrogen or under nitrogen limiting conditions.

[0128] The improved plant nitrogen utilization efficiency can be converted into a similar amount of yield in the field while supplying less nitrogen, or an increased yield can be obtained by supplying an optimum / sufficient amount of nitrogen. The improved nitrogen utilization efficiency can improve plant nitrogen stress tolerance, and can also improve the biochemical composition of crop quality and seeds, such as protein yield and oil yield. The terms "improved nitrogen utilization efficiency", "enhanced nitrogen utilization efficiency" and "nitrogen stress tolerance" are used interchangeably in this disclosure and refer to plants with improved productivity under nitrogen limiting conditions.

[0129] As used herein, "water use efficiency" refers to the amount of carbon dioxide assimilated by leaves per unit of transpiration water vapor. It constitutes one of the most important traits controlling plant productivity in dry environments. "Drought tolerance" refers to the degree to which plants adapt to dry or drought conditions. The physiological response of plants to water shortage includes leaf wilting, reduced leaf area, leaf shedding, and stimulating root growth by directing nutrients to the underground parts of the plant. Generally, plants are more susceptible to drought during flowering and seed development (reproduction stage) because the resources of the plant are biased to support root growth. In addition, abscisic acid (ABA) is a plant stress hormone that induces the closure of leaf stomata (microscopic pores involved in gas exchange), thereby reducing water loss caused by transpiration and reducing photosynthesis rate. These reactions improve the water use efficiency of plants in the short term. The terms "improved water use efficiency", "enhanced water use efficiency" and "increased drought tolerance" are used interchangeably in this disclosure and refer to plants with improved productivity under water-limited conditions.

[0130] As used herein, "increased water use efficiency" refers to the ability of a plant to grow, develop or produce faster or better than normal when subjected to the same available / applied amount of water as under normal or standard conditions; the ability of a plant to grow, develop or produce normally, or the ability to grow, develop or produce faster or better when subjected to reduced available / applied amounts of water (water input) or under conditions of water stress or water deficiency stress.

[0131] As used herein, "increased drought tolerance" refers to the ability of a plant to grow, develop or produce normally, or to grow, develop or produce faster or better than normal, when subjected to reduced available / applied amounts of water and / or under conditions of short-term or long-term drought; the ability of a plant to grow, develop or produce normally when subjected to reduced available / applied amounts of water (water input) or under conditions of water stress or under conditions of short-term or long-term drought.

[0132] As used herein, "drought stress" refers to a dry period (short or long / extended) that results in a lack of water and stresses the plant and / or causes damage to plant tissue and / or has a negative impact on grain / crop yield; a dry period (short or long / extended) that results in a lack of water and / or an increase in temperature and stresses the plant and / or causes damage to plant tissue and / or has a negative impact on grain / crop yield.

[0133] As used herein, "water deficit" refers to conditions or circumstances that provide less than the optimal amount of water required for adequate / successful growth and development of plants.

[0134] As used herein, "water stress" refers to a condition or environment that provides an inappropriate amount of water (less / insufficient or more / excessive) relative to the amount of water required for adequate / successful growth and development of the plant / crop, thereby stressing the plant and / or causing damage to plant tissue and / or negatively affecting grain / crop yield.

[0135] As used herein, "water stress" refers to a condition or environment that provides less / insufficient water than required for adequate / successful growth and development of a plant / crop, thereby stressing the plant and / or causing damage to plant tissue and / or negatively affecting grain yield.

[0136] The terms "enhanced root architecture," "altered root architecture," or "improved root architecture" may be used interchangeably and refer to an improved root architecture that provides a plant with an ability to absorb water and nutrients, particularly when the plant is grown under environmental conditions (e.g., drought conditions) that may limit water and nutrient absorption in plants that do not contain an enhanced root architecture. The enhanced or altered root architecture may be characterized by phenotypes including, but not limited to, increased root biomass, steeper root angles, increased lateral root branching and / or longer roots in any combination, and / or improved yield traits, and / or increased resistance or tolerance to abiotic stresses.

[0137] As used herein, the terms "nucleic acid", "nucleic acid molecule", "nucleotide sequence" and "polynucleotide" refer to linear or branched, single-stranded or double-stranded RNA or DNA, or a hybrid thereof. The term also encompasses RNA / DNA hybrids. When synthesizing dsRNA, less common bases such as inosine, 5-methylcytosine, 6-methyladenine, hypoxanthine, etc. can also be used for antisense, dsRNA and ribozyme pairing. For example, polynucleotides containing C-5 propyne analogs of uridine and cytidine have been shown to bind RNA with high affinity and are potent antisense inhibitors of gene expression. Other modifications may also be made, such as modifications to the 2'-hydroxyl in the phosphodiester backbone or the RNA ribose group.

[0138] As used herein, the term "nucleotide sequence" refers to a heteropolymer of nucleotides or a sequence of these nucleotides from the 5' to 3' end of a nucleic acid molecule, and includes DNA or RNA molecules, including cDNA, DNA fragments or parts, genomic DNA, synthetic (e.g., chemically synthesized) DNA, plasmid DNA, mRNA and antisense RNA, any of which can be single-stranded or double-stranded. The terms "nucleotide sequence", "nucleic acid", "nucleic acid molecule", "nucleic acid construct", "oligonucleotide" and "polynucleotide" are also used interchangeably herein to refer to a heteropolymer of nucleotides. Nucleic acid molecules and / or nucleotide sequences provided herein are presented in 5' to 3' directions from left to right herein, and are represented by the standard code for representing nucleotide characters specified in the sequence rules of the World Intellectual Property Organization (WIPO) standard ST.26. As used herein, "5' region" can represent the polynucleotide region closest to the 5' end of a polynucleotide. Therefore, for example, the elements in the 5' region of a polynucleotide can be located at any position from the first nucleotide at the 5' end of a polynucleotide to the nucleotide located in the middle of a polynucleotide. As used herein, "3' region" can represent the polynucleotide region closest to the 3' end of a polynucleotide. Thus, for example, elements in the 3' region of a polynucleotide can be located anywhere from the first nucleotide at the 3' end of the polynucleotide to a nucleotide located in the middle of the polynucleotide.

[0139] As used herein with respect to nucleic acids, the terms "fragment" or "portion" refer to a portion of a nucleic acid that is reduced in length (e.g., by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 400, 450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 610, 620, 630, 640, 650, 660 , 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical to the corresponding portion of the reference nucleic acid.For example, a "fragment" or "portion" (or region) of a nucleic acid encoding a cytokinin-activated polypeptide (e.g., a cytokinin nucleoside 5-monophosphate phosphoribosylhydrolase polypeptide) can be about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221 , 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, 200, 205, 210, 215, 220, 225, 230, 235, 240, 245, 250, 255, 260, 265, 270, 275, 280, 285, 290, 295, 300, 305, 310, 315, 320, 325, 335 0, 335, 340, 345, 350, 355, 360, 365, 370, 375, 380, 385, 390, 395, 400, 420, 440, 460, 480, 500, 520, 540, 560, 580, 600, 620, 640, 660, 680, 690, 700, 750, 800, 850, 900, 950, 1000, 1 100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, 2000, 2100, 2200, 2300, 2400 or 2500 or more consecutive nucleotides, or any range or value therebetween, optionally wherein the fragment, portion or region can be targeted for editing to provide a plant with improved yield traits and / or enhanced root architecture, the improved yield traits and / or enhanced root architecture can produce improved yield traits in the plant. Where appropriate, this nucleic acid fragment can be contained in a larger polynucleotide of which it is a component.As another example, the repeat sequence of the guide nucleic acid of the present invention may include a portion of a wild-type CRISPR-Cas repeat sequence (e.g., a wild-type CRISPR-Cas repeat sequence; for example, a repeat sequence from a CRISPR Cas system, such as Cas9, Cas12a (Cpf1), Cas12b, Cas12c (C2c3), Cas12d (CasY), Cas12e (CasX), Cas12g, Cas12h, Cas12i, C2c4, C2c5, C2c8, C2c9, C2c10, Cas14a, Cas14b and / or Cas14c, etc.).

[0140] In some embodiments, a nucleic acid fragment or portion (or region) may comprise about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 200, 200, 200, 200, 200, 200, 200, 200, 200, 200, 200, 200, 200, 200, 200, 200, 200, 200, 200, 200, 200, 200, 200, 200, 200, 200 5, 190, 195, 200, 205, 210, 215, 220, 225, 230, 235, 240, 245, 250, 255, 260, 265, 270, 275, 280, 285, 290, 295, 300, 305, 310, 315, 320, 325, 330, 335, 340, 345, 350, 355, 360, 365, 370, 375, 380, 385, 390, 395, 400, 420, 440, 460, 480, 500, 520, 540, 560, 580, 600, 620, 640, 660, 680, 690, 700, 750, 800, 850, 900, 950, 1000, 1050, 1100, 1150, 1200, 1250, 1300, 1350, 1400, 1450, 150 1800, 1850, 1900, 1950, 2000, 2050, 2100, 2150, 2200, 2300, 2400 or 2500 contiguous nucleotides or consists essentially of or consists of these contiguous nucleotides, which fragment or portion may comprise a target for LOG gene editing as described herein to provide improved or enhanced root architecture and / or improved yield traits in plants. In some embodiments, the portion or region of the LOG gene that can be targeted for editing can be from about nucleotide 1 to about nucleotide 1200 with reference to the nucleotide numbering of SEQ ID NO: 72 (e.g., SEQ ID NO: 75-78 or 139-151), or from about nucleotide 1 to about nucleotide 2000 with reference to the nucleotide numbering of SEQ ID NO: 79 (e.g., SEQ ID NO: 82-102).

[0141] In some embodiments, a nucleic acid segment or portion (or region) can be edited as described herein, wherein the editing results in a deletion. In some embodiments, the edits can be in a LOG nucleic acid, wherein 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 36, 37, 38, 39, 40, or 45 to about 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 or more consecutive nucleotides can be deleted from the LOG nucleic acid, optionally in reference to the nucleotide numbering of SEQ ID NO: 72 (e.g., SEQ ID NO: 73). 1 to about nucleotide 1200 of SEQ ID NO: 75-78 or 139-151), or in the region from about nucleotide 1 to about nucleotide 2000 with reference to the nucleotide numbering of SEQ ID NO: 79 (e.g., SEQ ID NO: 82-102). In some embodiments, the nucleotide deletion of the LOG gene as described herein can produce a semi-dominant mutation and / or a hypomorphic mutation, which, when included in a plant, can result in a plant that exhibits enhanced root architecture and / or increased yield traits compared to a plant that does not contain the deletion.

[0142] As used herein with respect to polypeptides, the term "fragment" or "portion" may refer to a polypeptide that is reduced in length relative to a reference polypeptide and comprises, consists essentially of, and / or consists of an amino acid sequence of contiguous amino acids that are identical or nearly identical (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical) to the corresponding portion of the reference polypeptide. Where appropriate, such a polypeptide fragment may be included in a larger polypeptide of which it is a component. In some embodiments, the polypeptide fragment comprises, consists essentially of, or consists of at least about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 200, 225, 250, 260, 270, 280, 290, 300, 350, 400, or more consecutive amino acids of a reference polypeptide.

[0143] A "region" of a polynucleotide or polypeptide refers to a portion of consecutive nucleotides or consecutive amino acid residues of the polynucleotide or polypeptide, respectively. For example, a "region" of a LOG polynucleotide sequence may include, but is not limited to, consecutive nucleotides in a region from about nucleotide 1 to about nucleotide 1200 with reference to the nucleotide numbering of SEQ ID NO: 72 (e.g., a region having a nucleotide sequence of any one of SEQ ID NOs: 75-78 or 139-151), or a region from about nucleotide 1 to about nucleotide 2000 with reference to the nucleotide numbering of SEQ ID NO: 79 (e.g., a region having a nucleotide sequence of any one of SEQ ID NOs: 82-102).

[0144] In some embodiments, a "sequence-specific nucleic acid binding domain" (e.g., a sequence-specific DNA binding domain; e.g., a sequence-specific DNA binding polypeptide / protein) can bind to a LOG gene (e.g., SEQ ID NO: 72, SEQ ID NO: 79), and / or to one or more fragments, parts or regions of a LOG gene (e.g., a part or region 5' of the first exon of a LOG gene as described herein, e.g., SEQ ID NOs: 75-78 139-151 and / or 82-102).

[0145] As used herein with respect to nucleic acids, the term "functional fragment" refers to a nucleic acid encoding a functional fragment of a polypeptide. A "functional fragment" with respect to a polypeptide is a fragment of a polypeptide that retains one or more activities of a native reference polypeptide.

[0146] As used herein, the term "gene" refers to a nucleic acid molecule that can be used to produce mRNA, antisense RNA, miRNA, anti-microRNA antisense oligodeoxyribonucleotides (AMOs), etc. A gene may or may not be used to produce a functional protein or gene product. A gene may include coding regions and non-coding regions (e.g., introns, regulatory elements, promoters, enhancers, termination sequences, and / or 5' and 3' untranslated regions). A gene can be "isolated," which means that the nucleic acid is substantially or substantially free of components that are usually present with the nucleic acid under natural conditions. Such components include other cell materials, culture media from recombinant production, and / or various chemicals for chemically synthesizing nucleic acids.

[0147] The term "mutation" refers to a point mutation (e.g., missense or nonsense, or insertion or deletion of a single base pair resulting in a frameshift), insertion, deletion, and / or truncation. When a mutation is a replacement of one residue within an amino acid sequence by another residue, or a deletion or insertion of one or more residues within a sequence, the mutation is typically described by identifying the original residue, followed by the position of the residue within the sequence, and the identity of the newly replaced residue. In some embodiments, the mutation may be a deletion or insertion in an endogenous LOG nucleic acid (e.g., LOG1, LOG5). In some embodiments, the deletion or insertion may be in a cis-regulatory element of an endogenous LOG gene (e.g., the 5' region of the first exon of a LOG gene as described herein). In some embodiments, the cis-regulatory element of an endogenous LOG gene may be a promoter, an enhancer, a silencer, or an insulator. In some embodiments, a mutation in a cis-regulatory element of an endogenous LOG gene of a plant produces a plant with an enhanced root architecture and / or improved yield traits.

[0148] As used herein, a "cis-regulatory element" of an endogenous LOG gene (e.g., LOG1, LOG5) refers to a regulatory element located in a region of the LOG gene that is 5' of the start codon of the first exon in the LOG gene. For example, the cis-regulatory element can be located in the LOG gene at about nucleotide 1 to about nucleotide 1200 with reference to the nucleotide numbering of SEQ ID NO: 72 (e.g., SEQ ID NOs: 75-78 or 139-151), and / or at about nucleotide 1 to about nucleotide 2000 with reference to the nucleotide numbering of SEQ ID NO: 79 (e.g., SEQ ID NOs: 82-102).

[0149] As used herein, the terms "complementary" or "complementarity" refer to the natural binding of polynucleotides by base pairing under permissive salt and temperature conditions. For example, the sequence "AGT" (5' to 3') binds to the complementary sequence "TCA" (3' to 5'). The complementarity between two single-stranded molecules can be "partial", in which only some of the nucleotides bind, or it can be complete when there is complete complementarity between the single-stranded molecules. The degree of complementarity between nucleic acid chains has a significant effect on the efficiency and strength of hybridization between nucleic acid chains.

[0150] As used herein, "complement" can mean 100% complementarity to a compared nucleotide sequence, or it can mean less than 100% complementarity to a compared nucleotide sequence (e.g., about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, etc. complementarity, e.g., substantial complementarity).

[0151] Different nucleic acids or proteins with homology are referred to herein as "homologs". The term homolog includes homologous sequences from the same species and other species and orthologous sequences from the same species and other species." Homology " refers to the level of similarity between two or more nucleic acid and / or amino acid sequences, expressed as a percentage of positional identity (i.e., sequence similarity or identity). Homology also refers to the concept of having similar functional properties between different nucleic acids or proteins. Therefore, the compositions and methods of the present invention also include homologs of the nucleotide sequences and polypeptide sequences of the present invention. As used herein, "orthologs" refer to homologous nucleotide sequences and / or amino acid sequences in different species, which are derived from common ancestral genes during the process of speciation. Homologs of the nucleotide sequences of the invention have substantial sequence identity (e.g., at least about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 100%) to the nucleotide sequences of the invention.

[0152] As used herein, "sequence identity" refers to the degree to which two optimally aligned polynucleotide or polypeptide sequences are unchanged over the entire component (e.g., nucleotide or amino acid) comparison window. "Identity" can be readily calculated by known methods, including but not limited to the methods described in the following documents: Computational Molecular Biology (Lesk, AM ed.) Oxford University Press, New York (1988); Biocomputing: Informatics and Genome Projects (Smith, DW ed.) Academic Press, New York (1993); Computer Analysis of Sequence Data, Part I (Griffin, AM and Griffin, HG ed.) Humana Press, New Jersey (1994); Sequence Analysis in Molecular Biology (von Heinje, G. ed.) Academic Press (1987); and Sequence Analysis Primer (Gribskov, M. and Devereux, J. ed.) Stockton Press, New York (1991).

[0153] As used herein, the term "percent sequence identity" or "percent identity" refers to the percentage of identical nucleotides in a linear polynucleotide sequence of a reference ("query") polynucleotide molecule (or its complementary strand) compared to a test ("subject") polynucleotide molecule (or its complementary strand) when the two sequences are optimally aligned. In some embodiments, "percent sequence identity" may refer to the percentage of identical amino acids in an amino acid sequence compared to a reference polypeptide.

[0154] As used herein, the phrases "substantially identical" or "substantial identity" in the context of two nucleic acid molecules, nucleotide sequences, or polypeptide sequences, means that two or more sequences or subsequences have at least about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 100% nucleotide or amino acid residue identity when compared and aligned for maximum correspondence as determined using one of the following sequence comparison algorithms, or by visual inspection. In some embodiments of the invention, substantial identity exists over a region of contiguous nucleotides of a nucleotide sequence of the invention, the region being from about 10 nucleotides to about 20 nucleotides, from about 10 nucleotides to about 25 nucleotides, from about 10 nucleotides to about 30 nucleotides, from about 15 nucleotides to about 25 nucleotides, from about 30 nucleotides to about 40 nucleotides, from about 50 nucleotides to about 60 nucleotides, from about 70 nucleotides to about 80 nucleotides, from about 90 nucleotides to about 100 nucleotides, from about 100 nucleotides to about 200 nucleotides, from about 100 nucleotides to about 300 nucleotides, from about 100 nucleotides to about 400 nucleotides, from about 100 nucleotides to about 500 nucleotides, from about 100 nucleotides to about 600 nucleotides, from about 100 nucleotides to about 800 nucleotides, from about 100 nucleotides to about 900 nucleotides, or more, and any ranges therein, up to the full length of the sequence. In some embodiments, a nucleotide sequence may be present in at least about 20 consecutive nucleotides (e.g., about 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 50, 60, 70, 80, 90, 100, 200, 300, 311, 32, 33, 34, 35, 36, 37, 38, 39, 40, 50, 60, 70, 80, 90, 100, 200, 300, 312, 321, 33 , 400, 500, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, 2000, 2100, 2200, 2300, 2500, 3000, 3500, 4000 or more nucleotides).In some embodiments, two or more LOG genes can be in a LOG gene such as SEQ ID NO: 72 or SEQ ID 200, 200, 2000, 2005, 2000, 2000, 2000, 2000, 2000, 2000, 2000, 2000, 2000, 2000, 2000, 2000, 2000, 2000, 2000, 2000, 2000, 2000, 2000, 2000, 2000, 2000, 2000, 2000, 2000, 2000, 2000, 2000, 2000, 2000, 2000, 2000, 2000, 2000, 2000, 2000, 2000, 2000, 2000, 2000, 2000, 2000, 2000, 400, 4500, 4600, 4700, 4800, 4900, 5000, 5100, 5200 or 5300 or more consecutive nucleotides, optionally in a LOG gene such as SEQ ID NO: 72 or SEQ ID NO: 73. NO:79 of about 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 420, 440, 450. , 500, 520, 540, 560, 580, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, 2000, 2100, 2200, 2300, 2400, or 2500 consecutive nucleotides.

[0155] In some embodiments of the invention, substantial identity exists over a region of contiguous amino acid residues of a polypeptide of the invention that is from about 3 amino acid residues to about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 amino acid residues, from about 5 amino acid residues to about 25, 30, 35, 40, 45, 50, or 60 amino acid residues, from about 15 amino acid residues to about 30 amino acid residues, from about 20 amino acid residues to about 40 amino acid residues, from about 25 amino acid residues to about 40 amino acid residues, The invention relates to a polypeptide having a sequence of at least one amino acid residue and a base, about 25 amino acid residues to about 50 amino acid residues, about 30 amino acid residues to about 50 amino acid residues, about 40 amino acid residues to about 50 amino acid residues, about 40 amino acid residues to about 70 amino acid residues, about 50 amino acid residues to about 70 amino acid residues, about 60 amino acid residues to about 80 amino acid residues, about 70 amino acid residues to about 80 amino acid residues, about 90 amino acid residues to about 100 amino acid residues or more, and any ranges therein, up to the full length of the sequence. In some embodiments, the polypeptide sequence may be at least about 8, 9, 10, 11, 12, 13, 14, or more consecutive amino acid residues (e.g., about 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75 175, 200, 225, 250, 275, 300, 325, 350, 400, 450, 500 or more amino acids or more consecutive amino acid residues) are substantially identical to each other.In some embodiments, the two or more polypeptides encoded by the LOG gene can be over at least about 10 to about 280 consecutive amino acid residues of an amino acid sequence, such as SEQ ID NO: 74 or SEQ ID NO: 81; for example, over at least about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 60, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 85, 90, 95, 100, 105, 110, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155 140, 145, 150, 155, 160, 165, 170, 175, 200, 205, 210, 215, 220, 225, 230, 235, 240, 245, 250, 255, 260, 265, 270, 275 or 280 or more consecutive amino acid residues are substantially identical to each other. In some embodiments, substantially identical nucleotide or protein sequences can perform substantially the same function as the substantially identical nucleotides (or encoded protein sequences) thereof.

[0156] For sequence comparison, usually one sequence acts as a reference sequence compared to a test sequence. When using a sequence comparison algorithm, the test sequence and the reference sequence are input into a computer, subsequence coordinates are specified if necessary, and sequence algorithm program parameters are specified. Then, the sequence comparison algorithm calculates the sequence identity percentage of the test sequence relative to the reference sequence based on the specified program parameters.

[0157] Optimal alignment of sequences for comparison windows is well known to those skilled in the art and can be performed by tools such as the local homology algorithm of Smith and Waterman, the homology alignment algorithm of Needleman and Wunsch, the similarity search method of Pearson and Lipman, and optionally by computerized implementations of these algorithms, such as GAP, BESTFIT, FASTA and TFASTA, which can be used as Wisconsin (Accelrys Inc., San Diego, CA). The "identity score" for the aligned segments of a test sequence and a reference sequence is the number of identical components shared by the two aligned sequences divided by the total number of components in the reference sequence segment (e.g., the entire reference sequence or a smaller defined portion of the reference sequence). The percent sequence identity is expressed as the identity score multiplied by 100. The comparison of one or more polynucleotide sequences can be a comparison with a full-length polynucleotide sequence or a portion thereof, or a comparison with a longer polynucleotide sequence. For purposes of the present invention, "percent identity" can also be determined for translated nucleotide sequences using BLASTX version 2.0, and "percent identity" can be determined for polynucleotide sequences using BLASTN version 2.0.

[0158] When two nucleotide sequences hybridize to each other under stringent conditions, the two sequences may also be considered to be substantially complementary. In some embodiments, two nucleotide sequences that are considered to be substantially complementary hybridize to each other under highly stringent conditions.

[0159] In the context of nucleic acid hybridization experiments (such as Southern and Northern hybridizations), "stringent hybridization conditions" and "stringent hybridization wash conditions" are sequence-dependent and are different under different environmental parameters. An extensive guide to nucleic acid hybridization can be found in Tijssen Laboratory Techniques in Biochemistry and Molecular Biology-Hybridization with Nucleic Acid Probes Part I Chapter 2 "Overview of principles of hybridization and the strategy of nucleic acid probe assays" Elsevier, New York (1993). In general, highly stringent hybridization and wash conditions are selected to be higher than the thermal melting point (Tf) for a specific sequence at a defined ionic strength and pH. m ) is about 5℃ lower.

[0160] T m It is the temperature (under defined ionic strength and pH) at which 50% of the target sequence hybridizes to a perfectly matched probe. Very stringent conditions are chosen to be equal to the T for a specific probe. m. In Southern or Northern blotting, an example of stringent hybridization conditions for hybridization of complementary nucleotide sequences with more than 100 complementary residues on a filter membrane is hybridization with 50% formamide and 1 mg of heparin at 42°C overnight. An example of highly stringent washing conditions is washing with 0.15M NaCl at 72°C for about 15 minutes. An example of stringent washing conditions is washing with 0.2x SSC at 65°C for 15 minutes (for a description of SSC buffer, see Sambrook below). Typically, a low stringency wash is performed before a high stringency wash to remove background probe signals. For example, an example of a medium stringency wash for a duplex of more than 100 nucleotides is washing with 1xSSC at 45°C for 15 minutes. For example, an example of a low stringency wash for a duplex of more than 100 nucleotides is washing with 4-6x SSC at 40°C for 15 minutes. For short probes (e.g., about 10 to 50 nucleotides), stringent conditions typically involve a salt concentration of less than about 1.0 M Na ion, typically about 0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to 8.3, and a temperature of typically at least about 30° C. Stringent conditions may also be achieved by adding a destabilizing agent such as formamide. In general, a signal-to-noise ratio of 2 times (or higher) that observed for an unrelated probe in a particular hybridization assay indicates that specific hybridization has been detected. Nucleotide sequences that do not hybridize to each other under stringent conditions are still substantially identical if the proteins encoded by the nucleotide sequences are substantially identical. This occurs, for example, when a copy of a nucleotide sequence is produced using the maximum codon degeneracy allowed by the genetic code.

[0161] The polynucleotides and / or recombinant nucleic acid constructs (e.g., expression cassettes and / or vectors) of the present invention may be codon optimized for expression. In some embodiments, the polynucleotides, nucleic acid constructs, expression cassettes and / or vectors of the editing systems of the present invention (e.g., comprising / encoding sequence-specific DNA binding domains / proteins (e.g., sequence-specific DNA binding domains / proteins from the following: polynucleotide-guided endonucleases, zinc finger nucleases, transcription activator-like effector nucleases (TALENs), Argonaute proteins and / or CRISPR-Cas endonucleases (e.g., CRISPR-Cas effector proteins) (e.g., type I CRISPR-Cas effector proteins, type II CRISPR-Cas effector proteins, type III CRISPR-Cas effector proteins, type IV CRISPR-Cas effector proteins) R-Cas effector protein, V-type CRISPR-Cas effector protein or VI-type CRISPR-Cas effector protein)), nucleases (e.g., endonucleases (e.g., Fok1), polynucleotide-guided endonucleases, CRISPR-Cas endonucleases (e.g., CRISPR-Cas effector proteins), zinc finger nucleases and / or transcription activator-like effector nucleases (TALENs)), deaminase proteins / domains (e.g., adenine deaminase, cytosine deaminase), polynucleotides encoding reverse transcriptase proteins or domains, polynucleotides encoding 5'-3' exonuclease polypeptides and / or affinity polypeptides, peptide tags, etc.) can be codon-optimized for expression in plants. In some embodiments, a codon-optimized nucleic acid, polynucleotide, expression cassette, and / or vector of the invention has about 70% to about 99.9% (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100%) or more identity to a reference nucleic acid, polynucleotide, expression cassette, and / or vector that has not been codon-optimized.

[0162] The polynucleotides or nucleic acid constructs of the present invention may be operably associated with a variety of promoters and / or other regulatory elements for expression in plants and / or plant cells. Therefore, in some embodiments, the polynucleotides or nucleic acid constructs of the present invention may also include one or more promoters, introns, enhancers and / or terminators operably connected to one or more nucleotide sequences. In some embodiments, a promoter may be operably associated with an intron (e.g., Ubil promoter and intron). In some embodiments, a promoter associated with an intron may be referred to as a "promoter region" (e.g., Ubil promoter and intron) (see, e.g., SEQ ID NO: 21 and SEQ ID NO: 22).

[0163] As used herein, "operably linked" or "operably associated" in relation to a polynucleotide means that the indicated elements are functionally related to each other, and usually also physically related. Thus, as used herein, the term "operably linked" or "operably associated" refers to functionally associated nucleotide sequences on a single nucleic acid molecule. Thus, a first nucleotide sequence that is operably linked to a second nucleotide sequence refers to a situation where the first nucleotide sequence is in a functional relationship with the second nucleotide sequence. For example, if a promoter affects the transcription or expression of a nucleotide sequence, then the promoter is operably associated with the nucleotide sequence. Those skilled in the art will understand that a control sequence (e.g., a promoter) does not have to be adjacent to the nucleotide sequence to which it is operably associated, as long as the function of the control sequence is to direct its expression. Thus, for example, there may be an intervening untranslated but transcribed nucleic acid sequence between a promoter and a nucleotide sequence, and the promoter may still be considered to be "operably linked" to the nucleotide sequence.

[0164] As used herein, the term "linked" in relation to a polypeptide refers to the connection of one polypeptide to another polypeptide. A polypeptide can be linked to another polypeptide (at the N-terminus or C-terminus) directly (eg, via a peptide bond) or via a linker.

[0165] The term "joint" is recognized in the art and refers to a chemical group or molecule that connects two molecules or parts, such as two domains of a fusion protein, such as, for example, a nucleic acid binding polypeptide or domain (e.g., a DNA binding domain / polypeptide) and a peptide tag and / or a reverse transcriptase and an affinity polypeptide bound to the peptide tag; or a DNA endonuclease polypeptide or domain and a peptide tag and / or a reverse transcriptase and an affinity polypeptide bound to the peptide tag. The joint may be composed of a single connecting molecule, or may contain more than one connecting molecule. In some embodiments, the joint may be an organic molecule, a group, a polymer, or a chemical moiety, such as a divalent organic moiety. In some embodiments, the joint may be an amino acid, or may be a peptide. In some embodiments, the joint is a peptide.

[0166] In some embodiments, the length of a peptide linker useful in the invention can be from about 2 to about 100 or more amino acids, for example, about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75 , 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100 or more amino acids (e.g., about 2 to about 40, about 2 to about 50, about 2 to about 60, about 4 to about 40, about 4 to about 50, about 4 to about 60, about 5 to about 40, about 5 to about 50, about 5 to about 60 35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,50,51,52,53,54,55,56,57,58,59,50,51,52,53,54,55,56,57,58,59,50,51,52,53,54,55,56,57,58,59,50,51,52,53,54,55,56,57,58,59,50 In some embodiments, the peptide linker can be a GS linker.

[0167] As used herein, the term "connection" or "fusion" related to polynucleotides refers to the connection of one polynucleotide to another polynucleotide. In some embodiments, two or more polynucleotide molecules can be connected by a joint, which can be an organic molecule, a group, a polymer or a chemical part, such as a divalent organic part. Polynucleotides can be connected or fused to another polynucleotide (at the 5' end or 3' end) by covalent or non-covalent bonds or in conjunction (including, for example, by Watson-Crick base pairing or by one or more connecting nucleotides). In some embodiments, a polynucleotide motif of a certain structure can be inserted into another polynucleotide sequence (for example, an extension of a hairpin structure in a guide RNA). In some embodiments, the connecting nucleotides can be naturally occurring nucleotides. In some embodiments, the connecting nucleotides can be non-naturally occurring nucleotides.

[0168] "Promoter" is a nucleotide sequence that controls or regulates the transcription of a nucleotide sequence (e.g., a coding sequence) operably associated with the promoter. The coding sequence controlled or regulated by the promoter can encode a polypeptide and / or a functional RNA. Generally, "promoter" refers to a nucleotide sequence that contains a binding site for RNA polymerase II and guides transcription initiation. In general, the promoter is located at 5' or upstream of the start of the coding region of the corresponding coding sequence. The promoter may include other elements that act as gene expression regulatory factors; for example, a promoter region. These include a TATA box consensus sequence, and generally also include a CAAT box consensus sequence (Breathnach and Chambon, (1981) Annu. Rev. Biochem. 50: 349). In plants, the CAAT box can be replaced by an AGGA box (Messing et al., (1983) in Genetic Engineering of Plants, T. Kosuge, C. Meredith and A. Hollaender (eds.), Plenum Press, pp. 211-227).

[0169] Promoters useful in the present invention may include, for example, constitutive, inducible, temporally regulated, developmentally regulated, chemically regulated, tissue-preferred and / or tissue-specific promoters for use in preparing recombinant nucleic acid molecules, for example, "synthetic nucleic acid constructs" or "protein-RNA complexes." These different types of promoters are known in the art.

[0170] The selection of promoters may vary depending on the temporal and spatial requirements of expression, and may also vary depending on the host cell to be transformed. Promoters for many different organisms are well known in the art. Based on the extensive knowledge available in the art, appropriate promoters may be selected for a particular host organism of interest. Thus, for example, promoters upstream of genes that are highly constitutively expressed in model organisms are well known, and this knowledge may be easily obtained and implemented in other systems where appropriate.

[0171] In some embodiments, a promoter functional in plants can be used with the construct of the present invention. Non-limiting examples of promoters that can be used to drive expression in plants include the promoter of RubisCo small subunit gene 1 (PrbcS1), the promoter of the actin gene (Pactin), the promoter of the nitrate reductase gene (Pnr), and the promoter of the repeat carbonic anhydrase gene 1 (Pdca1) (see Walker et al., Plant Cell Rep. 23: 727-735 (2005); Li et al., Gene 403: 132-142 (2007); Li et al., Mol Biol. Rep. 37: 1143-1154 (2010)). PrbcS1 and Pactin are constitutive promoters, and Pnr and Pdca1 are inducible promoters. Pnr is induced by nitrate and repressed by ammonium (Li et al., Gene 403: 132-142 (2007)), and Pdca1 is induced by salt (Li et al., Mol Biol. Rep. 37: 1143-1154 (2010)). In some embodiments, the promoter useful in the present invention is an RNA polymerase II (Pol II) promoter. In some embodiments, the U6 promoter or 7SL promoter from corn (Zea mays) can be used in the constructs of the present invention. In some embodiments, the U6c promoter and / or the 7SL promoter from corn can be used to drive the expression of the guide nucleic acid. In some embodiments, the U6c promoter, U6i promoter and / or 7SL promoter from soybean (Glycine max) can be used in the constructs of the present invention. In some embodiments, the U6c promoter, U6i promoter and / or 7SL promoter from soybean can be used to drive the expression of the guide nucleic acid.

[0172] Examples of constitutive promoters useful in plants include, but are not limited to, the cestrumvirus promoter (cmp) (U.S. Pat. No. 7,166,770), the rice actin 1 promoter (Wang et al. (1992) Mol. Cell. Biol. 12:3399-3406; and U.S. Pat. No. 5,641,876), the CaMV 35S promoter (Odell et al. (1985) Nature 313:810-812), the CaMV 19S promoter (Lawton et al. (1987) Plant Mol. Biol. 9:315-324), the nos promoter (Ebert et al. (1987) Proc. Natl. Acad. Sci USA 84:5745-5749), the Adh promoter (Walker et al. (1987) Proc. Natl. Acad. Sci. USA 84:6624-6629), the sucrose synthase promoter (Yang and Russell (1990) Proc. Natl. Acad. Sci. USA 87:4144-4148), and the ubiquitin promoter. Constitutive promoters derived from ubiquitin accumulate in many cell types. The ubiquitin promoter has been cloned from several plant species for use in transgenic plants, for example, sunflower (Binet et al., 1991. Plant Science 79:87-94), corn (Christensen et al., 1989. Plant Molec. Biol. 12:619-632), and Arabidopsis thaliana (Norris et al., 1993. Plant Molec. Biol. 21:895-906). The maize ubiquitin promoter (UbiP) has been developed in transgenic monocot systems, and its sequence and vectors constructed for monocot transformation are disclosed in patent publication EP 0 342 926. The ubiquitin promoter is suitable for expressing the nucleotide sequence of the present invention in transgenic plants, especially monocots. In addition, the promoter expression cassette described by McElroy et al. (Mol. Gen. Genet. 231: 150-160 (1991)) can be easily modified for expression of the nucleotide sequence of the present invention, and is particularly suitable for monocot hosts.

[0173] In some embodiments, tissue-specific / tissue-preferred promoters can be used to express heterologous polynucleotides in plant cells. Tissue-specific or preferred expression patterns include, but are not limited to, green tissue-specific or preferred, root-specific or preferred, stem-specific or preferred, flower-specific or preferred, or pollen-specific or preferred. Promoters suitable for expression in green tissues include many promoters of genes involved in photosynthesis, many of which are cloned from monocots and dicots. In one embodiment, a promoter useful in the present invention is the corn PEPC promoter (Hudspeth and Grula, Plant Molec. Biol. 12: 579-589 (1989)) from the phosphoenol carboxylase gene. Non-limiting examples of tissue-specific promoters include those associated with genes encoding seed storage proteins (such as β-conglycinin, cruciferin, napin, and phaseolin), zein or oil body proteins (such as oleosin), or proteins involved in fatty acid biosynthesis (including acyl carrier protein, stearoyl-ACP desaturase, and fatty acid desaturase (fad 2-1), as well as other nucleic acids expressed during embryo development (such as Bce4, see, e.g., Kridl et al. (1991) Seed Sci. Res. 1: 209-219; and EP Patent No. 255378). Tissue-specific or tissue-preferred promoters useful for expressing the nucleotide sequences of the present invention in plants, particularly corn, include, but are not limited to, those that direct expression in roots, pith, leaves, or pollen. Such promoters are disclosed, for example, in WO 93 / 07278 (incorporated herein by reference in its entirety).Other non-limiting examples of tissue-specific or tissue-preferred promoters that can be used in the present invention are the cotton rubisco promoter disclosed in U.S. Pat. No. 6,040,504; the rice sucrose synthase promoter disclosed in U.S. Pat. No. 5,604,121; the root-specific promoter described by de Framond (FEBS 290: 103-106 (1991); EP 0 452 269 to Ciba-Geigy); the stem-specific promoter described in U.S. Pat. No. 5,625,136 (to Ciba-Geigy), which drives expression of the maize trpA gene; the tuberose yellow leaf curl virus promoter disclosed in WO 01 / 73087; and pollen-specific or -preferred promoters, including but not limited to ProOsLPS10 and ProOsLPS11 from rice (Nguyen et al., Plant Biotechnol. Reports 2004). 9(5):297-306(2015)), ZmSTK2_USP from maize (Wang et al., Genome 60(6):485-495(2017)), LAT52 and LAT59 from tomato (Twell et al., Development 109(3):705-713(1990)), Zm13 (U.S. Patent No. 10,421,972), and PLA from Arabidopsis thaliana. 2 -δ promoter (U.S. Pat. No. 7,141,424) and / or the ZmC5 promoter from maize (International PCT Publication No. WO 1999 / 042587).

[0174] Additional examples of plant tissue-specific / tissue-preferred promoters include, but are not limited to, root hair-specific cis-element (RHE) (Kim et al., The Plant Cell 18:2958-2970 (2006)), root-specific promoters RCc3 (Jeong et al., Plant Physiol. 153:185-197 (2010)) and RB7 (U.S. Pat. No. 5,459,252), lectin promoter (Lindstrom et al. (1990) Der. Genet. 11:160-167; and Vodkin (1983) Prog. Clin. Biol. Res. 138:87-98), corn alcohol dehydrogenase 1 promoter (Dennis et al. (1984) Nucleic Acids Res. 12:3983-4000), S-adenosyl-L-methionine synthetase (SAMS) (Vander Mijnsbrugge et al. (1996) Plant and Cell Physiology, 37 (8): 1108-1115), the maize light harvesting complex promoter (Bansal et al. (1992) Proc. Natl. Acad. Sci. USA 89: 3654-3658), the maize heat shock protein promoter (O'Dell et al. (1985) EMBO J. 5: 451-458; and Rochester et al. (1986) EMBO J. 5: 451-458), the pea small subunit RuBP carboxylase promoter (Cashmore, "Nuclear genes encoding the small subunit of ribulose-1,5-bisphosphate carboxylase" pp. 29-39, in: Genetic Engineering of Plants (Hollaender ed., Plenum Press, 1996), 1983; and Poulsen et al. (1986) Mol. Gen. Genet. 205:193-200), the Ti plasmid mannopine synthase promoter (Langridge et al. (1989) Proc. Natl. Acad. Sci. USA 86:3219-3223), the Ti plasmid nopaline synthase promoter (Langridge et al. (1989), supra), the petunia chalcone isomerase promoter (van Tunen et al. (1988) EMBO J. 7:1257-1263), the legume glycine-rich protein 1 promoter (Keller et al. (1989) Genes Dev.3:1639-1646), a truncated CaMV 35S promoter (O'Dell et al. (1985) Nature 313:810-812), a potato glycoprotein promoter (Wenzler et al. (1989) Plant Mol. Biol. 13:347-354), a root cell promoter (Yamamoto et al. (1990) Nucleic Acids Res. 18:7449), a zein promoter (Kriz et al. (1987) Mol. Gen. Genet. 207:90-98; Langridge et al. (1983) Cell 34:1015-1022; Reina et al. (1990) Nucleic Acids Res. 18:6425; Reina et al. (1990) Nucleic Acids Res. 18:7449; and Wandelt et al. (1989) Nucleic Acids Res. 17:2354), globulin-1 promoter (Belanger et al. (1991) Genetics 129:863-872), α-tubulin cab promoter (Sullivan et al. (1989) Mol. Gen. Genet. 215:431-440), PEPCase promoter (Hudspeth and Grula (1989) Plant Mol. Biol. 12:579-589), R gene complex-associated promoter (Chandler et al. (1989) Plant Cell 1:1175-1183) and chalcone synthase promoter (Franken et al. (1991) EMBO J. 10:2605-2612).

[0175] Useful for seed-specific expression is the vicilin promoter (Czako et al. (1992) Mol. Gen. Genet. 235:33-40; and seed-specific promoters disclosed in U.S. Pat. No. 5,625,136). Useful promoters for expression in mature leaves are those that switch at the onset of senescence, such as the SAG promoter from Arabidopsis thaliana (Gan et al. (1995) Science 270:1986-1988).

[0176] In addition, promoters that are functional in chloroplasts can be used. Non-limiting examples of such promoters include phage T3 gene 9 5'UTR and other promoters disclosed in U.S. Patent No. 7,579,516. Other promoters that can be used in the present invention include, but are not limited to, the S-E9 small subunit RuBP carboxylase promoter and the Kunitz trypsin inhibitor gene promoter (Kti3).

[0177] Additional regulatory elements useful in the present invention include, but are not limited to, introns, enhancers, termination sequences, and / or 5' and 3' untranslated regions.

[0178] Introns that can be used in the present invention can be identified in plants and separated from plants, and then inserted into introns in expression cassettes for plant transformation. As will be appreciated by those skilled in the art, introns can include sequences required for self-excision and are incorporated into nucleic acid constructs / expression cassettes in frame. Introns can be used as spacers to separate multiple protein coding sequences in a nucleic acid construct, or introns can be used in a protein coding sequence, for example, to stabilize mRNA. If they are used in a protein coding sequence, they are inserted "in frame" and include excision sites. Introns can also be associated with promoters to improve or modify expression. As an example, promoter / intron combinations that can be used in the present invention include but are not limited to promoter / intron combinations of corn Ubil promoters and introns (see, for example, SEQ ID NO:21 and SEQ ID NO:22).

[0179] Non-limiting examples of introns that can be used in the present invention include introns from the following genes: ADHI gene (e.g., Adh1-S intron 1, 2 and 6), ubiquitin gene (Ubil), RuBisCO small subunit (rbcS) gene, RuBisCO large subunit (rbcL) gene, actin gene (e.g., actin-1 intron), pyruvate dehydrogenase kinase gene (pdk), nitrate reductase gene (nr), repeated carbonic anhydrase gene 1 (Tdca1), psbA gene, atpA gene, or any combination thereof.

[0180] In some embodiments, the polynucleotides and / or nucleic acid constructs of the present invention may be "expression cassettes", or may be contained within expression cassettes. As used herein, "expression cassettes" refer to recombinant nucleic acid molecules comprising, for example, one or more polynucleotides of the present invention (e.g., polynucleotides encoding sequence-specific nucleic acid binding domains (e.g., sequence-specific DNA binding domains), polynucleotides encoding deaminase proteins or domains, polynucleotides encoding reverse transcriptase proteins or domains, polynucleotides encoding 5'-3' exonuclease polypeptides or domains, guide nucleic acids and / or reverse transcriptase (RT) templates), wherein the polynucleotides are operably associated with one or more control sequences (e.g., promoters, terminators, etc.). Thus, in some embodiments, one or more expression cassettes may be provided, which are designed to express, for example, a nucleic acid construct of the invention (e.g., a polynucleotide encoding a sequence-specific nucleic acid binding domain, a polynucleotide encoding a nuclease polypeptide / domain, a polynucleotide encoding a deaminase protein / domain, a polynucleotide encoding a reverse transcriptase protein / domain, a polynucleotide encoding a 5'-3' exonuclease polypeptide / domain, a polynucleotide encoding a peptide tag, and / or a polynucleotide encoding an affinity polypeptide, etc., or comprising a guide nucleic acid, an extended guide nucleic acid, and / or an RT template, etc.). When the expression cassette of the invention comprises more than one polynucleotide, the polynucleotide may be operably linked to a single promoter that drives expression of all polynucleotides, or the polynucleotide may be operably linked to one or more separate promoters (e.g., three polynucleotides may be driven by one, two, or three promoters in any combination). When two or more separate promoters are used, the promoters may be the same promoter, or they may be different promoters. Thus, when contained in a single expression cassette, a polynucleotide encoding a sequence-specific nucleic acid binding domain, a polynucleotide encoding a nuclease protein / domain, a polynucleotide encoding a CRISPR-Cas effector protein / domain, a polynucleotide encoding a deaminase protein / domain, a polynucleotide encoding a reverse transcriptase polypeptide / domain (e.g., an RNA-dependent DNA polymerase) and / or a polynucleotide encoding a 5'-3' exonuclease polypeptide / domain, a guide nucleic acid, an extended guide nucleic acid and / or an RT template can each be operably linked to a single promoter or separate promoters in any combination.

[0181] The expression cassette comprising the nucleic acid construct of the invention may be chimeric, meaning that at least one of its components is heterologous relative to at least one of its other components (e.g., a promoter from a host organism is operably linked to a polynucleotide of interest to be expressed in the host organism, wherein the polynucleotide of interest is from an organism different from the host, or is not normally associated with the promoter). The expression cassette may also be naturally occurring, but has been obtained in a recombinant form that can be used for heterologous expression.

[0182] The expression cassette may optionally include a transcription and / or translation termination region (i.e., termination region) and / or an enhancer region that is functional in a selected host cell. A variety of transcription terminators and enhancers are known in the art and can be used in expression cassettes. Transcription terminators are responsible for terminating transcription and correcting mRNA polyadenylation. Termination regions and / or enhancer regions may be natural to the transcription initiation region, may be natural to the following: for example, a gene encoding a sequence-specific nucleic acid binding protein, a gene encoding a nuclease, a gene encoding a reverse transcriptase, a gene encoding a deaminase, etc., or may be natural to a host cell, or may be natural to another source (e.g., to a promoter, a gene encoding a sequence-specific nucleic acid binding protein, a gene encoding a nuclease, a gene encoding a reverse transcriptase, a gene encoding a deaminase, etc., or to a host cell, or any combination thereof, exogenous or heterologous).

[0183] The expression cassette of the present invention may also include a polynucleotide encoding a selectable marker that can be used to select transformed host cells. As used herein, a "selectable marker" refers to a polynucleotide sequence that, when expressed, imparts a unique phenotype to the host cell expressing the marker, thereby allowing such transformed cells to be distinguished from cells without the marker. This polynucleotide sequence can encode a selectable or screenable marker, depending on whether the marker imparts a trait that can be selected by chemical means, such as by using a selection agent (e.g., antibiotics, etc.), or whether the marker is simply a trait that can be identified by observation or testing, such as by screening (e.g., fluorescence). Many examples of suitable selectable markers are known in the art and can be used in expression cassettes described herein.

[0184] In addition to expression cassettes, nucleic acid molecules / constructs and polynucleotide sequences described herein can also be used in combination with vectors. The term "vector" refers to a composition for transferring, delivering or introducing nucleic acids (or multiple nucleic acids) into a cell. Vectors include nucleic acid constructs (e.g., expression cassettes) comprising nucleotide sequences to be transferred, delivered or introduced. Vectors for transforming host organisms are well known in the art. Non-limiting examples of general class vectors include viral vectors, plasmid vectors, phage vectors, phagemid vectors, cosmid vectors, fosmid vectors, phages, artificial chromosomes, minicircles or double-stranded or single-stranded linear or circular forms of Agrobacterium binary vectors, which may or may not be self-transferable or removable. In some embodiments, viral vectors may include, but are not limited to, retroviruses, slow viruses, adenoviruses, adeno-associated viruses or herpes simplex virus vectors. Vectors as defined herein can be transformed prokaryotic or eukaryotic hosts by being integrated into the cell genome or being present outside the chromosome (e.g., autonomously replicating plasmids with a replication origin). In addition, shuttle vectors are also included, and shuttle vectors refer to DNA vectors that can be naturally or intentionally replicated in two different host organisms, and host organisms can be selected from actinomycetes and related species, bacteria and eukaryotic organisms (for example, higher plants, mammals, yeast or fungal cells). In some embodiments, the nucleic acid in the vector is controlled by a suitable promoter or other regulatory elements, and is operably connected to a suitable promoter or other regulatory elements so as to be transcribed in a host cell. The vector can be a bifunctional expression vector that works in a variety of hosts. In the case of genomic DNA, this can include its own promoter and / or other regulatory elements, and in the case of cDNA, this can be controlled by a suitable promoter and / or other regulatory elements so as to be expressed in a host cell. Therefore, the nucleic acid or polynucleotide of the present invention and / or the expression cassette comprising the nucleic acid or polynucleotide can be included in a vector as described herein and known in the art.

[0185] As used herein, "contact," "contacting," "contacted," and grammatical variations thereof refer to bringing together the components of a desired reaction under conditions suitable for carrying out the desired reaction (e.g., transformation, transcriptional control, genome editing, nicking and / or cleavage). As an example, a target nucleic acid can be contacted with a sequence-specific nucleic acid binding protein (e.g., a polynucleotide-guided endonuclease, a CRISPR-Cas endonuclease (e.g., a CRISPR-Cas effector protein), a zinc finger nuclease, a transcription activator-like effector nuclease (TALEN) and / or an Argonaute protein)) and a deaminase or a nucleic acid construct encoding these under the following conditions: the sequence-specific nucleic acid protein, the reverse transcriptase and the deaminase are expressed, the sequence-specific nucleic acid binding protein binds to the target nucleic acid, and the reverse transcriptase and / or the deaminase can be fused to the sequence-specific nucleic acid binding protein or recruited to the sequence-specific nucleic acid binding protein (e.g., by a peptide tag fused to the sequence-specific nucleic acid binding protein and an affinity tag fused to the reverse transcriptase and / or the deaminase), so that the deaminase and / or the reverse transcriptase are located near the target nucleic acid, thereby modifying the target nucleic acid. Other methods of recruiting reverse transcriptases and / or deaminases using other protein-protein interactions can be used. In addition, RNA-protein interactions and chemical interactions can be used for protein-protein and protein-nucleic acid recruitment.

[0186] As used herein, "modification" ("modifying" or "modification") of a target nucleic acid includes editing (e.g., mutation), covalent modification, exchange / replacement of nucleic acid / nucleotide bases, deletion, cleavage, nicking, and / or alteration of transcriptional control of a target nucleic acid. In some embodiments, the modification may include any type of one or more single base changes (SNPs).

[0187] The term "modulate" is used in the context of a polypeptide "modulating" a phenotype, e.g., the balance between inactive and active cytokinins in a plant, to refer to the ability of the polypeptide to affect the expression of one or more genes, thereby changing a phenotype such as cytokinin balance.

[0188] "Introducing", "introduce", "introduced" (and grammatical variations thereof) in the context of a polynucleotide of interest refers to presenting a nucleotide sequence of interest (e.g., a polynucleotide, RT template, nucleic acid construct and / or guide nucleic acid) to a plant, a plant part thereof, or a cell thereof in a manner that enables the nucleotide sequence to enter the interior of the cell.

[0189] The terms "transformation" or "transfection" are used interchangeably and as used herein refer to the introduction of a heterologous nucleic acid into a cell. The transformation of a cell can be stable or transient. Thus, in some embodiments, a host cell or host organism (e.g., a plant) can be stably transformed with a polynucleotide / nucleic acid molecule of the present invention. In some embodiments, a host cell or host organism can be transiently transformed with a polynucleotide / nucleic acid molecule of the present invention.

[0190] "Transient transformation" in the context of a polynucleotide means that the polynucleotide is introduced into a cell but is not integrated into the genome of the cell.

[0191] "Stably introduced" or "stably introduced" in the context of a polynucleotide being introduced into a cell means that the introduced polynucleotide is stably incorporated into the genome of the cell, so that the cell is stably transformed with the polynucleotide.

[0192] As used herein, "stable transformation" or "stably transformed" refers to a nucleic acid molecule that is introduced into a cell and integrated into the genome of the cell. Thus, the integrated nucleic acid molecule is capable of being inherited by its progeny, more specifically, by successive generations of progeny. As used herein, "genome" includes nuclear and plastid genomes, and thus includes integration of nucleic acids into, for example, chloroplast or mitochondrial genomes. As used herein, stable transformation may also refer to a transgene that is maintained extrachromosomally, for example, as a minichromosome or plasmid.

[0193] Transient transformation can be detected by, for example, enzyme-linked immunosorbent assay (ELISA) or Western blotting, which can detect the presence of peptides or polypeptides encoded by one or more transgenics introduced into an organism. Stable transformation of cells can be detected by, for example, Southern blot hybridization assays of the genomic DNA of the cells with nucleic acid sequences that specifically hybridize with nucleotide sequences of transgenics introduced into an organism (e.g., a plant). Stable transformation of cells can be detected by, for example, Northern blot hybridization assays of the RNA of the cells with nucleic acid sequences that specifically hybridize with nucleotide sequences of transgenics introduced into a host organism. Stable transformation of cells can also be detected by, for example, polymerase chain reaction (PCR) or other amplification reactions well known in the art, which employ specific primer sequences that hybridize with target sequences of transgenics, resulting in amplification of transgenic sequences, which can be detected according to standard methods. Transformation can also be detected by direct sequencing and / or hybridization protocols well known in the art.

[0194] Thus, in some embodiments, the nucleotide sequences, polynucleotides, nucleic acid constructs and / or expression cassettes of the invention can be transiently expressed and / or they can be stably incorporated into the genome of a host organism. Thus, in some embodiments, the nucleic acid constructs of the invention (e.g., one or more expression cassettes comprising polynucleotides for editing as described herein) can be transiently introduced into a cell along with a guide nucleic acid, and therefore, DNA is not maintained in the cell.

[0195] The nucleic acid construct of the present invention can be introduced into plant cells by any method known to those skilled in the art. The non-limiting examples of transformation methods include conversion by bacterial-mediated nucleic acid delivery (for example, by Agrobacterium), virus-mediated nucleic acid delivery, silicon carbide or nucleic acid whisker-mediated nucleic acid delivery, liposome-mediated nucleic acid delivery, microinjection, microparticle bombardment, calcium phosphate-mediated conversion, cyclodextrin-mediated conversion, electroporation, nanoparticle-mediated conversion, ultrasonic treatment, infiltration, PEG-mediated nucleic acid uptake, and any other electrical, chemical, physical (mechanical) and / or biological mechanism that nucleic acid is introduced into plant cells, including any combination thereof. The program for transforming eukaryotic organisms and prokaryotic organisms is well known in the art and conventional, and is described in the literature (see, for example, Jiang et al., 2013.Nat.Biotechnol.31:233-239; Ran et al., Nature Protocols 8:2281–2308 (2013)). General guides to the various plant transformation methods known in the art include Miki et al. ("Procedures for Introducing Foreign DNA into Plants", in Methods in Plant Molecular Biology and Biotechnology, Glick, BR and Thompson, JE, eds. (CRC Press, Inc., Boca Raton, 1993), pp. 67-88) and Rakowoczy-Trojanowska (Cell. Mol. Biol. Lett. 7:849-858 (2002)).

[0196] In some embodiments of the present invention, the transformation of cells may include nuclear transformation. In other embodiments, the transformation of cells may include plastid transformation (e.g., chloroplast transformation). In further embodiments, nucleic acids of the present invention may be introduced into cells by conventional breeding techniques. In some embodiments, one or more of polynucleotides, expression cassettes and / or vectors may be introduced into plant cells by Agrobacterium transformation.

[0197] Therefore, polynucleotide can be introduced into plant, plant part, plant cell in any number of ways known in the art.Method of the present invention does not rely on the ad hoc method for introducing one or more nucleotide sequences into plant, as long as they can enter the interior of the cell.If more than one polynucleotide is to be introduced, they can be assembled as a part of a single nucleic acid construct or assembled as an independent nucleic acid construct, and can be located on the same or different nucleic acid constructs.Therefore, polynucleotide can be introduced into interested cell in a single transformation event, or introduced into interested cell in an independent transformation event, or alternatively, polynucleotide can be incorporated into plant as a part of a breeding scheme.

[0198] The ability of plants to absorb water and nutrients can limit yield. Therefore, one strategy to improve yield is to breed plants with enhanced root architecture. Steep, rapidly developing root systems allow plants to optimize the uptake of water and nutrients below the shallow soil layer, where water and nutrients are transiently available. In addition, early development of long roots can promote drought tolerance and reduce yield costs associated with water shortages. Finally, steeper root systems can facilitate high-density plantings by limiting interplant competition.

[0199] Current methods for enhancing root architecture involve mutagenesis and transgenic overexpression methods, with some success in improving root architecture. The present invention relates to the production of plants comprising one or more nucleotide modifications within the cis-regulatory elements of LOG genes (e.g., LOG1, LOG5). By modifying the cis-regulatory elements of endogenous LOG genes, improved root architecture can be produced in plants comprising the modifications, optionally wherein the modifications can produce plants exhibiting one or more of the following phenotypes: increased root biomass, steeper root angles, increased lateral root branching and / or longer roots in any combination, optionally wherein the plants comprising the modifications in the LOG genes can further exhibit improved yield traits and / or increased tolerance / resistance to abiotic stress, optionally wherein the abiotic stress is water stress (e.g., drought or salt stress) or limited nitrogen. The present invention will provide the further advantage of producing plants with improved root systems but without transgenes.

[0200] Therefore, in some embodiments, the present invention relates to generating a mutation in an endogenous LOG gene (e.g., LOG1, LOG5), optionally wherein the mutation is in a cis-regulatory element of the LOG gene, optionally in a promoter, enhancer, silencer or insulator. In some embodiments, the modification of the cis-regulatory element of the LOG gene as described herein can reduce or eliminate the negative regulation of the endogenous LOG gene, optionally wherein the modification causes an increase in the expression of the endogenous LOG gene.

[0201] In some embodiments, the present invention provides a plant or plant part thereof comprising at least one mutation in an endogenous LONELY GUY (LOG) gene encoding a cytokinin activated polypeptide, wherein the cytokinin activated polypeptide is a cytokinin nucleoside 5-monophosphate phosphoribohydrolase polypeptide, optionally wherein the at least one mutation may be a non-natural mutation. In some embodiments, the endogenous LOG gene may be an endogenous LOG1 gene and / or an endogenous LOG5 gene. In some embodiments, the at least one mutation in the endogenous LOG gene may be in a cis-regulatory element of the endogenous gene. The cis-regulatory element may include, but is not limited to, a promoter, an enhancer, a silencer, or an insulator, optionally wherein the cis-regulatory element is a promoter. In some embodiments, the cis-regulatory element of the endogenous LOG gene is located in a region of the gene at about nucleotide 1 to about nucleotide 2000, about nucleotide 600 to about nucleotide 1200, about nucleotide 700 to about nucleotide 1000, or about nucleotide 730 to about nucleotide 950 with reference to the nucleotide numbering of SEQ ID NO: 72, optionally the target site is within the region of any one of SEQ ID NOs: 75-78 or 139-151, or within about nucleotide 1 to about nucleotide 2000, about nucleotide 500 to about nucleotide 1900, about nucleotide 700 to about nucleotide 1800, or about nucleotide 950 to about nucleotide 1750 with reference to the nucleotide numbering of SEQ ID NO: 79, optionally the target site is within the region of any one of SEQ ID NOs: 81-120. In some embodiments, a mutation in the cis-regulatory element of an endogenous LOG gene in a plant produces a plant that exhibits improved enhanced root architecture, wherein the improved root architecture is compared to a plant or plant part (e.g., an isogenic plant) that does not contain the same mutation. The improved root configuration may be characterized by one or more of the following phenotypes: increased root biomass, steeper root angles, increased lateral root branching, and / or longer roots in any combination. In some embodiments, plants with altered root configurations may exhibit improved yield traits and / or increased tolerance / resistance to abiotic stress, optionally wherein the abiotic stress is water stress (e.g., drought or salt stress) or limited nitrogen). In some embodiments, mutations in the cis-regulatory elements of endogenous LOG genes in plants produce plants that exhibit improved yield traits, wherein the improved yield traits are compared to plants or plant parts (e.g., isogenic plants) that do not contain the same mutations. The improved yield trait may be characterized by one or more of the following phenotypes: increased KRN in any combination, increased flower number, increased spike length, and / or substantially unchanged spike width.

[0202] In some embodiments, a plant comprising at least one mutation in at least one endogenous LOG gene encoding a cytokinin-activated polypeptide exhibits improved yield traits compared to an isogenic plant that does not comprise the mutation (e.g., a wild-type unedited plant or a null segregant), optionally wherein the at least one mutation may be a non-natural mutation. In some embodiments, a plant comprising at least one mutation in an endogenous LOG gene comprises a mutant LOG gene having at least 90% sequence identity to any one of SEQ ID NOs: 125, 127, or 129-136 and / or encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 126 or SEQ ID NO: 128.

[0203] In some embodiments, the endogenous LOG gene useful in the present invention (a) comprises a nucleotide sequence having at least 80% sequence identity to the nucleotide sequence of any one of SEQ ID NOs:72, 73, 79 or 80; (b) comprises a region having at least 80% sequence identity to any one of the nucleotide sequences of SEQ ID NOs:75-78, 82-120 or 139-151; and / or (c) encodes a sequence having at least 80% sequence identity to any one of the amino acid sequences of SEQ ID NO:74 or SEQ ID NO:81.

[0204] The mutation in the endogenous LONELY GUY (LOG) gene (e.g., LOG1, LOG5) in the plant can be any type of mutation, including but not limited to point mutation, base substitution, base deletion and / or base insertion. In some embodiments, the mutation in the LOG gene can be a non-natural mutation. Mutations useful in the present invention can include but are not limited to substitutions, deletions and / or insertions of one or more bases in the cis-regulatory elements of the endogenous LOG gene. In some embodiments, at least one mutation can comprise a base substitution for A, T, G or C. In some embodiments, plants comprising an endogenous LOG gene having at least one mutation in the LOG gene as described herein exhibit enhanced root architecture, optionally improved yield traits and / or increased tolerance / resistance to abiotic stress, optionally wherein the abiotic stress is water stress (e.g., drought or salt stress) or limited nitrogen, compared to plants not comprising at least one mutation in the LOG gene. In some embodiments, plants comprising an endogenous LOG gene having at least one mutation in a LOG gene as described herein exhibit improved yield characteristics, such as increased KRN, increased flower number, increased ear length and / or substantially unchanged ear width, and optionally increased tolerance / resistance to abiotic stress, optionally wherein the abiotic stress is water stress (e.g., drought or salt stress) or limited nitrogen, compared to plants not comprising the at least one mutation in the LOG gene.

[0205] In some embodiments, the at least one mutation in the endogenous LOG1 gene can be a deletion (e.g., a deletion of one or more consecutive base pairs, such as about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75 4, 45, 46, 47, 48, 49, 50, 55, 60, 65, 70, 75, 80, 85, 90 or 100 or more (e.g., 110, 120, 130, 140, 150, etc.) consecutive base pairs of deletion (e.g., a deletion in the LOG gene region 5' of the first exon). In some embodiments, the deletion may be in a cis-regulatory element of an endogenous LOG gene, wherein the deletion may be located in a region of a LOG gene having at least 80% sequence identity to any one of SEQ ID NOs: 75-78, 82-120, or 139-151, optionally wherein the mutation produces a mutated endogenous LOG gene that is at least 90% identical to a mutated LOG gene as described herein.

[0206] In some embodiments, the mutation as a base insertion can be at least one base pair (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 55, 60, 65, 70, 75, 80, 85, 90, or 100 or more base pairs) are inserted into the LOG gene, optionally into the 5' region of the LOG gene, optionally into a cis-regulatory element of the LOG gene.

[0207] In some embodiments, mutations useful in the present invention may be non-natural mutations. In some embodiments, at least one mutation may be a semi-dominant mutation and / or a hypomorphic mutation. In some embodiments, plants comprising a mutation in a LOG gene as described herein exhibit improved yield traits (exemplary improved yield traits may include, but are not limited to, reduced to no yield loss under biotic or abiotic stress (e.g., yield loss is less than 3%; e.g., less than 0.5%, 1%, 1.5%, 2%, 2.5%, or 3%), increased seed / grain yield per hectare (about 5% to about 75%; e.g., about 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 80%, 81%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89 %, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51% , 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, or 75%), and the ear tip gap is reduced under water stress (the ear tip gap is reduced by about 50% to 100% (e.g., about 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, or 75%). , 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%), wherein a 100% reduction means the absence of tip gaps).

[0208] As used herein, "ear tip gap" means that the kernels at the ear tip have not been filled or have not fully developed. The ear tip usually occupies about 5% to about 20%; for example, about 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20% of the ear tip or any range or value therebetween.

[0209] In some embodiments, a plant cell comprising an editing system is provided, the editing system comprising: (a) a CRISPR-Cas associated effector protein; and (b) a guide nucleic acid (gRNA, gDNA, crRNA, crDNA, sgRNA, sgDNA) comprising a spacer sequence having complementarity to a region of an endogenous LOG target gene encoding a cytokinin nucleoside 5-monophosphate phosphoribosyl hydrolase polypeptide, optionally wherein the editing system further comprises a cytidine deaminase or an adenosine deaminase. In some embodiments, the editing system generates mutations in an endogenous target gene encoding a cytokinin nucleoside 5-monophosphate phosphoribosyl hydrolase polypeptide. The endogenous target gene encoding a cytokinin nucleoside 5-monophosphate phosphoribosyl hydrolase polypeptide can be any LOG gene, wherein when the cis-regulatory element of the endogenous LOG gene in the plant is modified, the plant exhibits an altered root structure and / or improved yield traits. In some embodiments, the endogenous LOG gene is a LOG1 gene and / or a LOG5 gene. In some embodiments, the endogenous LOG gene to which the spacer sequence of the guide nucleic acid is complementary (a) comprises a nucleotide sequence having at least 80% sequence identity to the nucleotide sequence of any one of SEQ ID NOs: 72, 73, 79, or 80; (b) comprises a region having at least 80% sequence identity to any one of the nucleotide sequences of SEQ ID NOs: 75-78, 82-120, or 139-151; and / or (c) encodes a sequence having at least 80% sequence identity to any one of the amino acid sequences of SEQ ID NOs: 74 or SEQ ID NOs: 81. In some embodiments, the spacer sequence useful in the present invention may include, but is not limited to, the nucleotide sequence of any one of SEQ ID NOs: 80-83. In some embodiments, the spacer sequence may comprise the nucleotide sequence of any one of SEQ ID NOs: 121-124, 138, or 139.

[0210] In some embodiments, a plant cell is provided, the plant cell comprising at least one mutation in a cis-regulatory element of a LONELYGUY (LOG) gene, wherein the at least one mutation is a base substitution, base insertion, or base deletion introduced using an editing system comprising a nucleic acid binding domain (e.g., a DNA binding domain) that binds to a target site in the LOG gene, the LOG gene (a) comprising a nucleotide sequence having at least 80% sequence identity to the nucleotide sequence of any one of SEQ ID NOs: 72, 73, 79, or 80; (b) comprising a region having at least 80% sequence identity to any one of the nucleotide sequences of SEQ ID NOs: 75-78, 82-120, or 139-151; and / or (c) encoding a sequence having at least 80% sequence identity to any one of the amino acid sequences of SEQ ID NOs: 74 or SEQ ID NOs: 81. In some embodiments, wherein the cis-regulatory element is a promoter, optionally wherein the at least one mutation reduces or eliminates negative regulation of an endogenous LOG gene, and / or the at least one mutation causes increased expression of an endogenous LOG gene. In some embodiments, the editing system comprises a nucleic acid binding domain that binds to a target site in an endogenous LOG gene, the target site having at least 80% sequence identity to at least 20 consecutive nucleotides (e.g., 20, 21, 22, 23, 24, 25 or more consecutive nucleotides) of a nucleic acid having at least 80% sequence identity to a region of SEQ ID NO: 72 or to a region of SEQ ID NO: 79, wherein the region of SEQ ID NO: 72 is about nucleotide 1 to about nucleotide 2000, about nucleotide 600 to about nucleotide 1200, about nucleotide 700 to about nucleotide 1000, or about nucleotide 700 to about nucleotide 1500, optionally the region of SEQ ID NO: 72 comprises a nucleic acid sequence having at least 80% sequence identity to any one of SEQ ID NOs: 75-78 or 139-151, SEQ ID The region of NO:79 is from about nucleotide 1 to about nucleotide 2000, from about nucleotide 600 to about nucleotide 1900, from about nucleotide 700 to about nucleotide 1800, or from about nucleotide 950 to about nucleotide 1800, optionally the region of SEQ ID NO:79 comprises a nucleic acid sequence having at least 80% sequence identity with any one of SEQ ID NOs:81-120.

[0211] In some embodiments, the nuclease is a zinc finger nuclease, a transcription activator-like effector nuclease (TALEN), an endonuclease (e.g., Fok1), or a CRISPR-Cas effector protein. In some embodiments, the nucleic acid binding domain of the editing system is from a polynucleotide-guided endonuclease, a CRISPR-Cas endonuclease (e.g., a CRISPR-Cas effector protein), a zinc finger nuclease, a transcription activator-like effector nuclease (TALEN), and / or an Argonaute protein.

[0212] In some embodiments, the at least one mutation causes a deletion of all or a portion of the cis-regulatory elements of the endogenous LOG gene. In some embodiments, a deletion of all or a portion of the cis-regulatory elements of the LOG gene reduces or eliminates the negative regulation of the endogenous LOG gene, optionally wherein a deletion of all or a portion of the cis-regulatory elements of the LOG gene causes an increase in the expression of the endogenous LOG gene.

[0213] In some embodiments, the at least one mutation in the LOG gene is a point mutation. In some embodiments, the at least one mutation may be a non-natural mutation. In some embodiments, the at least one mutation may be a base substitution to A, T, G or C, optionally wherein the base substitution results in an amino acid substitution. In some embodiments, the at least one mutation can be at least one or at least two or more (e.g., about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209 In some embodiments, the at least one mutation causes a deletion of all or part of the cis-regulatory elements of the LOG gene, which deletion results in a plant having altered / enhanced root architecture and / or improved yield traits, optionally wherein the deletion may be located at about nucleotide 1 to about nucleotide 2000, about nucleotide 600 to about nucleotide 1200, about nucleotide 700 to about nucleotide 1000, or about nucleotide 730 to about nucleotide 950 with reference to the nucleotide numbering of SEQ ID NO: 72, or at about nucleotide 1 to about nucleotide 2000, about nucleotide 500 to about nucleotide 1900, about nucleotide 700 to about nucleotide 1800, or about nucleotide 950 to about nucleotide 1750 with reference to the nucleotide numbering of SEQ ID NO: 79. In some embodiments, the at least one mutation may be a semi-dominant mutation and / or a hypomorphic mutation.

[0214] Non-limiting examples of plants or parts thereof that can be used in the present invention include any monocot or dicot plant, including but not limited to corn, soybean, canola, wheat, rice, cotton, sugarcane, sugar beet, barley, oats, alfalfa, sunflower, safflower, oil palm, sesame, coconut, tobacco, potato, sweet potato, cassava, coffee tree, apple, plum, apricot, peach, cherry, pear, fig, banana, citrus, cocoa, avocado, olive, almond, walnut, strawberry, watermelon, pepper, grape, tomato, cucumber, blackberry, raspberry, black raspberry or Brassica spp. In some embodiments, the plant or part thereof can be a corn plant or a part of a corn plant. In some embodiments, the plant can be regenerated from a plant part, which includes but is not limited to a plant cell of the present invention. In some embodiments, the plant of the present invention comprising at least one mutation in an endogenous LOG gene comprises an altered root configuration and / or improved yield traits, optionally wherein the plant can exhibit increased tolerance / resistance to abiotic stress.

[0215] In some embodiments, the plant or part thereof comprising a mutation as described herein may be a corn plant or part thereof, wherein the corn plant or part thereof comprises at least one mutation in the endogenous LONELY GUY (LOG) gene with gene identification number (gene ID) Zm00001d003013 (LOG1) or Zm00001d043692 (LOG5), optionally wherein the at least one mutation may be a non-natural mutation.

[0216] Also provided herein is a method of providing a plurality of plants having altered root architecture and / or improved yield traits, the method comprising planting two or more plants of the invention (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 100, 200, 300, 400, 500, 1000, 2000, 3000, 400, 5000, or 10,000 or more plants) in a growing area, thereby providing a plurality of plants having altered root architecture and / or improved yield traits as compared to a plurality of control plants not comprising the at least one mutation (e.g., compared to an isogenic wild type plant not comprising the mutation). The invention relates to a method for producing a plurality of plants having a modified root configuration and / or improved yield traits, wherein the plurality of plants having the modified root configuration exhibit increased root biomass, steeper root angle, increased lateral root branching and / or longer roots in any combination, and / or improved yield traits and / or increased tolerance / resistance to abiotic stress, wherein the abiotic stress may be water stress (e.g., drought or salt stress) or limited nitrogen, and / or wherein the plurality of plants having the improved yield traits exhibit increased KRN, increased flower number, increased fringe length and / or substantially unchanged fringe width. The growing region may be any region where a plurality of plants may be planted together, including but not limited to fields (e.g., cultivated land, farmland), growth chambers, greenhouses, recreational areas, lawns and / or roadsides, etc.

[0217] In some embodiments, a method for producing / cultivating a transgenic-free edited (e.g., base-edited) plant is provided, the method comprising: crossing a plant of the present invention (e.g., a plant comprising a mutation in a LOG gene (e.g., LOG1, LOG5) and having an altered root architecture and / or improved yield trait) with a transgenic-free plant, thereby introducing the at least one mutation into the transgenic-free plant (e.g., into a progeny plant); and selecting a progeny plant comprising the at least one mutation and being transgenic-free, thereby producing a transgenic-free edited plant.

[0218] In some embodiments, a method for editing a specific site in the genome of a plant cell is provided, the method comprising: cleaving a target site within an endogenous LONELY DOG (LOG) gene in the plant cell in a site-specific manner, the endogenous LOG gene: (a) comprising a nucleotide sequence having at least 80% sequence identity to the nucleotide sequence of any one of SEQ ID NOs:72, 73, 79 or 80; (b) comprising a region having at least 80% sequence identity to any one of the nucleotide sequences of SEQ ID NOs:75-78, 82-120 or 139-151; and / or (c) encoding a sequence having at least 80% sequence identity to any one of the amino acid sequences of SEQ ID NO:74 or SEQ ID NO:81, thereby producing an edit in the endogenous LOG gene of the plant cell. In some embodiments, the edit in the endogenous LOG gene can be in a cis-regulatory element of the endogenous LOG gene, optionally wherein the cis-regulatory element of the endogenous LOG gene is a promoter, an enhancer, a silencer, an insulator, is a promoter, optionally wherein the edit in the cis-regulatory element of the endogenous LOG gene reduces or eliminates the negative regulation of the endogenous LOG gene and / or the edit causes an increase in the expression of the endogenous LOG gene. In some embodiments, the mutation resulting from the edit can be a non-natural mutation. In some embodiments, the mutation resulting from the edit is a semi-dominant mutation and / or a hypomorphic mutation. In some embodiments, a plant can be regenerated from a plant cell comprising the edit in an endogenous LOG gene to produce a plant comprising the edit in its genome (i.e., in its endogenous LOG gene). In some embodiments, the edit produces a mutated LOG gene in a plant comprising a nucleotide sequence as described herein. A plant comprising the edit in an endogenous LOG gene can exhibit an altered root architecture when compared to a control plant that does not comprise the edit in the endogenous LOG gene. In some embodiments, the altered root architecture may be characterized by one or more of the following phenotypes: increased root biomass, steeper root angle, increased lateral root branching, and / or longer roots in any combination, optionally wherein the plant exhibiting the altered root architecture may exhibit improved yield traits and / or increased tolerance / resistance to abiotic stress, optionally wherein the abiotic stress is water stress (e.g., drought or salt stress) or limited nitrogen. Plants comprising the edit in the endogenous LOG gene may exhibit one or more improved yield traits when compared to control plants that do not comprise the edit in the endogenous LOG gene. In some embodiments, the one or more improved yield traits may be characterized by one or more of the following phenotypes: increased KRN, increased number of flowers, increased ear length, and / or substantially unchanged ear width.

[0219] In some embodiments, editing can produce point mutations. In some embodiments, the at least one mutation produced by editing can be a base insertion and / or a base deletion, wherein the base deletion or insertion can be in a cis-regulatory element of an endogenous LOG gene (e.g., LOG1, LOG5), optionally wherein the cis-regulatory element can be a promoter, an enhancer, a silencer, an insulator, optionally wherein the cis-regulatory element can be a promoter. In some embodiments, the editing in the cis-regulatory element of an endogenous LOG gene reduces or eliminates the negative regulation of the endogenous LOG gene, optionally the editing causes an increase in the expression of the endogenous LOG gene. In some embodiments, the editing in the endogenous LOG gene of a plant cell produces a mutant LOG gene having at least 90% sequence identity to any one of SEQ ID NOs: 125, 127, or 129-136 and / or encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 126 or SEQ ID NO: 128.

[0220] In some embodiments, a method for preparing a plant is provided, the method comprising: (a) contacting a population of plant cells comprising an endogenous gene LOG with a nuclease targeted to the endogenous LOG gene, wherein the nuclease is linked to a nucleic acid binding domain that binds to a target site in the endogenous LOG gene, the endogenous LOG gene: (i) comprising a nucleotide sequence having at least 80% sequence identity to the nucleotide sequence of any one of SEQ ID NOs:72, 73, 79 or 80; (ii) comprising a region having at least 80% sequence identity to any one of the nucleotide sequences of SEQ ID NOs:75-78, 82-120 or 139-151; and / or (iii) encoding a sequence having at least 80% sequence identity to any one of the amino acid sequences of SEQ ID NO:74 or SEQ ID NO:81; (b) selecting a plant cell from the population comprising a mutation in the endogenous LOG gene, wherein the mutation is a substitution and / or a deletion; and (c) growing the selected plant cell into a plant comprising the mutation in the endogenous LOG gene. In some embodiments, the mutation in the endogenous LOG gene can remove or eliminate negative regulation of the endogenous LOG gene, optionally causing increased expression of the endogenous LOG gene. In some embodiments, the mutation produces a semi-dominant allele or hypomorphic allele of the endogenous LOG gene, optionally a non-natural mutation; and growing the selected plant cell provides a plant comprising a semi-dominant allele or hypomorphic allele of the endogenous LOG gene. In some embodiments, the mutation in the endogenous LOG gene of the plant cell produces a mutant LOG gene having at least 90% sequence identity to any one of SEQ ID NOs: 125, 127, or 129-136 and / or encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NOs: 126 or SEQ ID NOs: 128.

[0221] In some embodiments, a method for changing the root architecture of a plant and / or improving a trait of a plant is provided, the method comprising (a) contacting a plant cell comprising an endogenous LONELY GUY (LOG) gene with a nuclease targeted to the endogenous gene, wherein the nuclease is linked to a nucleic acid binding domain that binds to a target site in the endogenous gene, the endogenous LOG gene: (i) comprising a nucleotide sequence having at least 80% sequence identity to the nucleotide sequence of any one of SEQ ID NOs:72, 73, 79 or 80; (ii) comprising a region having at least 80% sequence identity to any one of the nucleotide sequences of SEQ ID NOs:75-78, 82-120 or 139-151; and / or (iii) encoding a sequence having at least 80% sequence identity to any one of the amino acid sequences of SEQ ID NO:74 or SEQ ID NO:81; and (b) growing the plant cell into a plant, thereby changing the root architecture of the plant and / or improving the trait of the plant. In some embodiments, the mutation can be a base deletion, optionally a non-natural mutation, which produces a mutated endogenous LOG gene having at least 90% sequence identity to any one of SEQ ID NOs: 125, 127, or 129-136 and / or encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 126 or SEQ ID NO: 128.

[0222] In some embodiments, a plant or part thereof is produced comprising at least one cell having a mutation in an endogenous LONELY GUY (LOG) gene, the method comprising contacting a target site in an endogenous LOG gene in the plant or plant part with a nuclease comprising a cleavage domain and a nucleic acid binding domain, wherein the nucleic acid binding domain of the nuclease binds to the target site in the endogenous LOG gene, wherein the endogenous LOG gene: (a) comprises a nucleotide sequence having at least 80% sequence identity to the nucleotide sequence of any one of SEQ ID NOs: 72, 73, 79, or 80; (b) comprises a region having at least 80% sequence identity to any one of the nucleotide sequences of SEQ ID NOs: 75-78, 82-120, or 139-151; and / or (c) encodes a sequence having at least 80% sequence identity to any one of the amino acid sequences of SEQ ID NOs: 74 or SEQ ID NOs: 81, thereby producing a plant or part thereof comprising at least one cell having a mutation in an endogenous LOG gene. In some embodiments, the mutation in the endogenous LOG gene may be a non-natural mutation. In some embodiments, the mutation in the endogenous LOG gene may be in a cis-regulatory element, optionally wherein the mutation in the cis-regulatory element may be a semi-dominant mutation and / or a hypomorphic mutation. In some embodiments, the mutation in the endogenous LOG gene in a cis-regulatory element may remove or eliminate the negative regulation of the endogenous LOG gene, and / or may cause increased expression of the endogenous LOG gene. In some embodiments, the mutation introduced into the endogenous LOG gene may be a base deletion that produces a mutant LOG gene having at least 90% sequence identity to any one of SEQ ID NOs: 125, 127, or 129-136 and / or encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NOs: 126 or SEQ ID NOs: 128.

[0223] In some embodiments, a method of producing a plant or part thereof comprising a mutation in an endogenous LONELY GUY (LOG) gene having altered root architecture and / or improved trait characteristics is provided, the method comprising contacting a target site in an endogenous LOG gene (e.g., LOG1, LOG5) gene in the plant or plant part with a nuclease comprising a cleavage domain and a nucleic acid binding domain, wherein the nucleic acid binding domain of the nuclease binds to the target site in the endogenous LOG gene, wherein the endogenous LOG gene: (a) comprises a nucleotide sequence having at least 80% sequence identity to the nucleotide sequence of any one of SEQ ID NOs:72, 73, 79, or 80; (b) comprises a region having at least 80% sequence identity to any one of the nucleotide sequences of SEQ ID NOs:75-78, 82-120, or 139-151; and / or (c) encodes a region having at least 80% sequence identity to the nucleotide sequence of SEQ ID NOs:74 or SEQ ID NOs:75-78, 82-120, or 139-151; and / or NO:81, thereby producing a plant or part thereof having a mutated endogenous LOG gene and altered root architecture and / or improved trait characteristics. In some embodiments, the target site can be in a region of the LOG gene located at about nucleotide 1 to about nucleotide 2000, about nucleotide 600 to about nucleotide 1200, about nucleotide 700 to about nucleotide 1000, or about nucleotide 730 to about nucleotide 950, with reference to the nucleotide numbering of SEQ ID NO:72, optionally wherein the target site is within the region of any one of SEQ ID NOs:75-78 or 139-151, or within about nucleotide 1 to about nucleotide 2000, about nucleotide 500 to about nucleotide 1900, about nucleotide 700 to about nucleotide 1800, or about nucleotide 950 to about nucleotide 1750 with reference to the nucleotide numbering of SEQ ID NO:79, optionally the target site is within the region of any one of SEQ ID NOs:81-120. In some embodiments, the mutated endogenous LOG gene may comprise a sequence having at least 90% sequence identity to any one of SEQ ID NOs: 125, 127, or 129-136 and / or encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 126 or SEQ ID NO: 128.In some embodiments, the produced plants exhibit altered root architecture and / or improved trait characteristics compared to control plants, optionally wherein the altered root architecture comprises one or more of the following phenotypes: increased root biomass, steeper root angle, increased lateral root branching and / or longer roots in any combination, and / or improved yield traits and / or increased tolerance / resistance to abiotic stress, optionally wherein the abiotic stress is water stress (e.g., drought or salt stress) or limited nitrogen, and / or wherein the improved trait characteristics comprise one or more of the following phenotypes: increased KRN, increased flower number, increased ear length and / or substantially unchanged ear width, compared to plants not comprising the mutation and the altered root architecture.

[0224] In some embodiments, when the nuclease contacts the plant cell, the plant cell population and / or the target site, the nuclease cleaves the endogenous LOG gene, thereby introducing a mutation into the endogenous LOG gene, optionally wherein the mutation is introduced into the 5' region of the first exon of the endogenous LOG gene, for example, in the cis-regulatory element of the LOG gene. In some embodiments, the cis-regulatory element may be a promoter, an enhancer, a silencer or an insulator, optionally the cis-regulatory element is a promoter. In some embodiments, the mutation may be a base substitution, a base insertion and / or a base deletion. In some embodiments, the mutation is a non-natural mutation. In some embodiments, the mutation may be a semi-dominant mutation and / or a hypomorphic mutation. In some embodiments, the mutation produces a mutant LOG gene comprising a sequence having at least 90% sequence identity to any one of SEQ ID NOs: 125, 127 or 129-136 and / or encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NOs: 126 or SEQ ID NOs: 128.

[0225] Nucleases useful in the present invention may be any nucleases useful for editing / modifying target nucleic acids. Such nucleases include, but are not limited to, zinc finger nucleases, transcription activator-like effector nucleases (TALENs), endonucleases (e.g., Fok1), and / or CRISPR-Cas effector proteins. Similarly, any nucleic acid binding domain useful for the nucleases of the present invention may be any DNA binding domain useful for editing / modifying target nucleic acids. Such DNA binding domains include, but are not limited to, zinc fingers, transcription activator-like DNA binding domains (TALs), argonautes, and / or CRISPR-Cas effector DNA binding domains.

[0226] In some embodiments, a method for editing an endogenous LOG gene in a plant or a plant part is provided, the method comprising contacting a target site of the LOG gene in the plant or the plant part with a cytosine base editing system, the cytosine base editing system comprising a cytosine deaminase and a nucleic acid binding domain that binds to the target site in the endogenous LOG gene, wherein the endogenous LOG gene: (i) comprises a nucleotide sequence having at least 80% sequence identity to the nucleotide sequence of any one of SEQ ID NOs: 72, 73, 79, or 80; (b) comprises a region having at least 80% sequence identity to any one of the nucleotide sequences of SEQ ID NOs: 75-78, 82-120, or 139-151; and / or (c) encodes a sequence having at least 80% sequence identity to any one of the amino acid sequences of SEQ ID NOs: 74 or SEQ ID NO: 81; and / or the target site is in a region of the LOG gene, the region being referenced to SEQ ID NOs: The nucleotide numbering of NO:72 is located at about nucleotide 1 to about nucleotide 2000, about nucleotide 600 to about nucleotide 1200, about nucleotide 700 to about nucleotide 1000, or about nucleotide 730 to about nucleotide 950, optionally the target site is in the region of any one of SEQ ID NOs:75-78 or 139-151, or with reference to the nucleotide numbering of SEQ ID NO:79 is located at about nucleotide 1 to about nucleotide 2000, about nucleotide 500 to about nucleotide 1900, about nucleotide 700 to about nucleotide 1800, or about nucleotide 950 to about nucleotide 1750, optionally the target site is in the region of any one of SEQ ID NOs:81-120, thereby producing a plant or part thereof comprising an endogenous LOG gene having a mutation due to contact with a cytosine base editing system, and optionally the plant comprising the endogenous LOG gene having a mutation therein exhibits altered root architecture, improved yield traits and / or increased resistance / tolerance to abiotic stress.

[0227] In some embodiments, a method for editing an endogenous LOG gene in a plant or a plant part is provided, the method comprising contacting a target site in the LOG gene in the plant or the plant part with an adenosine base editing system, the adenosine base editing system comprising an adenosine deaminase and a nucleic acid binding domain that binds to the target site in the LOG gene, wherein the endogenous LOG gene: (i) comprises a nucleotide sequence having at least 80% sequence identity to the nucleotide sequence of any one of SEQ ID NOs: 72, 73, 79, or 80; (b) comprises a region having at least 80% sequence identity to any one of the nucleotide sequences of SEQ ID NOs: 75-78, 82-120, or 139-151; and / or (c) encodes a sequence having at least 80% sequence identity to any one of the amino acid sequences of SEQ ID NOs: 74 or SEQ ID NO: 81; and / or the target site is in a region of the LOG gene, the region referring to SEQ The nucleotide numbering of ID NO:72 is located at about nucleotide 1 to about nucleotide 2000, about nucleotide 600 to about nucleotide 1200, about nucleotide 700 to about nucleotide 1000, or about nucleotide 730 to about nucleotide 950, optionally the target site is in the region of any one of SEQ ID NOs:75-78 or 139-151, or with reference to the nucleotide numbering of SEQ ID NO:79 is located at about nucleotide 1 to about nucleotide 2000, about nucleotide 500 to about nucleotide 1900, about nucleotide 700 to about nucleotide 1800, or about nucleotide 950 to about nucleotide 1750, optionally the target site is in the region of any one of SEQ ID NOs:81-120, thereby producing a plant or part thereof comprising an endogenous LOG gene having a mutation due to contact with an adenosine base editing system, and optionally wherein the plant exhibits altered root architecture, improved yield traits and / or increased resistance / tolerance to abiotic stress.

[0228] In some embodiments, a method for detecting a mutant LOG gene (mutation in an endogenous LOG gene such as LOG1, LOG5) is provided, the method comprising detecting a mutation as described herein in an endogenous LOG gene in a plant genome. In some embodiments, the present invention provides a method for detecting a mutation in an endogenous LOG gene, the method comprising detecting a mutant LOG gene produced as described herein in a plant genome (see, e.g., a mutant LOG nucleic acid sequence described herein).

[0229] In some embodiments, a method for detecting a mutant LOG gene (a mutation in an endogenous LOG gene, such as LOG1, LOG5) is provided, the method comprising detecting a mutation in the 5' region of the first exon of a LOG gene in a plant genome, optionally in a cis-regulatory element, for example, at about nucleotide 1 to about nucleotide 2000, about nucleotide 600 to about nucleotide 1200, about nucleotide 700 to about nucleotide 1000, or about nucleotide 730 to about nucleotide 950, optionally within a region comprising the sequence of any one of SEQ ID NOs: 75-78 or 139-151, or at about nucleotide 1 to about nucleotide 2000, about nucleotide 500 to about nucleotide 1900, about nucleotide 700 to about nucleotide 1800, or about nucleotide 950 to about nucleotide 1750, optionally within a region comprising the sequence of any one of SEQ ID NOs: 81-120, with reference to the nucleotide numbering of SEQ ID NO: 79. In some embodiments, the mutation is an insertion, deletion, or substitution of at least one nucleotide (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 or more consecutive bases; for example, insertion and / or substitution of at least one nucleotide (e.g., insertion and / or substitution of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 or more bases (optionally consecutive bases))). In some embodiments, the detected mutated LOG gene comprises a nucleotide sequence as described herein.

[0230] In some embodiments, a method for generating a mutation in an endogenous LOG gene (e.g., LOG1, LOG5) of a plant is provided, the method comprising: (a) targeting a gene editing system to a portion of the LOG gene comprising a sequence having at least 80% sequence identity to any one of SEQ ID NOs: 75-78, 82-120, or 139-151; and (b) selecting a plant comprising a modification located in a region of the LOG gene having at least 80% sequence identity to any one of SEQ ID NOs: 75-78, 82-120, or 139-151.

[0231] In some embodiments, a method for generating a variation in a LOG gene (e.g., LOG1, LOG5) is provided, the method comprising: introducing an editing system into a plant cell, wherein the editing system targets a region of the LOG gene encoding a transcription factor polypeptide containing a LOG domain; and contacting the region of the LOG gene with the editing system, thereby introducing a mutation into the LOG gene and generating a variation in the LOG gene of the plant cell. In some embodiments, the LOG gene (a) comprises a nucleotide sequence having at least 80% sequence identity with SEQ ID NO: 72 or SEQ ID NO: 73; (b) comprises a region having at least 80% sequence identity with any one of the nucleotide sequences of SEQ ID NO: 75-78, 82-120, or 139-151; and / or (c) encodes an amino acid sequence having at least 80% sequence identity with SEQ ID NO: 74. In some embodiments, the targeted region of the LOG gene comprises at least 80% sequence identity with any one of the nucleotide sequences of SEQ ID NO: 75-78 or 82-120 or SEQ ID NO: 139-151. In some embodiments, a region of an endogenous LOG gene in a plant cell is contacted with an editing system to produce a plant cell comprising an edited endogenous LOG gene in its genome, the method further comprising (a) regenerating a plant from the plant cell; (b) selfing the plant to produce a progeny plant (E1); (c) analyzing the progeny plant of (b) for altered root architecture and / or improved yield traits; and (d) selecting progeny plants that exhibit altered root architecture and / or improved yield characteristics compared to control plants to produce selected progeny plants that exhibit altered root architecture and / or improved yield characteristics, optionally wherein the method further comprises (e) selfing the selected progeny plant of (d) to produce a progeny plant (E2); (f) analyzing the progeny plant of (e) for altered root architecture and / or improved yield characteristics; and (g) selecting progeny plants that exhibit altered root architecture and / or improved yield characteristics compared to control plants, optionally repeating (e) to (g) one or more times. In some embodiments, the altered root architecture comprises at least one of the following phenotypes: increased root biomass, steeper root angle, increased lateral root branching and / or longer roots, improved yield traits and / or increased tolerance / resistance to abiotic stress, optionally wherein the abiotic stress is water stress (e.g., drought or salt stress) or limited nitrogen, compared to a plant that does not comprise the mutation and the altered root architecture. In some embodiments, the improved trait characteristics comprise one or more of the following phenotypes: increased KRN, increased flower number, increased ear length and / or substantially unchanged ear width and / or increased tolerance / resistance to abiotic stress, optionally wherein the abiotic stress is water stress (e.g., drought or salt stress) or limited nitrogen, compared to a plant that does not comprise the mutation and the improved yield characteristics.

[0232] In some embodiments, the present invention provides a method for producing a plant comprising a mutation in an endogenous LOG gene and at least one polynucleotide of interest, the method comprising crossing a plant of the present invention (a first plant) comprising at least one mutation in an endogenous LOG gene with a second plant comprising at least one polynucleotide of interest to produce progeny plants; and selecting progeny plants comprising at least one mutation in the LOG gene and at least one polynucleotide of interest, thereby producing a plant comprising a mutation in the endogenous LOG gene and at least one polynucleotide of interest.

[0233] Also provided is a method for producing a plant comprising a mutation in an endogenous LOG gene and at least one polynucleotide of interest, the method comprising introducing at least one polynucleotide of interest into the plant of the present invention comprising at least one mutation in the LOG gene, thereby producing a plant comprising at least one mutation in the LOG gene and at least one polynucleotide of interest.

[0234] In some embodiments, a method of producing a plant is provided, the plant comprising a mutation in an endogenous LOG gene and exhibiting a phenotype of improved root architecture (optionally, exhibiting improved yield traits, root biomass, steeper root angle, increased lateral root branching and / or longer roots) and / or a phenotype of one or more improved yield characteristics (optionally, exhibiting increased KRN, increased flower number, increased ear length and / or substantially unchanged ear width), the method comprising crossing a first plant with a second plant to produce progeny plants, the first plant being a plant of the present invention, the second plant comprising at least one polynucleotide of interest; and selecting progeny plants comprising the mutation in the LOG gene and the at least one polynucleotide of interest, thereby producing a plant comprising the mutation in the endogenous LOG gene and the at least one polynucleotide of interest.

[0235] In some embodiments, a method for controlling weeds in a container (e.g., a pot or seed tray, etc.), a growth chamber, a greenhouse, a field, a recreational area, a lawn, or a roadside is provided, the method comprising applying a herbicide to one or more (plural) plants of the present invention growing in a container, a growth chamber, a greenhouse, a field, a recreational area, a lawn, or a roadside, thereby controlling the weeds in the container, growth chamber, greenhouse, field, recreational area, lawn, or roadside where the one or more plants grow.

[0236] In some embodiments, a method of reducing insect predation on plants is provided, the method comprising applying an insecticide to one or more plants of the present invention, thereby reducing insect predation on the one or more plants, optionally wherein the one or more plants are grown in containers, growth chambers, greenhouses, fields, recreational areas, lawns, or roadsides.

[0237] In some embodiments, a method of reducing fungal diseases on plants is provided, the method comprising applying a fungicide to one or more plants of the present invention, thereby reducing fungal diseases on the one or more plants, optionally wherein the one or more plants are grown in containers, growth chambers, greenhouses, fields, recreational areas, lawns, or roadsides.

[0238] The polynucleotide of interest may be any polynucleotide that can confer a desired phenotype on a plant or otherwise alter the phenotype or genotype of a plant. In some embodiments, the polynucleotide of interest may be a polynucleotide that confer herbicide tolerance, insect resistance, disease resistance, improved yield traits, increased nutrient use efficiency, and / or abiotic stress resistance.

[0239] LOG genes useful in the present invention include any LOG gene, wherein when the cis-regulatory elements of an endogenous LOG gene in a plant are modified, the plant exhibits altered root architecture and / or one or more improved yield traits.

[0240] In some embodiments, the mutation in the endogenous LOG gene may be a non-natural mutation. In some embodiments, plants comprising at least one mutation in at least one endogenous LOG gene encoding a LOG protein exhibit improved / enhanced root architecture, and / or one or more improved yield traits, optionally exhibiting increased abiotic stress resistance / tolerance, compared to isogenic plants not comprising the mutation.

[0241] In some embodiments, the mutation may be any mutation in an endogenous LOG gene that, when included in a plant, produces an altered root architecture, and / or improved yield traits, and optionally increased tolerance / resistance to abiotic stress. In some embodiments, the at least one mutation in an endogenous LOG gene may be a non-natural mutation. In some embodiments, the at least one mutation in an endogenous LOG gene may be a point mutation, optionally a base substitution, base insertion, and / or base deletion. In some embodiments, the at least one mutation in an endogenous LOG gene may be a semi-dominant mutation and / or a hypomorphic mutation. In some embodiments, the at least one mutation in an endogenous LOG gene of a plant may be a substitution, deletion, and / or insertion that produces a plant that exhibits an altered root architecture, and / or improved yield traits, and optionally, increased tolerance / resistance to abiotic stress. In some embodiments, the altered root architecture may be characterized by one or more of the following phenotypes: increased root biomass, steeper root angle, increased lateral root branching, and / or longer roots in any combination, optionally resulting in improved yield traits and / or increased tolerance and / or resistance to abiotic stress. In some embodiments, the improved yield traits may include increased KRN, increased flower number, increased ear length, and / or substantially unchanged ear width. In some embodiments, the at least one mutation in the plant endogenous LOG gene may be a substitution, deletion, and / or insertion, which produces a semi-dominant or hypomorphic allele mutation and a plant with altered root architecture, and / or improved yield traits, optionally increased tolerance / resistance to abiotic stress. In some embodiments, the at least one mutation may be a base substitution for A, T, G, or C.

[0242] In some embodiments, the present invention provides a mutated endogenous LOG gene comprising a nucleic acid sequence having at least 90% sequence identity to any one of SEQ ID NOs: 125, 127 or 129-136 and / or encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 126 or SEQ ID NO: 128.

[0243] In some embodiments, the present invention provides a guide nucleic acid (e.g., gRNA, gDNA, crRNA, crDNA) that binds to a target site in an endogenous gene encoding a LONELY GUY (LOG) gene, which LOG gene: (a) comprises a nucleotide sequence having at least 80% sequence identity to the nucleotide sequence of any one of SEQ ID NOs:72, 73, 79, or 80; (b) comprises a region having at least 80% sequence identity to any one of the nucleotide sequences of SEQ ID NOs:75-78, 82-120, or 139-151; and / or (c) encodes a sequence having at least 80% sequence identity to any one of the amino acid sequences of SEQ ID NO:74 or SEQ ID NO:81. In some embodiments, the target site is in a region of the LOG gene that is located at about nucleotide 1 to about nucleotide 2000, about nucleotide 600 to about nucleotide 1200, about nucleotide 700 to about nucleotide 1000, or about nucleotide 730 to about nucleotide 950, with reference to the nucleotide numbering of SEQ ID NO: 72, optionally the target site is within the region of any one of SEQ ID NOs: 75-78 or 139-151, or within about nucleotide 1 to about nucleotide 2000, about nucleotide 500 to about nucleotide 1900, about nucleotide 700 to about nucleotide 1800, or about nucleotide 950 to about nucleotide 1750 with reference to the nucleotide numbering of SEQ ID NO: 79, optionally the target site is within the region of any one of SEQ ID NOs: 81-120, optionally wherein the guide nucleic acid may comprise a spacer sequence having a nucleotide sequence of any one of SEQ ID NOs: 121-124, 138, or 139.

[0244] Exemplary spacer sequences useful for guide sequences of the invention can be substantially complementary (at least 70% complementary) to a fragment or portion (e.g., about 15 consecutive nucleotides to about 30 consecutive nucleotides) of a nucleotide sequence that (a) has at least 80% sequence identity to the nucleotide sequence of SEQ ID NO:72 or SEQ ID NO:79; (b) has at least 80% sequence identity to: (i) a region from about nucleotide 1 to about nucleotide 2000, from about nucleotide 600 to about nucleotide 1200, from about nucleotide 700 to about nucleotide 1000, or from about nucleotide 730 to about nucleotide 950 of SEQ ID NO:72; and / or (ii) a region from about nucleotide 1 to about nucleotide 2000, from about nucleotide 500 to about nucleotide 1900, from about nucleotide 700 to about nucleotide 1800, or from about nucleotide 950 to about nucleotide 1750 of SEQ ID NO:79; and / or (c) encodes a polynucleotide sequence that has at least 80% identity to SEQ ID NO:74 or SEQ ID NO:81, optionally, SEQ ID NO:82. A fragment or portion of any one of NO:75-78 or 82-120.

[0245] In some embodiments, the target nucleic acid can be any endogenous LOG gene in a plant or part thereof, wherein the cis-regulatory elements of the endogenous LOG gene in the plant can be modified as described herein, resulting in a plant exhibiting altered root architecture and / or improved yield traits, optionally increased abiotic stress resistance / tolerance. In some embodiments, the target site in the target nucleic acid can comprise a sequence having at least 80% sequence identity to a region, portion or fragment of SEQ ID NO: 72 or 79 (e.g., a region from about nucleotide 1 to about nucleotide 2000, about nucleotide 600 to about nucleotide 1200, about nucleotide 700 to about nucleotide 1000, or about nucleotide 730 to about nucleotide 950 of SEQ ID NO: 72; and / or a region from about nucleotide 1 to about nucleotide 2000, about nucleotide 500 to about nucleotide 1900, about nucleotide 700 to about nucleotide 1800, or about nucleotide 950 to about nucleotide 1750 of SEQ ID NO: 79).

[0246] In some embodiments, the guide nucleic acid comprises a spacer having a nucleotide sequence of any one of SEQ ID NOs: 121-124.

[0247] In some embodiments, a system is provided, comprising a guide nucleic acid of the invention and a CRISPR-Cas effector protein associated with the guide nucleic acid. In some embodiments, the system may further comprise a tracr nucleic acid associated with the guide nucleic acid and the CRISPR-Cas effector protein, optionally wherein the tracr nucleic acid and the guide nucleic acid are covalently linked.

[0248] As used herein, “CRISPR-Cas effector protein associated with a guide nucleic acid” refers to a complex formed between the CRISPR-Cas effector protein and the guide nucleic acid to direct the CRISPR-Cas effector protein to a target site in a gene.

[0249] In some embodiments, a gene editing system is provided, the gene editing system comprising a CRISPR-Cas effector protein associated with a guide nucleic acid, wherein the guide nucleic acid comprises a spacer sequence that binds to a LONELYGUY (LOG) gene. In some embodiments, the LOG gene (a) comprises a nucleotide sequence having at least 80% sequence identity to the nucleotide sequence of any one of SEQ ID NOs: 72, 73, 79, or 80; (b) comprises a region having at least 80% sequence identity to any one of the nucleotide sequences of SEQ ID NOs: 75-78 or 82-120; and / or (c) encodes an amino acid sequence having at least 80% sequence identity to any one of the sequences of SEQ ID NOs: 74 or SEQ ID NOs: 81. In some embodiments, the spacer sequence binds to a cis-regulatory element of the LOG gene. In some embodiments, the cis-regulatory element is a promoter, an enhancer, a silencer, or an insulator, optionally a promoter.

[0250] In some embodiments, the guide nucleic acid of the gene editing system may include a spacer sequence that is complementary to a region, portion, or fragment of the following nucleotide sequences: (a) a nucleotide sequence having at least 80% sequence identity to any one of the nucleotide sequences of SEQ ID NO: 72 or 79; (b) a nucleotide sequence having at least 80% sequence identity to any one of the nucleotide sequences of SEQ ID NO: 75-78 or 82-120; (c) a nucleotide sequence encoding a sequence having at least 80% sequence identity to the amino acid sequence of SEQ ID NO: 74 or SEQ ID NO: 81; (d) a nucleotide sequence having at least 80% sequence identity to a region of SEQ ID NO: 72 located at about nucleotide 1 to about nucleotide 2000, about nucleotide 600 to about nucleotide 1200, about nucleotide 700 to about nucleotide 1000, or about nucleotide 730 to about nucleotide 950; and / or SEQ ID NO: IDNO:79 is located at about nucleotide 1 to about nucleotide 2000, about nucleotide 500 to about nucleotide 1900, about nucleotide 700 to about nucleotide 1800, or about nucleotide 950 to about nucleotide 1750. In some embodiments, the spacer sequence for targeting the LOG gene is combined with the cis-regulatory element of the LOG gene, optionally wherein the cis-regulatory element is a promoter. In some embodiments, the gene editing system may also include a tracr nucleic acid associated with a guide nucleic acid and a CRISPR-Cas effector protein, optionally wherein the tracr nucleic acid and the guide nucleic acid are covalently linked. In some embodiments, the spacer sequence of the guide nucleic acid that can be used to target an endogenous LOG gene as described herein may include, but is not limited to, a nucleotide sequence comprising any one of SEQ ID NOs:121-124.

[0251] In some embodiments, a guide nucleic acid is provided, which binds to a target site in an endogenous LOG gene whose gene identification number (gene ID) is Zm00001d003013 (LOG1) or Zm00001d043692 (LOG5). In some embodiments, the guide nucleic acid comprises a spacer sequence complementary to a target site in a cis-regulatory element of an endogenous LOG gene, and the gene identification number (gene ID) of the LOG gene is Zm00001d003013 (LOG1) or Zm00001d043692 (LOG5).

[0252] The present invention also provides a complex comprising a CRISPR-Cas effector protein, the CRISPR-Cas effector protein comprising a cleavage domain and a guide nucleic acid, wherein the guide nucleic acid binds to a target site in an endogenous LONELY GUY (LOG) gene (e.g., LOG1, LOG5), the LOG gene (a) comprising a nucleotide sequence having at least 80% sequence identity to the nucleotide sequence of any one of SEQ ID NO: 72, 73, 79 or 80; (b) comprising a region having at least 80% sequence identity to any one of the nucleotide sequences of SEQ ID NO: 75-78 or 82-120; and / or (c) encoding a sequence having at least 80% sequence identity to any one of the amino acid sequences of SEQ ID NO: 74 or SEQ ID NO: 81, wherein the cleavage domain cleaves the target strand in the LOG gene.

[0253] Also provided herein is an expression cassette comprising (a) a polynucleotide encoding a CRISPR-Cas effector protein comprising a cleavage domain and (b) a guide nucleic acid that binds to a target site in an endogenous LONELY GUY (LOG) gene (e.g., LOG1, LOG5), wherein the guide nucleic acid comprises a spacer sequence that is complementary to and binds to the target site in the endogenous LOG gene, the endogenous LOG gene: (i) comprising a nucleotide sequence having at least 80% sequence identity to the nucleotide sequence of any one of SEQ ID NOs: 72, 73, 79, or 80; (ii) comprising a region having at least 80% sequence identity to any one of the nucleotide sequences of SEQ ID NOs: 75-78 or 82-120; and / or (iii) encoding a sequence having at least 80% sequence identity to any one of the amino acid sequences of SEQ ID NO: 74 or SEQ ID NO: 81; and / or (iv) comprising a region having at least 80% sequence identity to the amino acid sequence of SEQ ID NO: 82. NO:72 is located in the region of about nucleotide 1 to about nucleotide 2000, about nucleotide 600 to about nucleotide 1200, about nucleotide 700 to about nucleotide 1000, or about nucleotide 730 to about nucleotide 950; and / or a nucleotide sequence having at least 80% sequence identity with the region of SEQ ID NO:79 is located in the region of about nucleotide 1 to about nucleotide 2000, about nucleotide 500 to about nucleotide 1900, about nucleotide 700 to about nucleotide 1800, or about nucleotide 950 to about nucleotide 1750. In some embodiments, the target site in the endogenous LOG gene is in a region of the LOG gene that is located at about nucleotide 1 to about nucleotide 2000, about nucleotide 600 to about nucleotide 1200, about nucleotide 700 to about nucleotide 1000, or about nucleotide 730 to about nucleotide 950 with reference to the nucleotide numbering of SEQ ID NO: 72, or about nucleotide 1 to about nucleotide 2000, about nucleotide 500 to about nucleotide 1900, about nucleotide 700 to about nucleotide 1800, or about nucleotide 950 to about nucleotide 1750 with reference to the nucleotide numbering of SEQ ID NO: 79 (e.g., SEQ ID NOs: 75-78 or 82-120).

[0254] The editing system that can be used for the present invention can be any site-specific (sequence-specific) genome editing system that is now known or developed later, which can introduce mutations in a target-specific manner. For example, the editing system (e.g., a site-specific or sequence-specific editing system) may include, but is not limited to, a CRISPR-Cas editing system, a meganuclease editing system, a zinc finger nuclease (ZFN) editing system, a transcription activator-like effector nuclease (TALEN) editing system, a base editing system, and / or a lead editing system, each of which may include one or more polypeptides and / or one or more polynucleotides that can modify (mutate) a target nucleic acid in a sequence-specific manner when expressed as a system in a cell. In some embodiments, the editing system (e.g., a site-specific or sequence-specific editing system) may include one or more polynucleotides and / or one or more polypeptides, including but not limited to a nucleic acid binding domain (DNA binding domain), a nuclease and / or other polypeptides and / or polynucleotides and / or a guide nucleic acid (comprising a spacer region having substantial complementarity or complete complementarity with a target site).

[0255] In some embodiments, the editing system may include one or more sequence-specific nucleic acid binding domains (e.g., sequence-specific DNA binding domains), which may be derived from, for example, polynucleotide-guided endonucleases, CRISPR-Cas endonucleases (e.g., CRISPR-Cas effector proteins), zinc finger nucleases, transcription activator-like effector nucleases (TALENs), and / or Argonaute proteins. In some embodiments, the editing system may include one or more cleavage domains (e.g., nucleases), including but not limited to endonucleases (e.g., Fok1), polynucleotide-guided endonucleases, CRISPR-Cas endonucleases (e.g., CRISPR-Cas effector proteins), zinc finger nucleases, and / or transcription activator-like effector nucleases (TALENs). In some embodiments, the editing system may include one or more polypeptides, including but not limited to deaminases (e.g., cytosine deaminases, adenine deaminases), reverse transcriptases, Dna2 polypeptides, and / or 5' flap endonucleases (FENs). In some embodiments, the editing system may comprise one or more polynucleotides, including but not limited to a CRISPR array (CRISPR guide sequence) nucleic acid, an extended guide nucleic acid, and / or a reverse transcriptase template.

[0256] In some embodiments, a method of modifying or editing a LOG gene may include contacting a target nucleic acid (e.g., a nucleic acid encoding a cytokinin nucleoside 5-monophosphate phosphoribohydrolase polypeptide, such as a cis-acting element of a LOG gene) with a base editing fusion protein (e.g., a sequence-specific DNA binding protein (e.g., a CRISPR-Cas effector protein or domain)) fused to a deaminase domain (e.g., adenine deaminase and / or cytosine deaminase) and a guide nucleic acid, wherein the guide nucleic acid is capable of guiding / targeting the base editing fusion protein to the target nucleic acid, thereby editing a locus within the target nucleic acid. In some embodiments, the base editing fusion protein and the guide nucleic acid may be contained in one or more expression cassettes. In some embodiments, the target nucleic acid may be contacted with a base editing fusion protein and an expression cassette containing a guide nucleic acid. In some embodiments, the sequence-specific nucleic acid binding fusion protein and the guide sequence may be provided as a ribonucleoprotein (RNP). In some embodiments, a cell may be contacted with more than one base editing fusion protein and / or one or more guide nucleic acids, which may target one or more target nucleic acids in a cell.

[0257] In some embodiments, a method of modifying or editing a LOG gene may include contacting a target nucleic acid (e.g., a nucleic acid encoding a cytokinin nucleoside 5-monophosphate phosphoribosylhydrolase polypeptide, e.g., a cis-regulatory element of a nucleic acid encoding a cytokinin nucleoside 5-monophosphate phosphoribosylhydrolase polypeptide) with a sequence-specific nucleic acid binding fusion protein fused to an affinity polypeptide capable of binding to a peptide tag and a guide nucleic acid (e.g., a sequence-specific nucleic acid binding protein fused to a peptide tag (e.g., a CRISPR-Cas effector protein or domain), a deaminase fusion protein comprising a deaminase domain (e.g., adenine deaminase and / or cytosine deaminase)), wherein the guide nucleic acid is capable of guiding / targeting the sequence-specific nucleic acid binding fusion protein to the target nucleic acid, and the sequence-specific nucleic acid binding fusion protein is capable of recruiting the deaminase fusion protein to the target nucleic acid via a peptide tag-affinity polypeptide interaction, thereby editing a locus within the target nucleic acid. In some embodiments, the sequence-specific nucleic acid binding fusion protein can be fused to an affinity polypeptide that binds a peptide tag, and the deaminase can be fused to the peptide tag, thereby recruiting the deaminase to the sequence-specific nucleic acid binding fusion protein and the target nucleic acid. In some embodiments, the sequence-specific binding fusion protein, the deaminase fusion protein, and the guide nucleic acid can be contained in one or more expression cassettes. In some embodiments, the target nucleic acid can be contacted with the sequence-specific binding fusion protein, the deaminase fusion protein, and the expression cassette containing the guide nucleic acid. In some embodiments, the sequence-specific nucleic acid binding fusion protein, the deaminase fusion protein, and the guide nucleic acid can be provided in the form of a ribonucleoprotein (RNP).

[0258] In some embodiments, methods such as lead editing can be used to generate mutations in the endogenous LOG gene. In lead editing, an RNA-dependent DNA polymerase (reverse transcriptase, RT) and a reverse transcriptase template (RT template) are used in combination with a sequence-specific nucleic acid binding domain that confers the ability to recognize and bind to the target in a sequence-specific manner, and can also cause a nick containing a PAM chain within the target. The nucleic acid binding domain can be a CRISPR-Cas effector protein, and in this case, the CRISPR array or guide RNA can be an extended guide sequence comprising an extension that includes a primer binding site (PSB) and an edit to be incorporated into the genome (template). Similar to base editing, lead editing can utilize various methods to recruit proteins for target site editing, including non-covalent and covalent interactions between proteins and nucleic acids used in selected processes of genome editing.

[0259] In some embodiments, a mutant LONELY GUY (LOG) nucleic acid is provided, the mutant LOG nucleic acid comprising at least one mutation, wherein at least one mutation is in a cis-regulatory element, optionally wherein the mutant nucleic acid comprises a sequence having at least 90% sequence identity (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity) with any of the mutant LOG genes described herein. In some embodiments, a mutant nucleic acid encoding a cytokinin nucleoside 5-monophosphate phosphoribosylhydrolase polypeptide is provided, the mutant nucleic acid comprising a cis-regulatory element having a mutation, optionally wherein the mutation reduces or eliminates negative regulation of the mutant nucleic acid, and / or wherein the mutation causes increased expression of the mutant nucleic acid. In some embodiments, the mutant LOG nucleic acid is in a LOG1 gene and / or LOG5 comprising a mutation in a cis-regulatory element.

[0260] In some embodiments, the plant useful in the present invention can be corn, soybean, canola, wheat, rice, cotton, sugar cane, sugar beet, barley, oats, alfalfa, sunflower, safflower, oil palm, sesame, coconut, tobacco, potato, sweet potato, cassava, coffee tree, apple, plum, apricot, peach, cherry, pear, fig, banana, citrus, cocoa, avocado, olive, almond, walnut, strawberry, watermelon, pepper, grape, tomato, cucumber or Brassica species. In some embodiments, the plant can be a corn plant. The plant part can be a plant cell, optionally wherein the cell can be from a corn plant.

[0261] In some embodiments, a plant comprising a mutant LOG gene is provided. In some embodiments, the plant may be, for example, a corn plant. In some embodiments, a corn plant or part thereof comprising a mutant LOG gene is provided, optionally wherein the mutation is in a LOG gene having a gene identification number (gene ID) of Zm00001d003013 (LOG1) or Zm00001d043692 (LOG5), optionally wherein the corn plant exhibits a changed root configuration compared to a control corn plant not comprising the mutation, optionally exhibiting one or more of the following phenotypes: increased root biomass, steeper root angles, increased lateral root branches, and / or longer roots in any combination. In some embodiments, a corn plant comprising a mutant LOG gene may exhibit improved yield traits compared to a control corn plant not comprising the mutation, optionally exhibiting one or more of the following phenotypes: increased KRN, increased flower number, increased ear length, and / or substantially unchanged ear width, and / or increased tolerance / resistance to abiotic stress. In some embodiments, the present invention provides a corn plant or plant part thereof comprising at least one non-natural mutation in an endogenous LOG gene with a gene identification number (gene ID) of Zm00001d003013 (LOG1) or Zm00001d043692 (LOG5). In some embodiments, the at least one non-natural mutation is in a cis-regulatory element of an endogenous LOG gene with a gene identification number (gene ID) of Zm00001d003013 (LOG1) or Zm00001d043692 (LOG5), optionally wherein the at least one non-natural mutation is a semi-dominant mutation or a hypomorphic mutation.

[0262] In some embodiments, the mutation introduced into the endogenous LOG gene may be a non-natural mutation. In some embodiments, the mutation introduced into the endogenous LOG gene may be a substitution, insertion and / or deletion of one or more nucleotides as described herein. In some embodiments, the mutation introduced into the endogenous LOG gene may be a deletion, optionally a complete or partial deletion of a cis-regulatory element of the LOG gene. In some embodiments, the mutation in the endogenous LOG gene may produce a plant comprising the mutation that exhibits an altered root architecture compared to a wild-type LOG gene, optionally wherein the LOG gene is LOG5. In some embodiments, the mutation in the endogenous LOG gene may produce a plant comprising the mutation that exhibits an improved yield trait compared to a wild-type LOG gene, optionally wherein the LOG gene is LOG1.

[0263] In some embodiments, sequence-specific nucleic acid binding domains (DNA binding domains) useful in the editing systems of the present invention can be derived from, for example, polynucleotide-guided endonucleases, CRISPR-Cas endonucleases (e.g., CRISPR-Cas effector proteins), zinc finger nucleases, transcription activator-like effector nucleases (TALENs), and / or Argonaute proteins.

[0264] In some embodiments, the sequence-specific nucleic acid binding domain / protein may be a CRISPR-Cas effector protein, optionally wherein the CRISPR-Cas effector protein may be from a type I CRISPR-Cas system, a type II CRISPR-Cas system, a type III CRISPR-Cas system, a type IV CRISPR-Cas system, a type V CRISPR-Cas system, or a type VI CRISPR-Cas system. In some embodiments, the CRISPR-Cas effector protein of the present invention may be from a type II CRISPR-Cas system or a type V CRISPR-Cas system. In some embodiments, the CRISPR-Cas effector protein may be a type II CRISPR-Cas effector protein, such as a Cas9 effector protein. In some embodiments, the CRISPR-Cas effector protein may be a type V CRISPR-Cas effector protein, such as a Cas12 effector protein.

[0265] As used herein, a "CRISPR-Cas effector protein" is a protein or polypeptide or a domain thereof that cleaves or cuts a nucleic acid, binds a nucleic acid (e.g., a target nucleic acid and / or a guide nucleic acid), and / or identifies, recognizes, or binds a guide nucleic acid as defined herein. In some embodiments, a CRISPR-Cas effector protein may be an enzyme (e.g., a nuclease, an endonuclease, a nickase, etc.) or a portion thereof and / or may act as an enzyme. In some embodiments, a CRISPR-Cas effector protein refers to a CRISPR-Cas nuclease polypeptide or a domain thereof that comprises nuclease activity or wherein the nuclease activity has been reduced or eliminated, and / or comprises nickase activity or wherein the nickase activity has been reduced or eliminated, and / or comprises single-stranded DNA cleavage activity (ss DNA enzyme activity) or wherein the ss DNA enzyme activity has been reduced or eliminated, and / or comprises self-processing RNA enzyme activity or wherein the self-processing RNA enzyme activity has been reduced or eliminated. A CRISPR-Cas effector protein may bind to a target nucleic acid.

[0266] In some embodiments, the CRISPR-Cas effector protein may include, but is not limited to, Cas9, C2c1, C2c3, Cas12a (also known as Cpf1), Cas12b, Cas12c, Cas12d, Cas12e, Cas13a, Cas13b, Cas13c, Cas13d, Cas1, Cas1B, Cas2, Cas3, Cas3', Cas3", Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Cas10, Csyl, Csy2, Csy3, Csel, Cse2, Cscl, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4, CsxlO, Csxl6, CsaX, Csx3, Csxl, Csxl5, Csfl, Csf2, Csf3, Csf4 (dinG) and / or Csf5 nuclease, optionally wherein the CRISPR-Cas effector protein can be a Cas9, Cas12a (Cpf1), Cas12b, Cas12c (C2c3), Cas12d (CasY), Cas12e (CasX), Cas12g, Cas12h, Cas12i, C2c4, C2c5, C2c8, C2c9, C2c10, Cas14a, Cas14b and / or Cas14c effector protein.

[0267] In some embodiments, the CRISPR-Cas effector protein useful in the present invention may comprise a mutation in its nuclease active site (e.g., RuvC, HNH, e.g., a RuvC site of a Cas12a nuclease domain; e.g., a RuvC site and / or an HNH site of a Cas9 nuclease domain). The CRISPR-Cas effector protein has a mutation in its nuclease active site and therefore no longer comprises nuclease activity, and is often referred to as "dead", e.g., dCas. In some embodiments, a CRISPR-Cas effector protein domain or polypeptide having a mutation in its nuclease active site may have impaired activity or reduced activity compared to the same CRISPR-Cas effector protein (e.g., a nickase, e.g., a Cas9 nickase, a Cas12a nickase) without the mutation.

[0268] CRISPR Cas9 effector proteins or CRISPR Cas9 effector domains useful in the present invention may be any known or later identified Cas9 nuclease. In some embodiments, the CRISPR Cas9 polypeptide may be a Cas9 polypeptide from, for example, Streptococcus spp. (e.g., S. pyogenes, S. thermophilus), Lactobacillus spp., Bifidobacterium spp., Kandleria spp., Leuconostoc spp., Oenococcus spp., Pediococcus spp., Weissella spp., and / or Olsenella spp. Example Cas9 sequences include, but are not limited to, the amino acid sequences of SEQ ID NOs: 59-60 or the polynucleotide sequences of SEQ ID NOs: 61-71.

[0269] In some embodiments, the CRISPR-Cas effector protein can be a Cas9 polypeptide derived from Streptococcus pyogenes and recognizes the PAM sequence motifs NGG, NAG, NGA (Mali et al., Science 2013; 339(6121): 823-826). In some embodiments, the CRISPR-Cas effector protein can be a Cas9 polypeptide derived from Streptococcus thermophiles and recognizes the PAM sequence motifs NGGNG and / or NNAGAAW (W=A or T) (see, e.g., Horvath et al., Science, 2010; 327(5962): 167-170, and Deveau et al., J Bacteriol 2008; 190(4): 1390-1400). In some embodiments, the CRISPR-Cas effector protein can be a Cas9 polypeptide derived from Streptococcus mutans and recognizes the PAM sequence motifs NGG and / or NAAR (R=A or G) (see, e.g., Deveau et al., J BACTERIOL 2008; 190(4): 1390-1400). In some embodiments, the CRISPR-Cas effector protein can be a Cas9 polypeptide derived from Streptococcus aureus and recognizes the PAM sequence motifs NNGRR (R=A or G). In some embodiments, the CRISPR-Cas effector protein can be a Cas9 polypeptide derived from Streptococcus aureus and recognizes the PAM sequence motifs N GRRT (R=A or G). In some embodiments, the CRISPR-Cas effector protein can be a Cas9 polypeptide derived from Streptococcus aureus that recognizes the PAM sequence motifs N GRRV (R=A or G). In some embodiments, the CRISPR-Cas effector protein can be a Cas9 polypeptide derived from Neisseria meningitidis, and recognizes the PAM sequence motif NGATT or NGCTT (R = A or G, V = A, G or C) (see, e.g., Hou et al., PNAS 2013, 1-6). In the above embodiments, N can be any nucleotide residue, such as any one of A, G, C or T. In some embodiments, the CRISPR-Cas effector protein can be a Cas13a protein derived from Leptotrichia shahii, which recognizes a single 3'A, U or C protospacer flanking sequence (PFS) (or RNA PAM (rPAM)) sequence motif that can be located in the target nucleic acid.

[0270] In some embodiments, the CRISPR-Cas effector protein may be derived from Cas12a, which is a V-type regularly interspaced clustered short palindromic repeats (CRISPR)-Cas nuclease (see, e.g., SEQ ID NO: 1-20). Cas12a differs from the more well-known type II CRISPRCas9 nuclease in several aspects. For example, Cas9 recognizes the G-rich protospacer adjacent motif (PAM) (3'-NGG) located 3' of its guide RNA (gRNA, sgRNA, crRNA, crDNA, CRISPR array) binding site (protospacer, target nucleic acid, target DNA), while Cas12a recognizes the T-rich PAM (5'-TTN, 5'-TTTN) located 5' of the target nucleic acid. In fact, the orientation of Cas9 and Cas12a binding to their guide RNAs is almost opposite relative to their N and C termini. In addition, the Cas12a enzyme uses a single guide RNA (gRNA, CRISPR array, crRNA), rather than the dual guide RNA (sgRNA (e.g., crRNA and tracrRNA)) found in the natural Cas9 system, and Cas12a processes its own gRNA. In addition, the Cas12a nuclease activity produces staggered DNA double-strand breaks, rather than the flat ends produced by the Cas9 nuclease activity, and Cas12a relies on a single RuvC domain to cleave two DNA chains, while Cas9 utilizes the HNH domain and the RuvC domain to cleave.

[0271] CRISPR Cas12a effector proteins / domains useful in the present invention may be any known or later identified Cas12a polypeptide (formerly known as Cpf1) (see, e.g., U.S. Pat. No. 9,790,490, which is incorporated by reference for its disclosure of Cpf1 (Cas12a) sequences). The term "Cas12a", "Cas12a polypeptide" or "Cas12a domain" refers to an RNA-guided nuclease comprising a Cas12a polypeptide or a fragment thereof, the fragment comprising a guide nucleic acid binding domain of Cas12a and / or an active, inactive or partially active DNA cleavage domain of Cas12a. In some embodiments, Cas12a useful in the present invention may comprise a mutation in a nuclease active site (e.g., a RuvC site of a Cas12a domain). A Cas12a domain or Cas12a polypeptide having a mutation in its nuclease active site and thus no longer comprising nuclease activity is generally referred to as a dead Cas12a (e.g., dCas12a). In some embodiments, a Cas12a domain or Cas12a polypeptide having a mutation in its nuclease active site may have impaired activity, for example, may have nickase activity.

[0272] Any deaminase domain / polypeptide that can be used for base editing can be used in the present invention. In some embodiments, the deaminase domain can be a cytosine deaminase domain or an adenine deaminase domain. The cytosine deaminase (or cytidine deaminase) that can be used in the present invention can be any known or later identified cytosine deaminase from any organism (see, e.g., U.S. Patent No. 10,167,457 and Thuronyi et al., Nat. Biotechnol. 37: 1070–1079 (2019), each of which is incorporated herein by reference for its disclosure of cytosine deaminase). Cytosine deaminase can catalyze the hydrolysis and deamination of cytidine or deoxycytidine to uridine or deoxyuridine, respectively. Therefore, in some embodiments, the deaminase or deaminase domain that can be used in the present invention can be a cytidine deaminase domain that catalyzes the hydrolysis and deamination of cytosine to uracil. In some embodiments, the cytosine deaminase can be a variant of a naturally occurring cytosine deaminase, including but not limited to primates (e.g., humans, monkeys, chimpanzees, gorillas), dogs, cows, rats, or mice. Thus, in some embodiments, the cytosine deaminase useful in the present invention can be about 70% to about 100% identical to a wild-type cytosine deaminase (e.g., about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to a naturally occurring cytosine deaminase, and any range or value therein).

[0273] In some embodiments, the cytosine deaminase that can be used in the present invention can be an apolipoprotein B mRNA editing complex (APOBEC) family deaminase. In some embodiments, the cytosine deaminase can be an APOBEC1 deaminase, an APOBEC2 deaminase, an APOBEC3A deaminase, an APOBEC3B deaminase, an APOBEC3C deaminase, an APOBEC3D deaminase, an APOBEC3F deaminase, an APOBEC3G deaminase, an APOBEC3H deaminase, an APOBEC4 deaminase, a human activation-induced deaminase (hAID), rAPOBEC1, FERNY and / or CDA1, optionally pmCDA1, atCDA1 (e.g., At2g19570), and their evolved forms (e.g., SEQ ID NO: 27, SEQ ID NO: 28 or SEQ ID NO: 29). In some embodiments, the cytosine deaminase can be an APOBEC1 deaminase having an amino acid sequence of SEQID NO: 23. In some embodiments, the cytosine deaminase may be an APOBEC3A deaminase having the amino acid sequence of SEQ ID NO: 24. In some embodiments, the cytosine deaminase may be a CDA1 deaminase, optionally a CDA1 having the amino acid sequence of SEQ ID NO: 25. In some embodiments, the cytosine deaminase may be a FERNY deaminase, optionally a FERNY having the amino acid sequence of SEQ ID NO: 26. In some embodiments, a cytosine deaminase useful in the present invention can be about 70% to about 100% identical (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 100% identical) to the amino acid sequence of a naturally occurring cytosine deaminase (e.g., an evolved deaminase).In some embodiments, a cytosine deaminase useful in the present invention may be about 70% to about 99.5% identical (e.g., about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5% identical) to the amino acid sequence of SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, or SEQ ID NO: 26 (e.g., about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5% identical) to the amino acid sequence of SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, or SEQ ID NO: NO:29 is at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% identical). In some embodiments, the polynucleotide encoding the cytosine deaminase can be codon-optimized for expression in plants, and the codon-optimized polypeptide can be about 70% to 99.5% identical to the reference polynucleotide.

[0274] In some embodiments, the nucleic acid constructs of the present invention may also encode uracil glycosylase inhibitor (UGI) (e.g., uracil-DNA glycosylase inhibitor) polypeptides / domains. Thus, in some embodiments, nucleic acid constructs encoding CRISPR-Cas effector proteins and cytosine deaminase domains (e.g., encoding a fusion protein comprising a CRISPR-Cas effector protein domain fused to a cytosine deaminase domain, and / or a CRISPR-Cas effector protein domain fused to a peptide tag or an affinity polypeptide capable of binding a peptide tag, and / or a deaminase protein domain fused to a peptide tag or an affinity polypeptide capable of binding a peptide tag) may also encode uracil-DNA glycosylase inhibitor (UGI), optionally wherein UGI may be codon-optimized for expression in plants. In some embodiments, the present invention provides fusion proteins comprising CRISPR-Cas effector polypeptides, deaminase domains, and UGI and / or one or more polynucleotides encoding them, optionally wherein one or more polynucleotides may be codon-optimized for expression in plants. In some embodiments, the present invention provides fusion proteins, wherein the CRISPR-Cas effector polypeptide, the deaminase domain and the UGI can be fused to any combination of peptide tags and affinity polypeptides as described herein, thereby recruiting the deaminase domain and the UGI to the CRISPR-Cas effector polypeptide and the target nucleic acid. In some embodiments, the guide nucleic acid can be linked to a recruitment RNA motif, and one or more of the deaminase domain and / or the UGI can be fused to an affinity polypeptide capable of interacting with the recruitment RNA motif, thereby recruiting the deaminase domain and the UGI to the target nucleic acid.

[0275] The "uracil glycosylase inhibitor" useful in the present invention may be any protein capable of inhibiting uracil-DNA glycosylase base excision repair enzymes. In some embodiments, the UGI domain comprises a wild-type UGI or a fragment thereof. In some embodiments, the UGI domain useful in the present invention may be about 70% to about 100% identical to the amino acid sequence of a naturally occurring UGI domain (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or 100% identical and any range or value therein). In some embodiments, the UGI domain may comprise the amino acid sequence of SEQ ID NO:41, or a polypeptide having about 70% to about 99.5% sequence identity to the amino acid sequence of SEQ ID NO:41 (e.g., at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% identical to the amino acid sequence of SEQ ID NO:41). For example, in some embodiments, the UGI domain may comprise a fragment of the amino acid sequence of SEQ ID NO:41 that is 100% identical to a portion of consecutive nucleotides (e.g., 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80 consecutive nucleotides; e.g., about 10, 15, 20, 25, 30, 35, 40, 45 to about 50, 55, 60, 65, 70, 75, 80 consecutive nucleotides) of the amino acid sequence of SEQ ID NO:41. In some embodiments, the UGI domain can be a variant of a known UGI (e.g., SEQ ID NO: 41) having about 70% to about 99.5% sequence identity (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% sequence identity, and any range or value therein) to the known UGI. In some embodiments, the polynucleotide encoding the UGI can be codon-optimized for expression in a plant (e.g., a plant), and the codon-optimized polypeptide can be about 70% to about 99.5% identical to the reference polynucleotide.

[0276] Adenine deaminase (or adenosine deaminase) useful in the present invention can be any known or later identified adenine deaminase from any organism (see, e.g., U.S. Pat. No. 10,113,163, the disclosure of which is incorporated herein by reference for adenine deaminase). Adenine deaminase can catalyze the hydrolytic deamination of adenine or adenosine. In some embodiments, adenine deaminase can catalyze the hydrolytic deamination of adenosine or deoxyadenosine to inosine or deoxyinosine, respectively. In some embodiments, adenosine deaminase can catalyze the hydrolytic deamination of adenine or adenosine in DNA. In some embodiments, adenine deaminase encoded by a nucleic acid construct of the present invention can produce an A→G transition in the sense (e.g., "+"; template) strand of a target nucleic acid or a T→C transition in the antisense (e.g., "-", complementary) strand of a target nucleic acid.

[0277] In some embodiments, the adenosine deaminase may be a variant of a naturally occurring adenine deaminase. Thus, in some embodiments, the adenosine deaminase may be about 70% to 100% identical to a wild-type adenine deaminase (e.g., about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to a naturally occurring adenine deaminase, and any range or value therein). In some embodiments, the deaminase or deaminase is not naturally occurring and may be referred to as an engineered, mutated or evolved adenosine deaminase. Thus, for example, an engineered, mutated or evolved adenine deaminase polypeptide or adenine deaminase domain can be about 70% to 99.9% identical to a naturally occurring adenine deaminase polypeptide / domain (e.g., about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 110%, 111%, 112%, 11 In some embodiments, the adenine deaminase polypeptide / domain may be codon-optimized for expression in plants.

[0278] In some embodiments, the adenine deaminase domain can be a wild-type tRNA-specific adenosine deaminase domain, such as a tRNA-specific adenosine deaminase (TadA), and / or a mutant / evolved adenosine deaminase domain, such as a mutant / evolved tRNA-specific adenosine deaminase domain (TadA*). In some embodiments, the TadA domain can be from Escherichia coli (E. coli). In some embodiments, TadA can be modified, such as truncated, with one or more N-terminal and / or C-terminal amino acids missing relative to full-length TadA (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 6, 17, 18, 19 or 20 N-terminal and / or C-terminal amino acid residues may be missing relative to full-length TadA). In some embodiments, the TadA polypeptide or TadA domain does not include an N-terminal methionine. In some embodiments, the wild-type E. coli TadA comprises the amino acid sequence of SEQ ID NO: 30. In some embodiments, the mutant / evolved E. coli TadA* comprises the amino acid sequence of SEQ ID NO: 31-40 (e.g., SEQ ID NO: 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40). In some embodiments, the polynucleotide encoding TadA / TadA* can be codon-optimized for expression in plants.

[0279] Cytosine deaminase catalyzes the deamination of cytosine and produces thymidine (via a uracil intermediate), causing a C to T transition or a G to A transition in the complementary strand of the genome. Thus, in some embodiments, a cytosine deaminase encoded by a polynucleotide of the invention produces a C→T transition in the sense (e.g., "+"; template) strand of a target nucleic acid or a G→A transition in the antisense (e.g., "-", complementary) strand of a target nucleic acid.

[0280] In some embodiments, an adenine deaminase encoded by a nucleic acid construct of the invention produces an A→G transition in the sense (e.g., "+"; template) strand of a target nucleic acid or a T→C transition in the antisense (e.g., "-", complementary) strand of a target nucleic acid.

[0281] The nucleic acid construct encoding the base editor comprising a sequence-specific nucleic acid binding protein and a cytosine deaminase polypeptide of the present invention, and the nucleic acid construct / expression cassette / vector encoding the same, can be used in combination with a guide nucleic acid for modifying a target nucleic acid, including but not limited to generating a C→T or G→A mutation in a target nucleic acid (including but not limited to a plasmid sequence); generating a C→T or G→A mutation in a coding sequence to change the amino acid identity; generating a C→T or G→A mutation in a coding sequence to generate a stop codon; generating a C→T or G→A mutation in a coding sequence to destroy a start codon; generating a point mutation in genomic DNA to generate a mutated LOG gene.

[0282] The nucleic acid constructs of the present invention encoding base editors comprising sequence-specific nucleic acid binding proteins and adenine deaminase polypeptides, as well as expression cassettes and / or vectors encoding the same, can be used in combination with guide nucleic acids to modify target nucleic acids, including but not limited to generating A→G or T→C mutations in target nucleic acids (including but not limited to plasmid sequences); generating A→G or T→C mutations in coding sequences to change amino acid identity; generating A→G or T→C mutations in coding sequences to generate stop codons; generating A→G or T→C mutations in coding sequences to destroy start codons; generating point mutations in genomic DNA to destroy function; and / or generating point mutations in genomic DNA to destroy splice junctions.

[0283] The nucleic acid constructs of the present invention comprising a CRISPR-Cas effector protein or a fusion protein thereof can be used in combination with a guide RNA (gRNA, CRISPR array, CRISPR RNA, crRNA) to modify a target nucleic acid, which is designed to function with the encoded CRISPR-Cas effector protein or domain. The guide nucleic acid that can be used in the present invention comprises at least one spacer sequence and at least one repeat sequence. The guide nucleic acid is capable of forming a complex with the CRISPR-Cas nuclease domain encoded and expressed by the nucleic acid construct of the present invention, and the spacer sequence is capable of hybridizing with the target nucleic acid, thereby guiding the complex (e.g., a CRISPR-Cas effector fusion protein (e.g., a CRISPR-Cas effector domain fused to a deaminase domain and / or a CRISPR-Cas effector domain fused to a peptide tag or affinity polypeptide to recruit a deaminase domain and optionally a UGI) to a target nucleic acid, wherein the target nucleic acid can be modified (e.g., cleaved or edited) or regulated (e.g., regulated transcription) by the deaminase domain.

[0284] As an example, a nucleic acid construct encoding a Cas9 domain (e.g., a fusion protein) connected to a cytosine deaminase domain can be used in combination with a Cas9 guide nucleic acid to modify a target nucleic acid, wherein the cytosine deaminase domain of the fusion protein deaminates cytosine bases in the target nucleic acid, thereby editing the target nucleic acid. In another example, a nucleic acid construct encoding a Cas9 domain (e.g., a fusion protein) connected to an adenine deaminase domain can be used in combination with a Cas9 guide nucleic acid to modify a target nucleic acid, wherein the adenine deaminase domain of the fusion protein deaminates adenosine bases in the target nucleic acid, thereby editing the target nucleic acid.

[0285] Similarly, encoding a Cas12a domain (or other selected CRISPR-Cas nucleases, such as C2c1, C2c3, Cas12b, Cas12c, Cas12d, Cas12e, Cas13a, Cas13b, Cas13c, Cas13d, Cas1, Cas1B, Cas2, Cas3, Cas3', Cas3", Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Cas10, Csyl, Csy2, Csy3, Csel, Cse2, Cscl, Csc2, Csa5, Csn2, Nucleic acid constructs of Csm2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4, CsxlO, Csxl6, CsaX, Csx3, Csxl, Csxl5, Csfl, Csf2, Csf3, Csf4(dinG) and / or Csf5) (e.g., fusion proteins) can be used in combination with a Cas12a guide nucleic acid (or a guide nucleic acid of another selected CRISPR-Cas nuclease) to modify a target nucleic acid, wherein the cytosine deaminase domain or adenine deaminase domain of the fusion protein deaminates cytosine bases in the target nucleic acid, thereby editing the target nucleic acid.

[0286] As used herein, “guide nucleic acid,” “guide RNA,” “gRNA,” “CRISPR RNA / DNA,” “crRNA,” or “crDNA” refers to a sequence comprising at least one spacer sequence complementary to (and hybridizing with) a target DNA (e.g., a protospacer) and at least one repeat sequence (e.g., a repeat sequence of a type V Cas12a CRISPR-Cas system, or a fragment or portion thereof; a repeat sequence of a type II Cas9 CRISPR-Cas system, or a fragment thereof; a type V C2c1 CRISPR Repeat sequences of the Cas system, or fragments thereof; for example, C2c3, Cas12a (also known as Cpf1), Cas12b, Cas12c, Cas12d, Cas12e, Cas13a, Cas13b, Cas13c, Cas13d, Cas1, Cas1B, Cas2, Cas3, Cas3', Cas3", Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Cas10, Csyl, Csy2, Csy3, Csel, Cse2, Cscl, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4, CsxlO, Csx16, CsaX, Csx3, Csxl, Csxl5, Csfl, Csf2, Csf3, Csf4 (dinG) and / or Csf5 CRISPR-Cas system repetitive sequence, or its fragment) nucleic acid, wherein the repetitive sequence can be connected to the 5' end and / or 3' end of the spacer sequence. The design of the gRNA of the present invention can be based on type I, type II, type III, type IV, type V or type VI CRISPR-Cas system.

[0287] In some embodiments, the Cas12a gRNA may comprise a repeat sequence (full length or a portion thereof ("handle"); e.g., a pseudoknot-like structure) and a spacer sequence from 5' to 3'.

[0288] In some embodiments, the guide nucleic acid may comprise more than one repeat-spacer sequence (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10 or more repeat-spacer sequences) (e.g., repeat-spacer-repeat, e.g., repeat-spacer-repeat-spacer-repeat-spacer-repeat-spacer-repeat-spacer, etc.). The guide nucleic acids of the invention are synthetic, artificial, and do not exist in nature. The gRNA can be very long and can be used as an aptamer (e.g., in the MS2 recruitment strategy) or other RNA structures with hanging spacers.

[0289] As used herein, "repetitive sequence" refers to any repetitive sequence of, for example, a wild-type CRISPR Cas locus (e.g., Cas9 locus, Cas12a locus, C2c1 locus, etc.) or a repetitive sequence of a synthetic crRNA that works together with a CRISPR-Cas effector protein encoded by a nucleic acid construct of the present invention. The repetitive sequence that can be used in the present invention can be any known or later identified repetitive sequence (e.g., type I, type II, type III, type IV, type V, or type VI) of the CRISPR-Cas locus, or it can be a synthetic repetitive sequence designed to work in a type I, II, III, IV, V, or VI CRISPR-Cas system. The repetitive sequence may include a hairpin structure and / or a stem-loop structure. In some embodiments, the repetitive sequence may form a pseudoknot-like structure (i.e., "handle") at its 5' end. Thus, in some embodiments, the repetitive sequence may be identical or substantially identical to a repetitive sequence from a wild-type type I CRISPR-Cas locus, a type II CRISPR-Cas locus, a type III CRISPR-Cas locus, a type IV CRISPR-Cas locus, a type V CRISPR-Cas locus, and / or a type VI CRISPR-Cas locus. Repetitive sequences from wild-type CRISPR-Cas loci can be determined by established algorithms, such as using CRISPRfinder provided by CRISPRdb (see, Grissa et al., Nucleic Acids Res. 35 (web server album): W52-7). In some embodiments, the repetitive sequence or a portion thereof is linked to the 5' end of the spacer sequence at its 3' end, thereby forming a repeat-spacer sequence (e.g., a guide nucleic acid, a guide RNA / DNA, a crRNA, a crDNA).

[0290] In some embodiments, the repetitive sequence comprises, consists essentially of, or consists of at least 10 nucleotides, depending on the particular repetitive sequence and whether the guide nucleic acid comprising the repetitive sequence is processed or unprocessed (e.g., about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 to 100 or more nucleotides, or any range or value therein). In some embodiments, the repetitive sequence comprises, consists essentially of, or consists of about 10 to about 20, about 10 to about 30, about 10 to about 45, about 10 to about 50, about 15 to about 30, about 15 to about 40, about 15 to about 45, about 15 to about 50, about 20 to about 30, about 20 to about 40, about 20 to about 50, about 30 to about 40, about 40 to about 80, about 50 to about 100, or more nucleotides.

[0291] The repeat sequence linked to the 5' end of the spacer sequence can include a portion of the repeat sequence (e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 or more consecutive nucleotides of a wild-type repeat sequence). In some embodiments, the portion of the repeat sequence linked to the 5' end of the spacer sequence can be about five to about ten consecutive nucleotides (e.g., about 5, 6, 7, 8, 9, 10 nucleotides) in length and has at least 90% sequence identity (e.g., at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more) to the same region (e.g., 5' end) of the wild-type CRISPR Cas repeat nucleotide sequence. In some embodiments, a portion of a repeat sequence may comprise a pseudoknot-like structure (eg, a "handle") at its 5' end.

[0292] As used herein, a "spacer sequence" is a nucleotide sequence that is complementary to a region or portion of a target nucleic acid (e.g., a target DNA) (e.g., a protospacer) (e.g., a portion of contiguous nucleotides of a LOG gene, wherein the LOG gene (a) comprises a nucleotide sequence having at least 80% sequence identity to the nucleotide sequence of any one of SEQ ID NOs: 72, 73, 79, or 80; (b) comprises a region having at least 80% sequence identity to any one of the nucleotide sequences of SEQ ID NOs: 75-78, 82-120, or 139-151; and / or (c) encodes a region having at least 80% sequence identity to the nucleotide sequence of SEQ ID NOs: 74 or 75. NO:81 has a sequence with at least 80% sequence identity. The spacer sequence can be completely complementary or substantially complementary to a region or portion of the target nucleic acid (e.g., at least about 70% complementary (e.g., about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more)). In some embodiments, the spacer sequence can have one, two, three, four or five mismatches compared to the target nucleic acid, which mismatches can be continuous or discontinuous. In some embodiments, the spacer sequence can have 70% complementarity with the target nucleic acid. In other embodiments, the spacer nucleotide sequence can have 80% complementarity with the target nucleic acid. . In other embodiments, the spacer nucleotide sequence can have 85%, 90%, 95%, 96%, 97%, 98%, 99% or 99.5% complementarity with the target nucleic acid (protospacer), etc. In some embodiments, the spacer sequence is 100% complementary to a region or portion of the target nucleic acid. The spacer sequence can have a length of about 15 nucleotides to about 30 nucleotides (e.g., 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides, or any range or value therebetween). Therefore, in some embodiments, the spacer sequence can have complete complementarity or substantial complementarity in a region where the length of the target nucleic acid (e.g., protospacer) is at least about 15 nucleotides to about 30 nucleotides. In some embodiments, the length of the spacer is about 20 nucleotides. In some embodiments, the length of the spacer is about 21, 22 or 23 nucleotides.

[0293] In some embodiments, the 5' region of the spacer sequence of the guide nucleic acid may be identical to the target DNA, while the 3' region of the spacer may be substantially complementary to the target DNA (such as for a type V CRISPR-Cas system), or the 3' region of the spacer sequence of the guide nucleic acid may be identical to the target DNA, while the 5' region of the spacer may be substantially complementary to the target DNA (such as for a type II CRISPR-Cas system), and thus, the overall complementarity of the spacer sequence to the target DNA may be less than 100%. Thus, for example, in the guide sequence of a type V CRISPR-Cas system, for example, the first 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 nucleotides in the 5' region (i.e., the seed region) of the 20-nucleotide spacer sequence may be 100% complementary to the target DNA, while the remaining nucleotides in the 3' region of the spacer sequence are substantially complementary to the target DNA (e.g., at least about 70% complementary). In some embodiments, the first 1 to 8 nucleotides (e.g., the first 1, 2, 3, 4, 5, 6, 7, 8 nucleotides, and any ranges therein) of the 5' end of the spacer sequence may be 100% complementary to the target DNA, while the remaining nucleotides in the 3' region of the spacer sequence are substantially complementary to the target DNA (e.g., at least about 50% complementary (e.g., 50%, 55%, 60%, 65%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more)).

[0294] As another example, in the guide sequence of a type II CRISPR-Cas system, the first 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 nucleotides in the 3' region (i.e., seed region) of, for example, a 20-nucleotide spacer sequence may be 100% complementary to the target DNA, while the remaining nucleotides in the 5' region of the spacer sequence are substantially complementary to the target DNA (e.g., at least about 70% complementary). In some embodiments, the first 1 to 10 nucleotides (e.g., the first 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 nucleotides, and any ranges therein) of the 3' end of the spacer sequence may be 100% complementary to the target DNA, while the remaining nucleotides in the 5' region of the spacer sequence are substantially complementary to the target DNA (e.g., at least about 50% complementary (e.g., at least about 50%, 55%, 60%, 65%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more or any range or value therein)).

[0295] In some embodiments, the seed region of the spacer can be about 8 to about 10 nucleotides long, about 5 to about 6 nucleotides long, or about 6 nucleotides long.

[0296] As used herein, "target nucleic acid," "target DNA," "target nucleotide sequence," "target region," or "target region in a genome" refers to a region of a plant genome that is fully complementary (100% complementary) or substantially complementary (e.g., at least 70% complementary (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more)) to a spacer sequence in a guide nucleic acid of the invention. The target region that can be used for a CRISPR-Cas system can be positioned immediately 3' (e.g., a type V CRISPR-Cas system) or immediately 5' (e.g., a type II CRISPR-Cas system) to a PAM sequence in the genome of an organism (e.g., a plant genome). The target region can be selected from any region of at least 15 consecutive nucleotides (e.g., 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 nucleotides, etc.) located immediately adjacent to the PAM sequence.

[0297] "Pre-spacer sequence" refers to the target double-stranded DNA, specifically to the portion of the target DNA (e.g., or a target region in the genome) that is completely or substantially complementary (and hybridizes) to the spacer sequence of a CRISPR repeat-spacer sequence (e.g., a guide nucleic acid, a CRISPR array, a crRNA).

[0298] In the case of type V CRISPR-Cas (e.g., Cas12a) systems and type II CRISPR-Cas (Cas9) systems, the protospacer sequence is flanked by (e.g., immediately adjacent to) a protospacer adjacent motif (PAM). For type IV CRISPR-Cas systems, the PAM is located at the 5' end of the non-target strand and the 3' end of the target strand (see below, as an example).

[0299]

[0300] In the case of type II CRISPR-Cas (e.g., Cas9) systems, the PAM is positioned immediately 3' to the target region. The PAM of type I CRISPR-Cas systems is located 5' to the target strand. There is no known PAM for type III CRISPR-Cas systems. Makarova et al. describe the nomenclature for all classes, types, and subtypes of CRISPR systems (Nature Reviews Microbiology 13: 722–736 (2015)). R. Barrangou (Genome Biol. 16: 247 (2015)) describes guide structures and PAMs.

[0301] Typical Cas12a PAMs are T-rich. In some embodiments, typical Cas12a PAM sequences can be 5'-TTN, 5'-TTTN, or 5'-TTTV. In some embodiments, typical Cas9 (e.g., Streptococcus pyogenes) PAMs can be 5'-NGG-3'. In some embodiments, atypical PAMs can be used, but the efficiency may be lower.

[0302] Those skilled in the art can determine additional PAM sequences by established experimental and computational methods. Therefore, for example, experimental methods include targeting sequences flanking all possible nucleotide sequences and identifying sequence members that do not undergo targeting, such as by transformation of target plasmid DNA (Esvelt et al., 2013. Nat. Methods 10: 1116-1121; Jiang et al., 2013. Nat. Biotechnol. 31: 233-239). In some aspects, computational methods may include performing BLAST searches on natural spacers to identify the original target DNA sequence in phage or plasmids, and aligning these sequences to determine conserved sequences adjacent to the target sequence (Briner and Barrangou, 2014. Appl. Environ. Microbiol. 80: 994-1001; Mojica et al., 2009. Microbiology 155: 733-740).

[0303] In some embodiments, the present invention provides expression cassettes and / or vectors comprising nucleic acid constructs of the present invention (e.g., one or more components of the editing system of the present invention). In some embodiments, expression cassettes and / or vectors comprising nucleic acid constructs of the present invention and / or one or more guide nucleic acids may be provided. In some embodiments, nucleic acid constructs of the present invention encoding base editors (e.g., constructs (e.g., fusion proteins) comprising CRISPR-Cas effector proteins and deaminase domains) or components for base editing (e.g., CRISPR-Cas effector proteins fused to peptide tags or affinity polypeptides, deaminase domains fused to peptide tags or affinity polypeptides, and / or UGI fused to peptide tags or affinity polypeptides) may be included in an expression cassette or vector that is the same as or separate from an expression cassette or vector comprising one or more guide nucleic acids. When the nucleic acid construct encoding a base editor or the components for base editing are contained on an expression cassette or vector separate from the expression cassette or vector comprising a guide nucleic acid, the target nucleic acid can be contacted with (e.g., provided together with) the expression cassette or vector encoding the base editor or the components for base editing in any order with each other and the guide nucleic acid, for example, before, simultaneously with, or after providing the expression cassette comprising the guide nucleic acid (e.g., contacting with the target nucleic acid).

[0304] The fusion protein of the present invention may comprise a sequence-specific nucleic acid binding domain / protein, a CRISPR-Cas polypeptide and / or a deaminase domain fused to a peptide tag as known in the art or an affinity polypeptide that interacts with a peptide tag, for recruiting the deaminase to the target nucleic acid. The recruitment method may also include a guide nucleic acid connected to an RNA recruitment motif and a deaminase fused to an affinity polypeptide that can interact with the RNA recruitment motif, thereby recruiting the deaminase to the target nucleic acid. Alternatively, chemical interactions can be used to recruit polypeptides (e.g., deaminases) to target nucleic acids.

[0305] Peptide tags (e.g., epitopes) that can be used in the present invention may include, but are not limited to, GCN4 peptide tags (e.g., Sun-Tag), c-Myc affinity tags, HA affinity tags, His affinity tags, S affinity tags, methionine-His affinity tags, RGD-His affinity tags, FLAG octapeptide, strep tags or strep tags II, V5 tags, and / or VSV-G epitopes. In some embodiments, the peptide tags may also include phosphorylated tyrosine in a specific sequence environment recognized by an SH2 domain, a characteristic consensus sequence containing phosphoserine recognized by 14-3-3 proteins, a proline-rich peptide motif recognized by an SH3 domain, a PDZ protein interaction domain, or a PDZ signal sequence, and an AGO hook motif from a plant. Peptide tags are disclosed in WO2018 / 136783 and U.S. Patent Application Publication No. 2017 / 0219596, the disclosure of which peptide tags are incorporated by reference. Any epitope that can be linked to a polypeptide and has a corresponding affinity polypeptide that can be linked to another polypeptide can be used as a peptide tag in the present invention. The peptide tag can include one copy or two or more copies of the peptide tag or be present in one copy or two or more copies of the peptide tag (e.g., a multimerized peptide tag or a multimerized epitope) (e.g., about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 9, 20, 21, 22, 23, 24 or 25 or more peptide tags). When multimerized, the peptide tags can be directly fused to each other or they can be linked to each other via one or more amino acids (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more amino acids, optionally about 3 to about 10, about 4 to about 10, about 5 to about 10, about 5 to about 15, or about 5 to about 20 amino acids, etc., and any value or range therebetween). In some embodiments, the affinity polypeptide that interacts / binds with the peptide tag can be an antibody. In some embodiments, the antibody can be a scFv antibody. In some embodiments, the affinity polypeptide bound to the peptide tag can be synthetic (e.g., evolved for affinity interactions), including but not limited to affibodies, anticalins, monoclonal antibodies, and / or DARPins (see, e.g., Sha et al., Protein Sci. 26(5):910-924 (2017)); Gilbreth (Curr Opin Struc Biol 22(4):413-420 (2013)), U.S. Pat. No. 9,982,053, each of which is incorporated herein by reference in its entirety for its teachings related to affibodies, anticalins, monoclonal antibodies, and / or DARPins. Example peptide tag sequences and affinity polypeptides thereof include but are not limited to the amino acid sequences of SEQ ID NOs: 45-47.

[0306] In some embodiments, the guide nucleic acid can be linked to an RNA recruitment motif, and the polypeptide to be recruited (e.g., a deaminase) can be fused to an affinity polypeptide that binds to the RNA recruitment motif, wherein the guide sequence binds to the target nucleic acid and the RNA recruitment motif binds to the affinity polypeptide, thereby recruiting the polypeptide to the guide sequence and contacting the target nucleic acid with the polypeptide (e.g., a deaminase). In some embodiments, two or more polypeptides can be recruited to the guide nucleic acid, thereby contacting the target nucleic acid with two or more polypeptides (e.g., a deaminase). Example RNA recruitment motifs and affinity polypeptides thereof include, but are not limited to, sequences of SEQ ID NOs: 48-58.

[0307] In some embodiments, the polypeptide fused to the affinity polypeptide can be a reverse transcriptase, and the guide nucleic acid can be an extended guide nucleic acid connected to an RNA recruitment motif. In some embodiments, the RNA recruitment motif can be located at the 3' end of the extended portion of the extended guide nucleic acid (e.g., 5'-3', repeat-spacer-extension portion (RT template-primer binding site)-RNA recruitment motif). In some embodiments, the RNA recruitment motif can be embedded in the extension portion.

[0308] In some embodiments of the invention, the extended guide RNA and / or guide RNA can be linked to one or two or more RNA recruitment motifs (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more motifs, e.g., at least 10 to about 25 motifs), optionally wherein the two or more RNA recruitment motifs can be the same RNA recruitment motif or different RNA recruitment motifs. In some embodiments, the RNA recruitment motif and the corresponding affinity polypeptide may include, but are not limited to, the telomerase Ku binding motif (e.g., Ku binding hairpin) and the corresponding affinity polypeptide Ku (e.g., Ku heterodimer), the telomerase Sm7 binding motif and the corresponding affinity polypeptide Sm7, the MS2 phage operator stem loop and the corresponding affinity polypeptide MS2 coat protein (MCP), the PP7 phage operator stem loop and the corresponding affinity polypeptide PP7 coat protein (PCP), the SfMu phage Com stem loop and the corresponding affinity polypeptide Com RNA binding protein, the PUF binding site (PBS) and the affinity polypeptide Pumilio / fem-3 mRNA binding factor (PUF), and / or a synthetic RNA aptamer and an aptamer ligand as the corresponding affinity polypeptide. In some embodiments, the RNA recruitment motif and the corresponding affinity polypeptide may be the MS2 phage operator stem loop and the affinity polypeptide MS2 coat protein (MCP). In some embodiments, the RNA recruitment motif and the corresponding affinity polypeptide can be a PUF binding site (PBS) and an affinity polypeptide Pumilio / fem-3m RNA binding factor (PUF).

[0309] In some embodiments, the components used to recruit polypeptides and nucleic acids can be those that function through chemical interactions, which can include, but are not limited to, rapamycin-induced FRB-FKBP dimerization; biotin-streptavidin; SNAP tag; Halo tag; CLIP tag; compound-induced DmrA-DmrC heterodimer; bifunctional ligands (e.g., two protein-binding chemicals fused together; such as dihydrofolate reductase (DHFR).

[0310] In some embodiments, a nucleic acid construct, expression cassette, or vector of the invention optimized for expression in plants may be about 70% to 100% identical (e.g., about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 100%) to a nucleic acid construct, expression cassette, or vector comprising the same polynucleotide but which has not been codon-optimized for expression in plants.

[0311] Also provided herein are cells comprising one or more polynucleotides, guide nucleic acids, nucleic acid constructs, expression cassettes or vectors of the invention.

[0312] The nucleic acid constructs of the present invention (e.g., constructs comprising a sequence-specific nucleic acid binding domain, a CRISPR-Cas effector domain, a deaminase domain, a reverse transcriptase (RT), an RT template and / or a guide nucleic acid, etc.) and expression cassettes / vectors comprising the same can be used as the editing system of the present invention for modifying target nucleic acids and / or their expression.

[0313] The target nucleic acid of any plant or plant part (or plant grouping into groups such as genera or higher classifications) can be modified (e.g., mutated, e.g., base edited, cleaved, cut, etc.) using the polypeptides, polynucleotides, ribonucleoproteins (RNPs), nucleic acid constructs, expression cassettes and / or vectors of the present invention, including angiosperms, gymnosperms, monocots, dicots, C3, C4, CAM plants, mosses, ferns and / or pseudoferns, microalgae and / or macroalgae. The plants and / or plant parts that can be modified as described herein can be plants and / or plant parts of any plant species / variety / cultivar. In some embodiments, the plants that can be modified as described herein are monocots. In some embodiments, the plants that can be modified as described herein are dicots.

[0314] As used herein, the term "plant part" includes, but is not limited to, reproductive tissue (e.g., petals, sepals, stamens, pistils, receptacles, anthers, pollen, flowers, fruits, buds, ovules, seeds, embryos, nuts, kernels, spikes, cobs, and husks); vegetative tissue (e.g., petioles, stems, roots, root hairs, root tips, pith, coleoptiles, stalks, shoots, branches, bark, apical meristems, axillary buds, cotyledons, hypocotyls, and leaves); vascular tissue (e.g., phloem and xylem); specialized cells, such as epidermal cells, parenchyma cells, collenchyma cells, stomata, guard cells, cuticles, mesophyll cells; callus; and cuttings. The term "plant part" also includes plant cells, including intact plant cells in plants and / or plant parts, plant protoplasts, plant tissues, plant organs, plant cell tissue cultures, plant callus, plant clumps, and the like. As used herein, "seedlings" refer to aerial parts, including leaves and stems. As used herein, the term "tissue culture" encompasses cultures of tissues, cells, protoplasts, and callus.

[0315] As used herein, "plant cell" refers to the structural and physiological unit of a plant, which generally includes a cell wall, but also includes a protoplast. The plant cell of the present invention can be in the form of an isolated unicellular cell, or can be a cultured cell, or can be a part of a higher organizational unit such as, for example, a plant tissue (including callus) or a plant organ. In some embodiments, the plant cell can be an algae cell." protoplast" is a plant cell that does not have a cell wall or only has a partial cell wall. Therefore, in some embodiments of the present invention, the transgenic cell comprising the nucleic acid molecule of the present invention and / or the nucleotide sequence is a cell of any plant or plant part, including but not limited to root cells, leaf cells, tissue culture cells, seed cells, flower cells, fruit cells, pollen cells, etc. In some aspects of the present invention, a plant part can be a plant germplasm. In some aspects, a plant cell can be a non-breeding plant cell that no longer generates a plant.

[0316] "Plant cell culture" refers to cultures of plant units such as, for example, protoplasts, cell culture cells, cells in plant tissues, pollen, pollen tubes, ovules, embryo sacs, zygotes, and embryos at various stages of development.

[0317] As used herein, a "plant organ" is a distinct and clearly structured and differentiated part of a plant, such as a root, stem, leaf, flower bud, or embryo.

[0318] As used herein, "plant tissue" refers to a group of plant cells organized into a structural and functional unit. Included is any plant tissue in situ or in culture. The term includes, but is not limited to, whole plants, plant organs, plant seeds, tissue cultures, and any group of plant cells organized into a structural and / or functional unit. The term, when used with or without any specific type of plant tissue listed above or included in this definition, is not intended to exclude any other type of plant tissue.

[0319] In some embodiments of the invention, transgenic tissue cultures or transgenic plant cell cultures are provided, wherein the transgenic tissue or cell culture comprises the nucleic acid molecules / nucleotide sequences of the invention. In some embodiments, the transgenic tissue or cell culture is provided, wherein the transgenic tissue or cell culture comprises the nucleic acid molecules / nucleotide sequences of the invention. In some embodiments, the transgenic tissue or cell is provided, wherein the transgenic tissue or cell culture ...

[0320] Any plant comprising an endogenous LOG gene containing a cis-regulatory element can be modified as described herein to produce a plant comprising an altered root architecture and / or one or more improved yield traits in the plant, and / or increased abiotic stress tolerance / resistance. Non-limiting examples of plants that can be modified as described herein can include, but are not limited to, turf grasses (e.g., bluegrass, bentgrass, ryegrass, fescue), feather reed grass, tufted hairgrass, miscanthus, reed, switchgrass, vegetable crops including artichokes, kohlrabi, arugula, leeks, asparagus, lettuce (e.g., cabbage, leaf lettuce, romaine lettuce), yellow taro, melons (e.g., musk melon, watermelon, Crenshaw melon, honeydew melon, cantaloupe), Brassica crops (e.g., Brussels sprouts, cabbage, cauliflower, broccoli, kale, kale, Chinese cabbage, bok choy), cardoons, carrots, sauerkraut, okra, onions, celery, parsley, chickpeas, parsnips, endive, peppers, potatoes, cucurbits (e.g., zucchini, cucumber, zucchini, pumpkin, squash, honeydew melon, watermelon, cantaloupe), radishes, dry bulb onions (e.g., cauliflower, cauliflower, broccoli, kale, kale, Chinese cabbage, pak choi), onion), rutabaga, eggplant, salsify, endive, shallots, endive, garlic, spinach, shallots, pumpkin, leafy greens, beets (sugar and fodder), sweet potatoes, chard, horseradish, tomatoes, carrots, and spices; fruit crops such as apples, apricots, cherries, nectarines, peaches, pears, plums, prunes, cherries, quince, figs, nuts (e.g., chestnuts, pecans, pistachios, hazelnuts, pistachios, peanuts, walnuts, macadamia nuts, almonds, etc.), citrus (e.g., clementines, kumquats, oranges, grapefruits, tangerines, mandarins, lemons, limes, etc.), blueberries, black raspberries, boysenberries, cranberries, currants, gooseberries, loganberries, raspberries, strawberries, blackberries, grapes (wine and table grapes), avocados, bananas, kiwis, persimmons, pomegranates, pineapples, tropical fruits, pomegranates, melon, mango, papaya and lychee, field crops such as clover, alfalfa, timothy, evening primrose, silver grass, corn / maize (fodder corn, sweet corn, popcorn corn), hops, jojoba, buckwheat, safflower, quinoa, wheat, rice, barley, rye, millet, sorghum, oats, triticale, sorghum, tobacco, kapok, legumes (legumes (e.g., green beans and dry beans), lentils, peas, soybeans), oil plants (rapeseed, canola, mustard, poppy, olive, sunflower, coconut, castor oil plant, cocoa bean, peanut, oil palm), duckweed, Arabidopsis, fiber plants (cotton, flax, hemp, jute), Cannabis (e.g., Cannabis sativa, Cannabis indica and Cannabis sativa) ruderalis), plants of the Lauraceae family (cinnamon, camphor), or plants such as coffee, sugar cane, tea, and the natural rubber plant;and / or bedding plants, such as flowering plants, cacti, succulents and / or ornamental plants (e.g., roses, tulips, violets), and trees, such as forest trees (broadleaf trees and evergreen trees, such as conifers; for example, elm, ash, oak, maple, fir, spruce, cedar, pine, birch, cypress, eucalyptus, willow) and shrubs and other nursery stock. In some embodiments, the nucleic acid construct of the invention and / or the expression cassette and / or vector encoding the nucleic acid construct can be used to modify corn, soybean, wheat, canola, rice, tomato, pepper or sunflower. ;

[0321] In some embodiments, plants that can be modified as described herein can include, but are not limited to, corn, soybean, canola, wheat, rice, cotton, sugarcane, sugar beet, barley, oats, alfalfa, sunflower, safflower, oil palm, sesame, coconut, tobacco, potato, sweet potato, cassava, coffee tree, apple, plum, apricot, peach, cherry, pear, fig, banana, citrus, cocoa, avocado, olive, almond, walnut, strawberry, watermelon, pepper, grape, tomato, cucumber, or Brassica spp (e.g., B. napus, B. oleraceae, B. rapa, B. juncea, and / or B. nigra). In some embodiments, plants that can be modified as described herein are dicots. In some embodiments, plants that can be modified as described herein are monocots. In some embodiments, the plant that can be modified as described herein is corn (ie, Zea mays).

[0322] Therefore, plants or plant cultivars to be preferentially treated according to the invention include all plants which, by genetic modification, have acquired genetic material which imparts particularly advantageous useful properties ("traits") to these plants. Examples of such properties are better plant growth, vigor, stress tolerance, uprightness, resistance to lodging, nutrient uptake, plant nutrition and / or yield, in particular improved growth, increased tolerance to high or low temperatures, increased tolerance to drought or water or soil salinity levels, enhanced flowering performance, easier harvesting, accelerated maturation, higher yield, higher quality and / or higher nutritional value of the harvested product, better storage life and / or processability of the harvested product.

[0323] A further example of such a property is an increased resistance to animal and microbial pests, such as insects, arachnids, nematodes, mites, slugs and snails, due, for example, to toxins formed in the plant. Among the DNA sequences encoding proteins conferring tolerance properties to such animal and microbial pests, in particular insects, mention will be made in particular of the genetic material encoding the Bt protein from Bacillus thuringiensis, which is widely described in the literature and is well known to the person skilled in the art. Mention will also be made of proteins extracted from bacteria such as Photorhabdus (WO 97 / 17432 and WO 98 / 08932). Specifically, mention will be made of Bt Cry or VIP proteins, which include Cry1A, Cry1Ab, Cry1Ac, CryIIA, CryIIIA, CryIIIB2, Cry9c Cry2Ab, Cry3Bb and CryIF proteins or toxic fragments thereof, and hybrids or combinations thereof, in particular Cry1F protein or hybrids derived from Cry1F protein (e.g., hybrid Cry1A-CrylF protein or toxic fragments thereof), Cry1A-type proteins or toxic fragments thereof, preferably Cry1Ac protein or hybrids derived from Cry1Ac protein (e.g., hybrid Cry1Ab-CrylAc protein) or Cry1Ab or Bt2 protein or toxic fragments thereof, Cry2Ae, Cry2Af or Cry2Ag protein or toxic fragments thereof, Cry1A.105 protein or toxic fragments thereof, VIP3Aa19 protein, VIP3Aa20 protein, VIP3A protein produced in COT202 or COT203 cotton events, as described in Estruch et al. (1996), Proc Natl Acad Sci US A.28; 93 (11): 5389-94 or a toxic fragment thereof, such as the Cry protein described in WO2001 / 47952, an insecticidal protein from a strain of Xenorhabdus (such as described in WO98 / 50427), Serratia (especially from S. entomophila) or Photorhabdus, such as the Tc protein from Photorhabdus described in WO98 / 08932. In addition, any variant or mutant of any of these proteins that differs from any of the above-named sequences in some amino acids (1-10, preferably 1-5) is also included herein, and these sequences are particularly the sequences of their toxic fragments, or are fused to a transit peptide, such as a plastid transit peptide, or another protein or peptide.

[0324] Another particularly emphasized example of such properties is the conferring of tolerance to one or more herbicides, such as imidazolinone, sulfonylurea, glyphosate or glufosinate. Among the DNA sequences (i.e., polynucleotides of interest) encoding proteins that confer the properties of tolerance to certain herbicides on transformed plant cells and plants, particular mention will be made of the bar or PAT gene or the Streptomyces coelicolor gene described in WO2009 / 152359, which confer tolerance to glufosinate herbicides; genes encoding suitable EPSPS (5-enolpyruvylshikimate-3-phosphate-synthetase), which confer tolerance to herbicides targeting EPSPS, in particular herbicides such as glyphosate and its salts; genes encoding glyphosate-n-acetyltransferase, or genes encoding glyphosate oxidoreductase. Additional suitable herbicide tolerance traits include at least one ALS (acetolactate synthase) inhibitor (e.g., WO2007 / 024782); a mutated Arabidopsis ALS / AHAS gene (e.g., U.S. Pat. No. 6,855,533); a gene encoding 2,4-D-monooxygenase, which confers tolerance to 2,4-D (2,4-dichlorophenoxyacetic acid); and a gene encoding dicamba monooxygenase, which confers tolerance to dicamba (3,6-dichloro-2-methoxybenzoic acid).

[0325] Further examples of such traits are increased resistance to phytopathogenic fungi, bacteria and / or viruses due to, for example, systemic acquired resistance (SAR), systemins, phytoalexins, elicitors and resistance genes and correspondingly expressed proteins and toxins.

[0326] Particularly useful transgenic events in transgenic plants or plant cultivars that can be preferentially treated according to the present invention include: event 531 / PV-GHBK04 (cotton, insect control, described in WO2002 / 040677), event 1143-14A (cotton, insect control, not deposited, described in WO2006 / 128569); event 1143-51B (cotton, insect control, not deposited, described in WO2006 / 128570); event 1445 (cotton, herbicide tolerance, not deposited, described in US-A 2002-120964 or WO2002 / 034946); Event 17053 (rice, herbicide tolerance, deposited as PTA-9843, described in WO2010 / 117737); Event 17314 (rice, herbicide tolerance, deposited as PTA-9844, described in WO2010 / 117735); Event 281-24-236 (cotton, insect control-herbicide tolerance, deposited as PTA-6233, described in WO2005 / 103266 or US-A 2005-216969); Event 3006-210-23 (cotton, insect control-herbicide tolerance, deposited as PTA-6233, described in US-A 2007-143876 or WO2005 / 103266); Event 3272 (corn, quality traits, deposited as PTA-9972, described in WO2006 / 098952 or US-A 2006-230473); Event 33391 (wheat, herbicide tolerance, deposited as PTA-2347, described in WO2002 / 027004), Event 40416 (corn, insect control-herbicide tolerance, deposited as ATCC PTA-11508, described in WO11 / 075593); Event 43A47 (corn, insect control-herbicide tolerance, deposited as ATCC PTA-11509, described in WO2011 / 075595); Event 5307 (corn, insect control, deposited as ATCC PTA-9561, described in WO2010 / 077816); event ASR-368 (benthgrass, herbicide tolerance, deposited as ATCC PTA-4816, described in US-A 2006-162007 or WO2004 / 053062); event B16 (corn, herbicide tolerance, not deposited, described in US-A 2003-126634); event BPS-CV127-9 (soybean, herbicide tolerance, deposited as NCIMB No. 41603, described in WO2010 / 080829); event BLR1 (canola, male sterility restoration, deposited as NCIMB 41193, described in WO2005 / 074671), event CE43-67B (cotton, insect control,Deposited as DSMACC2724, described in US-A 2009-217423 or WO2006 / 128573); Event CE44-69D (cotton, insect control, not deposited, described in US-A 2010-0024077); Event CE44-69D (cotton, insect control, not deposited, described in WO2006 / 128571); Event CE46-02A (cotton, insect control, not deposited, described in WO2006 / 128572); Event COT102 (cotton, insect control, not deposited, described in US-A 2006-130175 or WO2004 / 039986); Event COT202 (cotton, insect control, not deposited, described in US-A 2007-067868 or WO2005 / 054479); event COT203 (cotton, insect control, not deposited, described in WO2005 / 054480);); event DAS21606-3 / 1606 (soybean, herbicide tolerance, deposited as PTA-11028, described in WO2012 / 033794), event DAS40278 (corn, herbicide tolerance, deposited as ATCC PTA-10244, described in WO2011 / 022469); event DAS-44406-6 / pDAB8264.44.06.1 (soybean, herbicide tolerance, deposited as PTA-11336, described in WO2012 / 075426), event DAS-14536-7 / pDAB8291.45.36.2 (soybean, herbicide tolerance, deposited as PTA-11335, described in WO2012 / 075429), event DAS-59122-7 (corn, insect control - herbicide tolerance, deposited as ATCC PTA11384, described in US-A 2006-070139); event DAS-59132 (corn, insect control-herbicide tolerance, not deposited, described in WO2009 / 100188); event DAS68416 (soybean, herbicide tolerance, deposited as ATCC PTA-10442, described in WO2011 / 066384 or WO2011 / 066360); event DP-098140-6 (corn, herbicide tolerance, deposited as ATCC PTA-8296, described in US-A 2009-137395 or WO 08 / 112019); event DP-305423-1 (soybean, quality traits, not deposited, described in US-A 2008-312082 or WO2008 / 054747); event DP-32138-1 (maize, hybrid system, deposited as ATCC PTA-9158,described in US-A 2009-0210970 or WO 2009 / 103049); event DP-356043-5 (soybean, herbicide tolerance, deposited as ATCC PTA-8287, described in US-A 2010-0184079 or WO 2008 / 002872); event EE-I (eggplant, insect control, not deposited, described in WO 07 / 091277); event Fil 17 (corn, herbicide tolerance, deposited as ATCC 209031, described in US-A 2006-059581 or WO 98 / 044140); event FG72 (soybean, herbicide tolerant, deposited as PTA-11041, described in WO2011 / 063413), event GA21 (corn, herbicide tolerant, deposited as ATCC 209033, described in US-A 2005-086719 or WO 98 / 044140); event GG25 (corn, herbicide tolerant, deposited as ATCC 209032, described in US-A 2005-188434 or WO98 / 044140); event GHB119 (cotton, insect control-herbicide tolerant, deposited as ATCC PTA-8398, described in WO2008 / 151780); event GHB614 (cotton, herbicide tolerant, deposited as ATCC PTA-6878, described in US-A 2010-050282 or WO 2007 / 017186); event GJ11 (maize, herbicide tolerance, deposited as ATCC 209030, described in US-A 2005-188434 or WO 98 / 044140); event GM RZ13 (sugar beet, virus resistance, deposited as NCIMB-41601, described in WO 2010 / 076212); event H7-1 (sugar beet, herbicide tolerance, deposited as NCIMB 41158 or NCIMB 41159, described in US-A 2004-172669 or WO 2004 / 074492); event JOPLIN1 (wheat, disease resistance, not deposited, described in US-A 2008-064032); event LL27 (soybean, herbicide tolerant, deposited as NCIMB41658, described in WO 2006 / 108674 or US-A 2008-320616); event LL55 (soybean, herbicide tolerant, deposited as NCIMB41660, described in WO 2006 / 108675 or US-A 2008-196127); event LLcotton25 (cotton, herbicide tolerant, deposited as ATCC PTA-3343, described in WO 2003 / 013224 or US-A 2003-097687); event LLRICE06 (rice,herbicide tolerance, deposited as ATCC 203353, described in US 6,468,747 or WO2000 / 026345); event LLRice62 (rice, herbicide tolerance, deposited as ATCC 203352, described in WO2000 / 026345), event LLRICE601 (rice, herbicide tolerance, deposited as ATCC PTA-2600, described in US-A 2008-2289060 or WO2000 / 026356); event LY038 (maize, quality traits, deposited as ATCC PTA-5623, described in US-A 2007-028322 or WO2005 / 061720); event MIR162 (maize, insect control, deposited as PTA-8166, described in US-A 2009-300784 or WO2007 / 142840); event MIR604 (corn, insect control, not deposited, described in US-A 2008-167456 or WO2005 / 103301); event MON15985 (cotton, insect control, deposited as ATCC PTA-2516, described in US-A 2004-250317 or WO2002 / 100163); event MON810 (corn, insect control, not deposited, described in US-A 2002-102582); event MON863 (corn, insect control, deposited as ATCC PTA-2605, described in WO2004 / 011601 or US-A 2006-095986); event MON87427 (maize, pollination control, deposited as ATCC PTA-7899, described in WO2011 / 062904); event MON87460 (maize, stress tolerance, deposited as ATCC PTA-8910, described in WO2009 / 111263 or US-A 2011-0138504); event MON87701 (soybean, insect control, deposited as ATCC PTA-8194, described in US-A 2009-130071 or WO2009 / 064652); event MON87705 (soybean, quality trait - herbicide tolerance, deposited as ATCC PTA-9241, described in US-A 2010-0080887 or WO2010 / 037016); event MON87708 (soybean, herbicide tolerance, deposited as ATCC PTA-9670, described in WO2011 / 034704); event MON87712 (soybean, yield, deposited as PTA-10296, described in WO2012 / 051199), event MON87754 (soybean, quality traits, deposited as ATCC PTA-9385, described in WO2012 / 051199); event MON87713 (soybean, yield, deposited as PTA-10296, described in WO2012 / 051199); event MON87714 (soybean, quality traits, deposited as ATCC PTA-9385, described in WO2012 / 051199); event MON87715 (soybean, yield, deposited as PTA-10296, described in WO2012 / 051199); event MON87716 (soybean, yield, deposited as PTA-10296, described in WO2012 / 051199); event MON87717 (soybean, quality traits, deposited as ATCC PTA-9385, described in WO2012 / 051199); event MON87718 (soybean, herbicide tolerance, deposited as ATCC PTA-9670, described in WO2011 / 034704); event MON87719 (soybean, yield, deposited as PTA-10296, described in WO2012MON87769 (soybean, quality trait, deposited as ATCC PTA-8911, described in US-A 2011-0067141 or WO2009 / 102873); event MON88017 (corn, insect control-herbicide tolerance, deposited as ATCC PTA-5582, described in US-A 2008-028482 or WO2005 / 059103); event MON88913 (cotton, herbicide tolerance, deposited as ATCC PTA-4854, described in WO 2004 / 072235 or US-A 2006-059590); event MON88302 (canola, herbicide tolerant, deposited as PTA-10955, described in WO 2011 / 153186), event MON88701 (cotton, herbicide tolerant, deposited as PTA-11754, described in WO 2012 / 134808), event MON89034 (corn, insect control, deposited as ATCC PTA-7455, described in WO 07 / 140256 or US-A 2008-260932); event MON89788 (soybean, herbicide tolerant, deposited as ATCC PTA-6708, described in US-A 2006-282915 or WO2006 / 130436); event MS11 (canola, pollination control-herbicide tolerance, deposited as ATCC PTA-850 or PTA-2485, described in WO2001 / 031042); event MS8 (canola, pollination control-herbicide tolerance, deposited as ATCC PTA-730, described in WO2001 / 041558 or US-A 2003-188347); event NK603 (maize, herbicide tolerance, deposited as ATCC PTA-2478, described in US-A2007-292854); event PE-7 (rice, insect control, not deposited, described in WO2008 / 114282); event RF3 (canola, pollination control-herbicide tolerance, deposited as ATCC PTA-730, described in WO2001 / 041558 or US-A2003-188347); event RT73 (canola, herbicide tolerant, not deposited, described in WO2002 / 036831 or US-A2008-070260); event SYHT0H2 / SYN-000H2-5 (soybean, herbicide tolerant, deposited as PTA-11226, described in WO2012 / 082548), event T227-1 (sugar beet, herbicide tolerant, not deposited, described in WO2002 / 44407 or US-A 2009-265817); event T25 (corn, herbicide tolerant, not deposited,described in US-A 2001-029014 or WO2001 / 051654); event T304-40 (cotton, insect control-herbicide tolerance, deposited as ATCC PTA-8171, described in US-A 2010-077501 or WO2008 / 122406); event T342-142 (cotton, insect control, not deposited, described in WO2006 / 128568); event TC1507 (corn, insect control-herbicide tolerance, not deposited, described in US-A2005-039226 or WO2004 / 099447); event VIP1034 (corn, insect control-herbicide tolerance, deposited as ATCC PTA-3925, described in WO2003 / 052073), event 32316 (corn, insect control-herbicide tolerance, deposited as PTA-11507, described in WO2011 / 084632), event 4114 (corn, insect control-herbicide tolerance, deposited as PTA-11506, described in WO2011 / 084621), event EE-GM3 / FG72 (soybean, herbicide tolerance, ATCC accession number PTA-11041), optionally stacked events Event EE-GM1 / LL27 or event EE-GM2 / LL55 (WO2011 / 063413A2), event DAS-68416-4 (soybean, herbicide tolerance, ATCC accession number PTA-10442, WO2011 / 066360A1), event DAS-68416-4 (soybean, herbicide tolerance, ATCC accession number PTA-10442, WO2011 / 066384A1), event DP-040416-8 (corn, insect control, ATCC C accession number PTA-11508, WO2011 / 075593A1), event DP-043A47-3 (corn, insect control, ATCC accession number PTA-11509, WO2011 / 075595A1), event DP-004114-3 (corn, insect control, ATCC accession number PTA-11506, WO2011 / 084621A1), event DP-032316-8 (corn, insect control, ATCC accession number PTA-11507, WO2 011 / 084632A1), event MON-88302-9 (canola, herbicide tolerance, ATCC accession number PTA-10955, WO2011 / 153186A1), event DAS-21606-3 (soybean, herbicide tolerance, ATCC accession number PTA-11028, WO2012 / 033794A2), event MON-87712-4 (soybean, quality traits, ATCC accession number PTA-10296, WO2012 / 051199A2),Event DAS-44406-6 (soybean, stacked herbicide tolerance, ATCC Accession No. PTA-11336, WO2012 / 075426A1), Event DAS-14536-7 (soybean, stacked herbicide tolerance, ATCC Accession No. PTA-11335, WO2012 / 075429A1), Event SYN-000H2-5 (soybean, herbicide tolerance, ATCC Accession No. PTA-112 26, WO2012 / 082548A2), event DP-061061-7 (canola, herbicide tolerance, no deposit number available, WO2012071039A1), event DP-073496-4 (canola, herbicide tolerance, no deposit number available, US2012131692), event 8264.44.06.1 (soybean, superimposed herbicide tolerance, accession number PTA-11336, WO2012 075426A2), event 8291.45.36.2 (soybean, stacked with herbicide tolerance, accession number PTA-11335, WO2012075429A2), event SYHT0H2 (soybean, ATCC accession number PTA-11226, WO2012 / 082548A2), event MON88701 (cotton, ATCC accession number PTA-11754, WO2012 / 134808A1) , Event KK179-2 (alfalfa, ATCC Accession No. PTA-11833, WO2013 / 003558A1), Event pDAB8264.42.32.1 (soybean, with superimposed herbicide tolerance, ATCC Accession No. PTA-11993, WO2013 / 010094A1), Event MZDT09Y (corn, ATCC Accession No. PTA-13025, WO2013 / 012775A1). ,

[0327] The genes / events that confer the desired traits in question (e.g., polynucleotides of interest) may also be present in combination with one another in transgenic plants. Examples of transgenic plants that may be mentioned are important crop plants such as cereals (wheat, rice, triticale, barley, rye, oats), corn, soybeans, potatoes, sugar beets, sugar cane, tomatoes, peas and other types of vegetables, cotton, tobacco, rapeseed and fruit plants (fruits are apples, pears, citrus fruits and grapes), with particular emphasis on corn, soybeans, wheat, rice, potatoes, cotton, sugar cane, tobacco and rapeseed. Traits that are particularly emphasized are the increased resistance of the plants to insects, arachnids, nematodes, slugs and snails, and the increased resistance of the plants to one or more herbicides.

[0328] Commercially available examples of such plants, plant parts or plant seeds that may be preferentially treated according to the invention include commercial products such as RIB ROUNDUP VT DOUBLE VT TRIPLE BOLLGARD ROUNDUP READY 2 ROUNDUP 2XTEN DTM 、INTACTA RR2 VISTIVE and / or XTENDFLEX TM Plant seeds sold or distributed under a trade name.

[0329] The present invention will now be described with reference to the following examples. It should be understood that these examples are not intended to limit the scope of the claims of the present invention, but are intended to be examples of certain embodiments. Any changes to the exemplary methods that occur to the technician are intended to fall within the scope of the present invention.

[0330] Example

[0331] Example 1. Genome Editing of the LONELY GUY (LOG) Gene

[0332] A strategy was developed to generate variation in the cis-regulatory region of the LOG5 gene with the goal of generating gene variants that were less negatively regulated by auxin binding elements. To generate a range of alleles, CRISPR guide nucleic acids containing spacers with complementarity to regions within the promoter of LOG5 were designed and placed into constructs.

[0333] A strategy was developed to generate loss-of-function variants of the LOG1 gene. To generate a range of alleles, CRISPR guide nucleic acids containing spacers with complementarity to regions within LOG1 were designed and placed into constructs.

[0334] Lines carrying edits in the LOG5 or LOG1 gene were screened, and those showing edits in the targeted gene were developed to the next generation.

[0335] Additional guide constructs containing different spacers (see, e.g., Table 1) were designed to target editing in the promoter region of LOG5.

[0336] Table 1. Boot spacer

[0337] Target Gene Spacer ID sequence SEQ ID NO: Log5 PWsp1895 GTGTAGTTAATGTAGTGACGGTG 121 Log5 PWsp5375 TCTGGGTGTCGGTAGACGGCGAC 122 Log5 PWsp5376 CTAGATCTTGTACAGCGGGCCAC 123 Log5 PWsp5377 TGTCTATATTCGATTGAAAGATG 124 Log1 PWsp1892 CTGCTGCTACCTCCTTGATCTCC 137 Log1 PWsp1893 TCCCCTGGCTGCTTCCGCAGAAG 138

[0338] Example 2. Edited alleles of LOG1 and / or LOG5

[0339] The edited allele of LOG1 gene Zm00001d003013 was generated as described in Example 1 and further described in Table 2.

[0340] Table 2. LOG1 editing alleles

[0341]

[0342]

[0343] The edited alleles of LOG5 gene Zm00001d043692 were generated as described in Example 1 and are further described in Table 3. All edited alleles of LOG5 were located in the promoter sequence and did not affect the coding sequence of the LOG gene.

[0344] Table 3. Edited alleles of LOG5 gene Zm00001d043692

[0345]

[0346]

[0347] Example 3. Phenotypic Assessment of Trait Activity

[0348] Seeds were sown on flat ground and then transferred to pots after seedling formation. All materials were cultivated under standard greenhouse conditions and grown to reproductive maturity. According to standard practice, small paper bags were used to cover the newly grown ears before silking, and male ears were covered plant by plant during flowering to capture pollen. In some cases, flowering and silking were not synchronized, and the ears were not pollinated. We named these ears "unpollinated" ears, and once all ears were removed from the plants after drying, they were evaluated to determine the number of grain rows (as described below).

[0349] After the ears were harvested and dried, the number of kernel rows was manually counted for all ears. The data represent the average of three row counts per ear taken from the middle of the ear, where the row pedigree was most clear. To prevent duplicate counting of rows, a marker (e.g., a paper clip) was inserted between the rows where counting began to designate where the row count should stop.

[0350] All ears were photographed and recorded using a Canon digital camera and the EOS application. The images were then imported into ImageJ and all ears were measured using the line trace function. The ear length was determined in centimeters according to the set scale in the image analysis program, and the distance was output in centimeters after tracing the ear along its length from the tip of the ear to the base of the ear with a line. Unedited accessions and lines transformed with the Gus plasmid were used as wild-type controls for phenotypic analysis.

[0351] Example 4. Phenotypic Analysis of LOG1 Edited Alleles

[0352] The E0 plants produced as described in Example 1 were allowed to self-pollinate in a greenhouse and produce E1 seeds. The E1 seeds were planted and self-pollinated in a greenhouse to produce E2 seeds. The E2 seeds were planted and grown in a greenhouse and self-pollinated, and the resulting ears were analyzed for number of rows of grains, ear width, and ear length as described in Example 3. Tables 4-6 summarize the results of the alleles of the LOG1 gene Zm00001d003013 and demonstrate that the altered LOG1 alleles alter plant configuration characteristics, such as number of rows of grains and ear length, which can increase plant yield.

[0353] Table 4. Number of kernel rows

[0354]

[0355]

[0356] Table 5. Ear width

[0357]

[0358] Table 6. Ear length

[0359]

[0360] Example 5. Root phenotyping analysis

[0361] Root phenotypes were measured by planting plants in an aeroponic environment and imaging the roots that formed. Corn seeds were soaked in water for up to 24 hours and then placed in a paper towel. The paper towel was soaked with water and the soaked corn seeds were placed about an inch apart. The paper towel with the seeds was rolled up and wrapped in a layer of plastic wrap and then a layer of aluminum foil to form a seed packet. The seed packet was placed in a warm growth chamber and allowed to incubate for 2 to 3 days, during which time the seeds began to germinate.

[0362] The aeroponic system was prepared by soaking the container and foam tray in a diluted bleach solution and then rinsing in distilled water. The germinated corn seeds were placed in the foam tray and the loaded tray was placed in the top opening of the aeroponic container. The germinated seeds were continuously sprayed with nutrient solution. When the corn seedlings reached the V2 stage of growth, which was approximately the eighth day after being loaded into the aeroponic system, the seedlings were imaged to capture the root configuration. The root angle was measured as the angle between the stem and the root, with 180 degrees being the maximum angle possible.

[0363] The root architecture changes of plants containing the edited allele of LOG5 as described in Example 2 were analyzed and the observations are summarized in Tables 7 and 8, and it was demonstrated that the edited allele of LOG5 affects the root architecture and can increase plant yield.

[0364] Table 7. Root phenotypes of LOG5 editing alleles

[0365]

[0366] Table 8. Root phenotypes of LOG5 editing alleles

[0367]

[0368] The foregoing is illustrative of the present invention and should not be construed as limiting the present invention. The present invention is defined by the following claims, with equivalents of the claims to be included therein.

Claims

1. A plant or plant part thereof comprising at least one mutation in an endogenous LONELY GUY (LOG) gene encoding a cytokinin-activated polypeptide, wherein the cytokinin-activated polypeptide is a cytokinin nucleoside 5-monophosphate phosphoribosylhydrolase polypeptide.

2. The plant or plant part thereof according to claim 1, wherein the mutation is located in a cis-regulatory element of the endogenous gene.

3. The plant or plant part thereof of claim 1 or claim 2, wherein the cis-regulatory element is a promoter.

4. The plant or plant part thereof according to any one of claims 1 to 3, wherein the at least one mutation reduces or eliminates the negative regulation of the endogenous LOG gene.

5. The plant or plant part thereof as claimed in any one of the preceding claims, wherein the at least one mutation causes increased expression of the endogenous LOG gene.

6. A plant or plant part thereof as claimed in any one of the preceding claims, wherein the mutation produces a plant exhibiting an altered root architecture and / or one or more improved yield traits, wherein the altered root architecture is compared to a plant or plant part not comprising the same mutation.

7. Plant or plant part as described in any one of the preceding claims, wherein the altered root architecture is characterized by one or more of the following phenotypes: increased root biomass, steeper root angle, increased lateral root branching and / or longer roots, and / or the one or more improved yield traits are characterized by increased KRN, increased flower number, increased ear length and / or essentially unchanged ear width.

8. The plant or plant part thereof of claim 7, wherein the plant with altered root architecture exhibits improved yield traits and / or increased tolerance / resistance to abiotic stress, optionally wherein the abiotic stress is water stress (e.g., drought or salt stress) or limited nitrogen).

9. The plant or plant part thereof according to any one of the preceding claims, wherein the endogenous LOG gene is an endogenous LOG1 gene and / or an endogenous LOG5 gene.

10. The plant or plant part thereof according to any one of the preceding claims, wherein the at least one mutation is a base substitution, a base deletion and / or a base insertion.

11. The plant or part thereof as claimed in any one of the preceding claims, wherein the at least one mutation comprises a base substitution to A, T, G or C.

12. The plant or part thereof as claimed in any one of the preceding claims, wherein the at least one mutation is a base deletion of at least one base pair, optionally a deletion of about 1 base pair to about 100 consecutive base pairs.

13. The plant or part thereof of any one of claims 1 to 14, wherein the at least one mutation is a base insertion of at least one base pair.

14. The plant or plant part thereof as claimed in any one of the preceding claims, wherein the endogenous LOG gene: (a) comprising a nucleotide sequence having at least 80% sequence identity to the nucleotide sequence of any one of SEQ ID NO: 72, 73, 79 or 80; (b) comprising a region having at least 80% sequence identity to any one of the nucleotide sequences of SEQ ID NOs: 75-78, 82-120 or 139-151; and / or (c) encoding a sequence having at least 80% sequence identity to either of the amino acid sequences of SEQ ID NO:74 or SEQ ID NO:

81.

15. The plant or plant part thereof of claim 14, wherein the cis-regulatory element is in a region of the endogenous gene located at about nucleotide 1 to about nucleotide 2000, about nucleotide 600 to about nucleotide 1200, about nucleotide 700 to about nucleotide 1000, or about nucleotide 730 to about nucleotide 950, with reference to the nucleotide numbering of SEQ ID NO: 72, optionally the target site is within the region of any one of SEQ ID NOs: 75-78 or 139-151, or within about nucleotide 1 to about nucleotide 2000, about nucleotide 500 to about nucleotide 1900, about nucleotide 700 to about nucleotide 1800, or about nucleotide 950 to about nucleotide 1750, with reference to the nucleotide numbering of SEQ ID NO: 79, optionally the target site is within the region of any one of SEQ ID NOs: 81-120.

16. The plant or plant part thereof as claimed in any one of the preceding claims, wherein the at least one mutation is a semi-dominant mutation and / or a hypomorphic mutation.

17. The plant or plant part thereof as claimed in any one of the preceding claims, wherein the at least one mutation is a non-natural mutation.

18. The plant or part thereof as claimed in any one of the preceding claims, wherein the plant is a monocot or a dicot.

19. The plant or part thereof of any of the preceding claims, wherein the plant is corn, soybean, canola, wheat, rice, cotton, sugarcane, sugar beet, barley, oats, alfalfa, sunflower, safflower, oil palm, sesame, coconut, tobacco, potato, sweet potato, cassava, coffee, apple, plum, apricot, peach, cherry, pear, fig, banana, citrus, cocoa, avocado, olive, almond, walnut, strawberry, watermelon, pepper, grape, tomato, cucumber, or Brassica species.

20. The plant or part thereof of any one of the preceding claims, wherein the at least one mutation results in a mutated LOG gene comprising a sequence having at least 90% sequence identity to any one of SEQ ID NOs: 125, 127 or 129-136, and / or encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 126 or SEQ ID NO:

128.

21. The plant or part thereof as claimed in any one of the preceding claims, wherein the plant is corn.

22. A plant cell, comprising an editing system, wherein the editing system comprises: (a) CRISPR-Cas-associated effector proteins; and (b) a guide nucleic acid (gRNA) having a spacer sequence having complementarity to a region of an endogenous LOG target gene encoding a cytokinin nucleoside 5-monophosphate phosphoribosylhydrolase polypeptide, optionally wherein the editing system further comprises a cytidine deaminase or an adenosine deaminase.

23. The plant cell of claim 22, wherein the endogenous LOG target gene (a) comprising a nucleotide sequence having at least 80% sequence identity to the nucleotide sequence of any one of SEQ ID NO: 72, 73, 79 or 80; (b) comprising a region having at least 80% sequence identity to any one of the nucleotide sequences of SEQ ID NOs: 75-78, 82-120 or 139-151; and / or (c) encoding a sequence having at least 80% sequence identity to either of the amino acid sequences of SEQ ID NO:74 or SEQ ID NO:

81.

24. The plant cell of claim 21 or claim 22, wherein the spacer sequence comprises the nucleotide sequence of any one of SEQ ID NOs: 121-124, 138 or 139.

25. A plant cell comprising at least one mutation in a cis-regulatory element of an endogenous LONELY GUY (LOG) gene, wherein the at least one mutation is a base substitution, base insertion, or base deletion introduced using an editing system comprising a nucleic acid binding domain that binds to a target site in the LOG gene, wherein the LOG gene (a) comprising a nucleotide sequence having at least 80% sequence identity to the nucleotide sequence of any one of SEQ ID NO: 72, 73, 79 or 80; (b) comprising a region having at least 80% sequence identity to any one of the nucleotide sequences of SEQ ID NOs: 75-78, 82-120 or 139-151; and / or (c) encoding a sequence having at least 80% sequence identity to either of the amino acid sequences of SEQ ID NO:74 or SEQ ID NO:

81.

26. The plant cell of claim 25, wherein the cis-regulatory element is a promoter, optionally wherein the at least one mutation reduces or eliminates negative regulation of the endogenous LOG gene, and / or the at least one mutation causes increased expression of the endogenous LOG gene.

27. The plant cell of claim 25 or claim 26, wherein the editing system comprises a nucleic acid binding domain that binds to a target site in the endogenous LOG gene, the target site having at least 80% sequence identity to at least 20 consecutive nucleotides (e.g., 20, 21, 22, 23, 24, 25 or more consecutive nucleotides) of a nucleic acid having at least 80% sequence identity to a region of SEQ ID NO: 72 or to a region of SEQ ID NO: 79, wherein the region of SEQ ID NO: 72 is from about nucleotide 1 to about nucleotide 2000, from about nucleotide 600 to about nucleotide 1200, from about nucleotide 700 to about nucleotide 1000, or from about nucleotide 700 to about nucleotide 1500, optionally the target site is within the region of any one of SEQ ID NOs: 75-78 or 139-151, wherein SEQ ID NOs: The region of NO:79 is from about nucleotide 1 to about nucleotide 2000, from about nucleotide 600 to about nucleotide 1900, from about nucleotide 700 to about nucleotide 1800, or from about nucleotide 950 to about nucleotide 1800, optionally the target site is within the region of any one of SEQ ID NOs:81-120.

28. The plant cell of any one of claims 25 to 27, wherein the nucleic acid binding domain of the editing system is from a polynucleotide-guided endonuclease, a CRISPR-Cas endonuclease (e.g., a CRISPR-Cas effector protein), a zinc finger nuclease, a transcription activator-like effector nuclease (TALEN) and / or an Argonaute protein.

29. The plant cell of any one of claims 25 to 27, wherein the at least one mutation causes the deletion of all or part of the cis-regulatory elements of the endogenous LOG gene.

30. The plant cell of any one of claims 25 to 29, wherein deletion of all or part of the cis-regulatory elements of the LOG gene reduces or eliminates negative regulation of the endogenous LOG gene.

31. The plant cell of any one of claims 25 to 30, wherein deletion of all or part of the cis-regulatory element of the LOG gene results in increased expression of the endogenous LOG gene.

32. The plant cell of any one of claims 25 to 31, wherein the at least one mutation comprises a base substitution to A, T, G or C, optionally wherein the base substitution results in an amino acid substitution.

33. The plant cell of any one of claims 25 to 32, wherein the plant cell is a cell from corn, soybean, canola, wheat, rice, cotton, sugarcane, sugar beet, barley, oats, alfalfa, sunflower, safflower, oil palm, sesame, coconut, tobacco, potato, sweet potato, cassava, coffee, apple, plum, apricot, peach, cherry, pear, fig, banana, citrus, cocoa, avocado, olive, almond, walnut, strawberry, watermelon, pepper, grape, tomato, cucumber, blackberry, raspberry, black raspberry, or a Brassica species.

34. The plant cell of any one of claims 25 to 33, wherein the plant cell is a cell from Zea mays, optionally wherein the gene identification number (gene ID) of the LOG gene is Zm00001d003013 (LOG1) or Zm00001d043692 (LOG5).

35. The plant cell of any one of claims 22 to 34, wherein the at least one mutation is a non-natural mutation.

36. The plant cell of any one of claims 22 to 35, wherein the at least one mutation is a semi-dominant mutation and / or a hypomorphic mutation.

37. The plant cell of any one of claims 22 to 36, wherein the endogenous LOG gene is an endogenous LOG1 gene and / or an endogenous LOG5 gene.

38. The plant cell of any one of claims 22 to 36, wherein the at least one mutation produces a mutated LOG gene comprising a sequence having at least 90% sequence identity to any one of SEQ ID NOs: 125, 127, or 129-136, and / or encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 126 or SEQ ID NO:

128.

39. A plant regenerated from the plant part of any one of claims 1 to 21 or from the plant cell of any one of claims 22 to 38.

40. The plant of claim 39, wherein the plant comprises a mutated LOG gene comprising a sequence having at least 90% sequence identity to any one of SEQ ID NOs: 125, 127, or 129-136, and / or encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 126 or SEQ ID NO:

128.

41. The plant of any one of claims 1 to 21, 39 or 40, wherein the plant comprises an altered root architecture and / or one or more improved yield traits.

42. The plant of any one of claims 39 to 41, wherein the plant is corn.

43. A method of providing a plurality of plants with altered root architecture and / or one or more improved yield traits, the method comprising planting two or more plants according to any one of claims 1 to 21 or 39 to 42 in a growing area, thereby providing a plurality of plants with altered root architecture and / or one or more improved yield traits compared to a plurality of control plants not comprising the at least one mutation, optionally wherein the plurality of plants with altered root architecture exhibit increased root biomass, steeper root angles, increased lateral root branching and / or longer roots, improved yield traits and / or increased tolerance / resistance to abiotic stress, optionally wherein the abiotic stress is water stress (e.g., drought or salt stress) or limited nitrogen, and / or optionally the plurality of plants with one or more improved yield traits exhibit increased KRN, increased flower number, increased ear length and / or substantially unchanged ear width.

44. A method of producing / growing a transgene-free genome-edited (e.g., base-edited) plant, the method comprising: (a) crossing the plant of any one of claims 1 to 21 or 39 to 42 with a plant without a transgene, thereby introducing the at least one mutation into the plant without a transgene; and (b) selecting progeny plants that comprise the at least one mutation but are free of the transgene, thereby producing a genome-edited plant free of the transgene.

45. A method for generating a mutation in an endogenous LONELY GUY (LOG) gene of a plant, the method comprising: (a) targeting a gene editing system to a portion of the LOG gene, the portion comprising a sequence having at least 80% sequence identity to any one of SEQ ID NOs: 75-78 or 139-151 or SEQ ID NOs: 81-120; and (b) selecting a plant comprising a modification in a region of the LOG gene having at least 80% sequence identity to any one of SEQ ID NOs: 75-78 or 139-151 or SEQ ID NOs: 81-120.

46. ​​A method for generating a variation in a cytokinin-activated polypeptide encoded by a LONELY GUY (LOG) gene, the method comprising: introducing an editing system into a plant cell, wherein the editing system targets a region of an endogenous LOG gene encoding the cytokinin-activated polypeptide, and The region of the endogenous LOG gene is contacted with the editing system, thereby introducing mutations into the endogenous LOG gene and generating variations in the cytokinin-activated polypeptide of the plant cell.

47. The method of claim 46, wherein the endogenous LOG gene comprises a nucleotide sequence having at least 80% sequence identity to the nucleotide sequence of any one of SEQ ID NO:72, 73, 79 or 80, and / or encodes an amino acid sequence having at least 80% sequence identity to the amino acid sequence of SEQ ID NO:74 or SEQ ID NO:

81.

48. The method of claim 46 or claim 47, wherein the region of the endogenous LOG gene that is targeted comprises at least 80% sequence identity to the nucleotide sequence of any one of SEQ ID NOs: 75-78 or 139-151 or SEQ ID NOs: 81-120.

49. The method of any one of claims 46 to 48, wherein contacting the region of the endogenous LOG gene in the plant cell with the editing system produces a plant cell comprising the edited LOG gene in its genome, the method further comprising (a) regenerating a plant from the plant cell; (b) selfing the plant to produce a progeny plant (E1); (c) analyzing the progeny plant of (b) for altered root architecture and / or improved yield traits; and (d) selecting progeny plants that exhibit altered root architecture and / or improved yield traits compared to control plants.

50. The method of claim 49, further comprising (e) selfing the selected progeny plant of (d) to produce a progeny plant (E2); (f) analyzing the progeny plant of (e) for altered root architecture; and (g) selecting the progeny plants exhibiting altered root architecture and / or improved yield traits compared to control plants, optionally repeating (e) to (g) one or more times.

51. A method for detecting a LONELY GUY (LOG) gene (mutation in an endogenous LOG gene) in a plant, the method comprising detecting in the genome of the plant a LOG gene having at least one mutation within a region having at least 80% sequence identity to the nucleotide sequence of any one of SEQ ID NOs: 75-78 or 139-151 or SEQ ID NOs: 81-120.

52. The method of claim 43, wherein the mutant LOG gene detected comprises a nucleic acid sequence having at least 90% sequence identity to any one of SEQ ID NOs: 125, 127, or 129-1362, and / or encodes a mutant cytokinin-activated polypeptide having at least 90% sequence identity to SEQ ID NO: 126 or SEQ ID NO:

128.

53. A method for editing a specific site in the genome of a plant cell, the method comprising: Cleavage in a site-specific manner a target site within an endogenous LONELY DOG (LOG) gene in the plant cell, wherein the endogenous LOG gene: (a) comprising a nucleotide sequence having at least 80% sequence identity to the nucleotide sequence of any one of SEQ ID NO: 72, 73, 79 or 80; (b) comprising a region having at least 80% sequence identity to any one of the nucleotide sequences of SEQ ID NOs: 75-78, 82-120, or 139-151; and / or (c) encoding a sequence having at least 80% sequence identity to either of the amino acid sequences of SEQ ID NO:74 or SEQ ID NO:81, thereby producing editing in the endogenous LOG gene of the plant cell.

54. The method of claim 53, wherein the edit in the endogenous LOG gene is in a cis-regulatory element of the LOG gene.

55. The method of claim 54, wherein the cis-regulatory element of the endogenous LOG gene is a promoter.

56. The method of claim 54 or claim 55, wherein the editing in the cis-regulatory element of the endogenous LOG gene reduces or eliminates negative regulation of the endogenous LOG gene, optionally the editing causes increased expression of the endogenous LOG gene.

57. The method of any one of claims 54 to 56, wherein the editing produces a non-natural mutation.

58. The method of any one of claims 54 to 57, wherein the editing in the endogenous LOG gene produces a semi-dominant mutation and / or a hypomorphic mutation.

59. The method of any one of claims 54 to 58, further comprising regenerating a plant from the plant cell comprising the edit in the endogenous LOG gene to produce a plant comprising the edit in its endogenous LOG gene.

60. The method of claim 59, wherein said plant comprising said edit in its endogenous LOG gene exhibits altered root architecture and / or improved yield traits compared to a control plant not comprising said edit, optionally wherein said plant exhibiting altered root architecture exhibits increased root biomass, steeper root angle, increased lateral root branching and / or longer roots, improved yield traits and / or increased tolerance / resistance to abiotic stress, optionally wherein said abiotic stress is water stress (e.g., drought or salt stress) or limited nitrogen and / or said plant exhibiting improved yield traits exhibits increased kernel row number (KRN), increased flower number, increased ear length and / or substantially unchanged ear width.

61. The method of any one of claims 54-60, wherein the editing produces a mutated LOG gene comprising a sequence having at least 90% sequence identity to any one of SEQ ID NOs: 125, 127, or 129-136, and / or encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 126 or SEQ ID NO:

128.

62. A method for preparing a plant, the method comprising: (a) contacting a plant cell population comprising an endogenous gene LOG with a nuclease targeting the endogenous LOG gene, wherein the nuclease is linked to a nucleic acid binding domain that binds to a target site in the endogenous LOG gene, wherein the endogenous LOG gene: (i) comprising a nucleotide sequence having at least 80% sequence identity to the nucleotide sequence of any one of SEQ ID NO: 72, 73, 79 or 80; (ii) comprising a region having at least 80% sequence identity to any one of the nucleotide sequences of SEQ ID NOs: 75-78, 82-120, or 139-151; and / or (iii) encoding a sequence having at least 80% sequence identity to either of the amino acid sequences of SEQ ID NO:74 or SEQ ID NO:81; (b) selecting a plant cell from said population comprising a mutation in said endogenous LOG gene, wherein said mutation is a substitution and / or a deletion; and (c) growing the selected plant cell into a plant comprising the mutation in the endogenous LOG gene.

63. The method of claim 62, wherein the mutation removes or eliminates negative regulation of the endogenous LOG gene, optionally the mutation causes increased expression of the endogenous LOG gene.

64. A method for altering the root architecture of a plant and / or improving one or more yield traits, the method comprising (a) contacting a plant cell comprising an endogenous LONELY GUY (LOG) gene with a nuclease targeted to the endogenous gene, wherein the nuclease is linked to a nucleic acid binding domain that binds to a target site in the endogenous gene, wherein the endogenous LOG gene: (i) comprising a nucleotide sequence having at least 80% sequence identity to the nucleotide sequence of any one of SEQ ID NO: 72, 73, 79 or 80; (ii) comprising a region having at least 80% sequence identity to any one of the nucleotide sequences of SEQ ID NOs: 75-78, 82-120, or 139-151; and / or (iii) encodes a sequence having at least 80% sequence identity to either of the amino acid sequences of SEQ ID NO:74 or SEQ ID NO:81; and (b) growing the plant cell into a plant, thereby altering the root architecture of the plant and / or improving one or more yield traits of the plant.

65. A method for producing a plant or part thereof comprising at least one cell having a mutation in an endogenous LONELY GUY (LOG) gene, the method comprising: contacting the target site in the endogenous LOG gene in the plant or plant part with a nuclease comprising a cleavage domain and a nucleic acid binding domain, wherein the nucleic acid binding domain of the nuclease binds to the target site in the endogenous LOG gene, wherein the endogenous LOG gene: (a) comprising a nucleotide sequence having at least 80% sequence identity to the nucleotide sequence of any one of SEQ ID NO: 72, 73, 79 or 80; (b) comprising a region having at least 80% sequence identity to any one of the nucleotide sequences of SEQ ID NOs: 75-78, 82-120 or 139-151; and / or (c) encoding a sequence having at least 80% sequence identity to either of the amino acid sequences of SEQ ID NO:74 or SEQ ID NO:81, thereby producing a plant or part thereof comprising at least one cell having a mutation in the endogenous LOG gene.

66. The method of any one of claims 62-65, wherein the mutation in the endogenous LOG gene is in a cis-regulatory element, optionally wherein the mutation reduces or eliminates negative regulation of the endogenous LOG gene, and / or the mutation causes increased expression of the endogenous LOG gene.

67. A method of producing a plant or part thereof comprising a mutation in an endogenous LONELY GUY (LOG) gene having altered root architecture and / or improved yield traits, the method comprising contacting a target site in the endogenous LOG gene in the plant or plant part with a nuclease comprising a cleavage domain and a nucleic acid binding domain, wherein the nucleic acid binding domain of the nuclease binds to the target site in the endogenous LOG gene, wherein the endogenous LOG gene: (a) comprising a nucleotide sequence having at least 80% sequence identity to the nucleotide sequence of any one of SEQ ID NO: 72, 73, 79 or 80; (b) comprising a region having at least 80% sequence identity to any one of the nucleotide sequences of SEQ ID NOs: 75-78, 82-120 or 139-151; and / or (c) encoding a sequence having at least 80% sequence identity to either of the amino acid sequences of SEQ ID NO: 74 or SEQ ID NO: 81, thereby producing a plant or plant part having a mutated endogenous LOG gene and altered root architecture and / or improved yield traits.

68. The method of any one of claims 53 to 67, wherein the target site is in a region of the LOG gene located at about nucleotide 1 to about nucleotide 2000, about nucleotide 600 to about nucleotide 1200, about nucleotide 700 to about nucleotide 1000, or about nucleotide 730 to about nucleotide 950, with reference to the nucleotide numbering of SEQ ID NO: 72, optionally the target site is within the region of any one of SEQ ID NOs: 75-78 or 139-151, or within about nucleotide 1 to about nucleotide 2000, about nucleotide 500 to about nucleotide 1900, about nucleotide 700 to about nucleotide 1800, or about nucleotide 950 to about nucleotide 1750, with reference to the nucleotide numbering of SEQ ID NO: 79, optionally the target site is within the region of any one of SEQ ID NOs: 81-120.

69. The method of any one of claims 62 to 68, wherein the plant exhibits altered root architecture and / or improved yield traits compared to control plants.

70. The method of claim 69, wherein the plant with altered root architecture comprises at least one of the following phenotypes: increased root biomass, steeper root angle, increased lateral root branching and / or longer roots, improved yield traits and / or increased tolerance / resistance to abiotic stress compared to a plant not comprising the mutation, optionally wherein the abiotic stress is water stress (e.g., drought or salt stress) or limited nitrogen, and / or the plant with improved yield traits exhibits one or more of the following phenotypes: increased KRN, increased flower number, increased ear length and / or essentially unchanged ear width.

71. The method of any one of claims 62 to 70, wherein the nuclease cleaves the endogenous LOG gene and introduces mutations into cis-regulatory elements of the endogenous LOG gene.

72. The method of claim 71, wherein the cis-regulatory element of the endogenous LOG gene is a promoter region.

73. The method of any one of claims 62 to 72, wherein the mutation is a non-natural mutation.

74. The method of any one of claims 62 to 73, wherein the mutation is a substitution, insertion and / or deletion.

75. The method of any one of claims 62 to 74, wherein the nuclease is a zinc finger nuclease, a transcription activator-like effector nuclease (TALEN), an endonuclease (e.g., Fok1), or a CRISPR-Cas effector protein.

76. The method of any one of claims 53 to 75, wherein the endogenous LOG gene is an endogenous LOG1 gene and / or an endogenous LOG5 gene.

77. The method of any one of claims 62 to 76, wherein the mutated LOG gene comprises a sequence having at least 90% sequence identity to any one of SEQ ID NOs: 125, 127, or 129-136, and / or encodes an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 126 or SEQ ID NO:

128.

78. A guide nucleic acid that binds to a target site in an endogenous gene encoding LONELY GUY (LOG), wherein the endogenous gene: (a) comprising a nucleotide sequence having at least 80% sequence identity to the nucleotide sequence of any one of SEQ ID NO: 72, 73, 79 or 80; (b) comprising a region having at least 80% sequence identity to any one of the nucleotide sequences of SEQ ID NOs: 75-78, 82-120 or 139-151; and / or (c) encoding a sequence having at least 80% sequence identity to either of the amino acid sequences of SEQ ID NO:74 or SEQ ID NO:

81.

79. The guide nucleic acid of claim 78, wherein the target site is in a region of the LOG gene located at about nucleotide 1 to about nucleotide 2000, about nucleotide 600 to about nucleotide 1200, about nucleotide 700 to about nucleotide 1000, or about nucleotide 730 to about nucleotide 950, with reference to the nucleotide numbering of SEQ ID NO: 72, optionally the target site is within the region of any one of SEQ ID NOs: 75-78 or 139-151, or within about nucleotide 1 to about nucleotide 2000, about nucleotide 500 to about nucleotide 1900, about nucleotide 700 to about nucleotide 1800, or about nucleotide 950 to about nucleotide 1750, with reference to the nucleotide numbering of SEQ ID NO: 79, optionally the target site is within the region of any one of SEQ ID NOs: 81-120.

80. The guide nucleic acid of claim 78 or claim 79, wherein the guide nucleic acid comprises a spacer sequence having a nucleotide sequence of any one of SEQ ID NOs: 121-124, 138 or 139.

81. A system comprising a guide nucleic acid as described in any one of claims 78 to 80 and a CRISPR-Cas effector protein associated with the guide nucleic acid.

82. The system of claim 81 , further comprising a tracr nucleic acid associated with the guide nucleic acid and a CRISPR-Cas effector protein, optionally wherein the tracr nucleic acid and the guide nucleic acid are covalently linked.

83. A gene editing system comprising a CRISPR-Cas effector protein associated with a guide nucleic acid, wherein the guide nucleic acid comprises a spacer sequence that binds to a LONELY GUY (LOG) gene.

84. The gene editing system of claim 83, wherein the LOG gene: (a) comprising a nucleotide sequence having at least 80% sequence identity to the nucleotide sequence of any one of SEQ ID NO: 72, 73, 79 or 80; (b) comprising a region having at least 80% sequence identity to any one of the nucleotide sequences of SEQ ID NOs: 75-78, 82-120 or 139-151; and / or (c) encoding a sequence having at least 80% sequence identity to either of the amino acid sequences of SEQ ID NO:74 or SEQ ID NO:

81.

85. The gene editing system of claim 83 or claim 84, wherein the spacer sequence is bound to a cis-regulatory element of the LOG gene.

86. The gene editing system of claim 85, wherein the cis-regulatory element is a promoter of the endogenous LOG gene.

87. The gene editing system of any one of claims 84 to 86, wherein the guide nucleic acid comprises a spacer sequence having a nucleotide sequence of any one of SEQ ID NOs: 121-124, 138 or 139.

88. The gene editing system of any one of claims 84 to 87, further comprising a tracr nucleic acid associated with the guide nucleic acid and a CRISPR-Cas effector protein, optionally wherein the tracr nucleic acid and the guide nucleic acid are covalently linked.

89. A complex comprising a CRISPR-Cas effector protein, the CRISPR-Cas effector protein comprising a cleavage domain and a guide nucleic acid, wherein the guide nucleic acid binds to a target site in a LONELY GUY (LOG) gene, the LOG gene (a) comprising a nucleotide sequence having at least 80% sequence identity to the nucleotide sequence of any one of SEQ ID NO: 72, 73, 79 or 80; (b) comprising a region having at least 80% sequence identity to any one of the nucleotide sequences of SEQ ID NOs: 75-78, 82-120 or 139-151; and / or (c) encoding a sequence having at least 80% sequence identity to any one of the amino acid sequences of SEQ ID NO: 74 or SEQ ID NO: 81, wherein the cleavage domain cleaves the target strand in the LOG gene.

90. An expression cassette comprising (a) a polynucleotide encoding a CRISPR-Cas effector protein comprising a cleavage domain, and (b) a guide nucleic acid that binds to a target site in a LONELY GUY (LOG) gene, wherein the guide nucleic acid comprises a spacer sequence that is complementary to and binds to the target site in the LOG gene, the LOG gene: (i) comprising a nucleotide sequence having at least 80% sequence identity to the nucleotide sequence of any one of SEQ ID NO: 72, 73, 79 or 80; (ii) comprising a region having at least 80% sequence identity to any one of the nucleotide sequences of SEQ ID NOs: 75-78, 82-120, or 139-151; and / or (iii) encodes a sequence having at least 80% sequence identity to either of the amino acid sequences of SEQ ID NO:74 or SEQ ID NO:

81.

91. The complex of claim 89 or the expression cassette of claim 90, wherein the target site is in a region of the LOG gene located at about nucleotide 1 to about nucleotide 2000, about nucleotide 600 to about nucleotide 1200, about nucleotide 700 to about nucleotide 1000, or about nucleotide 730 to about nucleotide 950, with reference to the nucleotide numbering of SEQ ID NO: 72, optionally the target site is within the region of any one of SEQ ID NOs: 75-78 or 139-151, or within about nucleotide 1 to about nucleotide 2000, about nucleotide 500 to about nucleotide 1900, about nucleotide 700 to about nucleotide 1800, or about nucleotide 950 to about nucleotide 1750, with reference to the nucleotide numbering of SEQ ID NO: 79, optionally the target site is within the region of any one of SEQ ID NOs: 81-120.

92. The complex of claim 89 or claim 91, or the expression cassette of claim 89 or claim 90, wherein the LOG gene is a LOG1 gene and / or a LOG5 gene.

93. A mutant nucleic acid encoding a cytokinin nucleoside 5-monophosphate phosphoribohydrolase polypeptide, the mutant nucleic acid comprising a cis-regulatory element having a mutation, optionally wherein the mutation reduces or eliminates negative regulation of the mutant nucleic acid, and / or wherein the mutation causes increased expression of the mutant nucleic acid.

94. The mutant nucleic acid of claim 93, wherein the mutant nucleic acid is a LOG1 gene and / or a LOG5 gene comprising a mutation in the cis-regulatory element.

95. A plant or part thereof comprising a nucleic acid as described in claim 93 or claim 94.

96. A corn plant or plant part thereof, comprising a mutant nucleic acid as claimed in claim 93 or claim 94, optionally wherein the mutant nucleic acid is a mutant LOG gene, and the gene identification number (gene ID) of the LOG gene is Zm00001d003013 (LOG1) or Zm00001d043692 (LOG5).

97. The plant of claim 95 or the corn plant of claim 96, comprising an altered root architecture and / or improved yield traits.

98. The plant or corn plant of claim 97, further comprising one or more of the following phenotypes compared to a plant or corn plant not comprising the mutation: increased root biomass, steeper root angle, increased lateral root branching and / or longer roots, increased KRN, increased flower number, increased ear length and / or essentially unchanged ear width, and / or increased tolerance / resistance to abiotic stress, optionally wherein the abiotic stress is water stress (e.g., drought or salt stress) or limited nitrogen.

99. A corn plant or plant part thereof, comprising at least one mutation in an endogenous LOG gene having a gene identification number (Gene ID) of Zm00001d003013 (LOG1) or Zm00001d043692 (LOG5), optionally wherein the at least one mutation is a non-natural mutation.

100. The corn plant or part thereof of claim 99, wherein the at least one mutation in the endogenous LOG gene having a gene identification number (gene ID) of Zm00001d003013 (LOG1) or Zm00001d043692 (LOG5) is in a cis-regulatory element of the endogenous LOG gene, optionally wherein the at least one mutation is a non-natural mutation.

101. A guide nucleic acid that binds to a target nucleic acid in an endogenous LOG gene whose gene identification number (gene ID) is Zm00001d003013 (LOG1) or Zm00001d043692 (LOG5).

102. The guide nucleic acid of claim 101, wherein the guide nucleic acid comprises a spacer sequence complementary to a target site in a cis-regulatory element of the endogenous LOG gene whose gene identification number (gene ID) is Zm00001d003013 (LOG1) or Zm00001d043692 (LOG5).

103. A mutated endogenous LOG gene in a plant cell, wherein the mutated endogenous LOG gene comprises a sequence having at least 90% sequence identity to any one of SEQ ID NOs: 125, 127, or 129-136, and / or encodes an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 126 or SEQ ID NO:

128.

104. A mutated endogenous LOG gene, wherein the mutated endogenous LOG gene comprises a nucleic acid sequence having at least 90% sequence identity to any one of SEQ ID NOs: 125, 127 or 129-136, and / or encodes an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 126 or SEQ ID NO:

128.

105. A method of producing a plant comprising a mutation in an endogenous LOG gene and at least one polynucleotide of interest, the method comprising: crossing a first plant that is a plant of any one of claims 1 to 21, 39 to 42, or 95 to 100 with a second plant comprising the at least one polynucleotide of interest to produce progeny plants; and Progeny plants comprising the mutation in the LOG gene and the at least one polynucleotide of interest are selected, thereby producing the plant comprising the mutation in the endogenous LOG gene and the at least one polynucleotide of interest.

106. A method of producing a plant comprising a mutation in an endogenous LOG gene and at least one polynucleotide of interest, the method comprising: Introducing at least one polynucleotide of interest into a plant as claimed in any one of claims 1 to 21, 39 to 42 or 95 to 100, thereby producing a plant comprising a mutation in the LOG gene and the at least one polynucleotide of interest.

107. A method of producing a plant comprising a mutation in an endogenous LOG gene and exhibiting a phenotype of improved root architecture and / or improved yield traits (optionally exhibiting increased root biomass, steeper root angles, increased lateral root branching and / or longer roots, increased KRN, increased flower number, increased ear length and / or substantially unchanged ear width), the method comprising crossing a first plant that is a plant of any one of claims 1 to 21, 39 to 42, or 95 to 100 with a second plant comprising at least one polynucleotide of interest to produce progeny plants; and Progeny plants are selected that comprise said mutation in said LOG gene and said at least one polynucleotide of interest, thereby producing said plants that comprise said mutation in an endogenous DRO1 gene and at least one polynucleotide of interest as compared to control plants.

108. A method for controlling weeds in a container (e.g., a pot or seed tray, etc.), a growth chamber, a greenhouse, a field, a recreational area, a lawn, or a roadside, the method comprising applying a herbicide to one or more (plural) plants as described in any one of claims 1-21, 39-42, or 95-1009 growing in the container, growth chamber, greenhouse, field, recreational area, lawn, or roadside, thereby controlling the weeds in the container, growth chamber, greenhouse, field, recreational area, lawn, or roadside where the one or more plants grow.

109. A method of reducing insect predation on a plant, the method comprising applying an insecticide to one or more plants of any one of claims 1 to 21, 39 to 42, or 95 to 100, thereby reducing insect predation on the one or more plants.

110. A method of reducing fungal diseases on plants, the method comprising applying a fungicide to one or more plants of any one of claims 1 to 21, 39 to 42, or 95 to 100, thereby reducing fungal diseases on the one or more plants.

111. The method of claim 109 or claim 110, wherein the one or more plants are grown in a container, a growth chamber, a greenhouse, a field, a recreational area, a lawn, or a roadside.

112. The method of any one of claims 105 to 111, wherein the polynucleotide of interest is a polynucleotide that confers herbicide tolerance, insect resistance, disease resistance, increased yield, increased nutrient use efficiency, or abiotic stress resistance.

Images