Application of (-)-Gallocatechin gallate in preparation of medicine for preventing and / or treating porcine deltacoronavirus

Abstract

The invention discloses an application of (-)-Gallocatechin gallate in preparation of a medicine for preventing and / or treating a porcine deltacoronavirus, and a preparation method of the (-)-Gallocatechin gallate in the preparation of the medicine for preventing and / or treating the porcine deltacoronavirus. It is found for the first time that (-)-Gallocatechin gallate has the activity of activating HK2, shows a remarkable effect of inhibiting porcine deltacoronavirus proliferation in host cells, has a good and stable effect of resisting porcine deltacoronavirus and can be used for preparing the medicine for preventing and / or treating porcine deltacoronavirus.

Description

Technical Field

[0001] The invention relates to application of (-)-Gallocatechin gallate in preparing medicines for preventing and / or treating porcine deltacoronavirus, and belongs to the field of porcine deltacoronavirus treatment. Background Art

[0002] Porcine deltacoronavirus (PDCoV) is a new type of enteropathogenic coronavirus, belonging to the genus Deltacoronavirus of the Coronaviridae family, and is an enveloped single-stranded positive-strand RNA virus. PDCoV can infect pigs of different ages, and is more susceptible in newborn piglets. Infected pigs will have clinical symptoms such as diarrhea, vomiting, dehydration, and decreased appetite. Histopathology shows intestinal damage, multifocal to diffuse, and villous atrophy from the proximal jejunum to the ileum. PDCoV has a high morbidity and mortality rate, causing large-scale diarrhea in piglets, causing significant economic losses to the global pig industry. According to Nature, scientists detected and isolated PDCoV in serum samples from three febrile children in Haiti, indicating that PDCoV can be transmitted across species. There is currently no effective PDCoV vaccine. For the prevention and control of PDCoV, production mainly relies on biosafety prevention and control to prevent the spread and infection of this virus, which greatly increases the cost of breeding companies.

[0003] As an obligate intracellular parasite, viruses are able to utilize various metabolic pathways of the host to meet the bioenergetic and biosynthetic requirements for the production of their offspring. Glycolysis is the earliest metabolic pathway to be elucidated. It mainly occurs in the cytosol of cells and converts glucose into pyruvate through a series of enzymatic reactions, producing ATP as an energy source. For example, adenovirus infection promotes the expression of GLUT1 and GLUT4 proteins in human primary skeletal muscle cells, thereby increasing glucose uptake through the RAS-activated PI3 kinase pathway. Hexokinases (HKs) are the first rate-limiting enzymes in the glycolysis process and play an important role in this process. Viruses can affect host metabolism by utilizing HK2, thereby creating a microenvironment that is conducive to viral replication. For example, hepatitis B virus (HBV) can sequester MAVS of RIG-I by forming a hexokinase ternary complex, preventing its aggregation and mitochondrial localization during HBV infection, indicating that HK2 plays an important role in HBV immune escape.

[0004] Polyphenols are phytochemicals found in many plants and fruits. They are reported to have effects as antioxidants, free radical scavengers, metal chelators, antiallergic, anticancer, antioxidant, anti-inflammatory, antifungal, antiviral and antibacterial agents. In general, these polyphenols are known to have medicinal and chemopreventive effects on human health. In particular, epigallocatechin gallate (-)-Gallocatechin gallate is known as a type of catechin. Epigallocatechin gallate is the most abundant catechin, especially in tea and other plants, and they are a potent antioxidant that may have therapeutic effects against many diseases, including cancer. There are also reports showing that epigallocatechin gallate has benefits in treating brain cancer, prostate cancer, and other types of cancer. There are no studies reported on the efficacy of (-)-Gallocatechin gallate against porcine deltacoronavirus. Summary of the invention

[0005] Purpose of the invention: The technical problem to be solved by the present invention is to provide for the first time the use of (-)-Gallocatechingallate in the preparation of drugs for the prevention and / or treatment of porcine delta coronavirus.

[0006] Technical solution: In order to solve the above technical problems, the present invention provides the use of (-)-Gallocatechin gallate or a pharmaceutically acceptable salt thereof in the preparation of a drug for preventing and / or treating porcine deltacoronavirus.

[0007] Wherein, the prevention is to prevent cells from being infected with swine delta coronavirus or to reduce the infection rate of delta coronavirus disease in cells.

[0008] Wherein, the treatment is to inhibit the growth and replication of porcine deltacoronavirus in cells.

[0009] Among them, the proliferation of PDCoV is inhibited.

[0010] Among them, the expression of PDCoV-N gene is downregulated or the expression level of PDCoV-M protein is reduced.

[0011] The proliferation of PDCoV is inhibited by activating the porcine HK2 gene with the accession number NM_001122987.1. The (-)-Gallocatechin gallate has a significant activation effect on the expression of the HK2 gene, thereby having a significant inhibitory effect on the proliferation of PDCoV.

[0012] Wherein, the HK is hexokinase, which has types I-IV.

[0013] Wherein, the HK2 is hexokinase type II.

[0014] Among them, the HK2 can inhibit the growth and replication of swine delta coronavirus in cells.

[0015] Wherein, the structure of the (-)-Gallocatechin gallate is as follows:

[0016]

[0017] The present invention also provides the use of (-)-Gallocatechin gallate or a pharmaceutically acceptable salt thereof in preparing a drug for inhibiting the proliferation of PDCoV.

[0018] The present invention also provides the use of (-)-Gallocatechin gallate or a pharmaceutically acceptable salt thereof in preparing a drug for down-regulating PDCoV-N gene expression or reducing PDCoV-M protein expression.

[0019] The present invention also provides the use of (-)-Gallocatechin gallate or a pharmaceutically acceptable salt thereof in preparing a drug for activating the pig HK2 gene with the registration number of NM_001122987.1.

[0020] The (-)-Gallocatechin gallate is non-toxic to cells at a concentration of 1 μM to 5 μM.

[0021] The (-)-Gallocatechin gallate is used at a concentration of 2 μM to 5 μM to inhibit the proliferation of swine delta coronavirus by activating HK2.

[0022] Wherein, the dosage form of the drug is any pharmaceutically acceptable dosage form.

[0023] Wherein, the dosage form of the drug includes oral preparations, spray preparations or injection preparations.

[0024] The drug comprises a stereoisomer of (-)-Gallocatechin gallate or a solvate of (-)-Gallocatechin gallate as an active ingredient.

[0025] Wherein, the drug comprises a pharmaceutically acceptable salt of (-)-Gallocatechin gallate or a solvate of a pharmaceutically acceptable salt of (-)-Galloc atechin gallate.

[0026] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages: (1) The present invention first discovered that (-)-Gallocatechin gallate has the activity of activating HK2, and provides an application in the preparation of drugs for preventing and / or treating porcine delta coronavirus. (-)-Gallocatechin gallate exhibits a significant inhibitory effect on the proliferation of porcine delta coronavirus in host cells, and has a good and stable anti-porcine delta coronavirus effect; (2) In the embodiment of the present invention, porcine testicular cells (ST) are used as a cell model, and the experimental results show that: (-)-Gallocatechin gallate has no effect on cell activity in the concentration range of 1 μM to 5 μM; in the concentration range of 2 μM to 5 μM, it has a significant effect of activating HK2, and the virus inhibition effect is positively correlated with the increase in the concentration of (-)-Gallocatechin gallate, and can be used to prepare drugs for preventing and / or treating porcine delta coronavirus. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 The molecular docking model diagram of (-)-Gallocatechin gallate and HK2 shows the interaction site between (-)-Gallocatechin gallate and HK2;

[0028] Figure 2 This is a graph showing the effect of different concentrations of (-)-Gallocatechin gallate on ST cell activity detected by CCK-8 method;

[0029] Figure 3 This is a fluorescence quantitative PCR (RT-qPCR) detection of the effect of overexpression of HK2 gene on PDCoV-N gene in ST cells;

[0030] Figure 4 This is a diagram of the effect of overexpression of HK2 gene on PDCoV-M protein in ST cells detected by Western Blot;

[0031] Figure 5 The effect of different concentrations of (-)-Gallocatechin gallate on the PDCoV-N gene in ST cells was detected by fluorescence quantitative PCR (RT-qPCR). Figure: A: HK2 gene expression; B: PDCoV-N gene expression;

[0032] Figure 6 This is a diagram showing the effect of different concentrations of (-)-Gallocatechin gallate on PDCoV-M protein in ST cells detected by Western Blot. DETAILED DESCRIPTION

[0033] The technical solution of the present invention is further described below in conjunction with the accompanying drawings.

[0034] The cells, viruses and main reagents used in the present invention are as follows:

[0035] Cell line: porcine testicular ST cells (stored in our laboratory) were cultured in DMEM (Basal Media, Shanghai, China) supplemented with 10% fetal bovine serum (Ozfan, Nanjing, China).

[0036] Strain: PDCoV (CHN-GD16-05) was preserved in our laboratory and published in Porcine Delta coronavirus Infection Disrupts the Intestinal Mucosal Barrier and Inhibits Intestinal Stem Cell Differentiation to Goblet Cells via the Notch Signaling Pathway.

[0037] Main reagents: DMEM culture medium (Shanghai Yuanpei Biotechnology Co., Ltd.); fetal bovine serum (Nanjing Shenghang Biotechnology Co., Ltd.); CCK8 kit (Nanjing Novozyme Co., Ltd.); penicillin-streptomycin mixture (Beijing Solebold Technology Co., Ltd.); 0.25% trypsin (Gibco, USA); TRIzol (Baoriyi Biotechnology (Beijing) Co., Ltd.); DEPC water (Beijing Solebold Technology Co., Ltd.); HiScript Q RT SuperMix for qPCR (+gDNA wiper) reverse transcription kit (Nanjing Novozyme Biotechnology Co., Ltd.); AceQ qPCR SYBR Green Master Mix fluorescence quantitative kit (Nanjing Novogene Biotechnology Co., Ltd.); protein lysis buffer (Shanghai Biotech Co., Ltd.); protease inhibitors (Target MOI, MA, USA); 5× non-denaturing protein loading buffer (Shanghai Yazyme Biotechnology Co., Ltd.); 10% protein precast gel (Shanghai Yazyme Biotechnology Co., Ltd.); PDCoV-M antibody (Cat. No.: DA0324, Shanghai Youlong Biotechnology Co., Ltd.) and HK2 protein antibody (22029-1-AP, Wuhan Sanying Biotechnology Co., Ltd.); anti-GAPDH antibody (60004-1-Ig, Wuhan Sanying Biotechnology Co., Ltd.); ultrasensitive ECL chemiluminescence kit (Suzhou Xinsaimei Biotechnology Co., Ltd.); CoraLite594-conjugated Goat Anti-Mouse IgG (H+L) secondary antibody (AA042111, Nanjing Baode Biotechnology Co., Ltd.).

[0038] The reagents not described in detail in the application are all conventional reagents and can be obtained from commercial channels; the methods not described in detail are all conventional experimental methods and can be obtained from the prior art.

[0039] Example 1: Prediction of the interaction site between (-)-Gallocatechin gallate and HK2 using molecular docking

[0040] The present invention adopts a semi-flexible docking method to form a stable complex. This process is very important for explaining the mechanism of action or screening lead compounds, and thus becomes one of the basic methods for structure-based drug design. Gallocatechin gallate (PubChem CID: 199472) and protein HK2 (Uniprot ID: Q1W674_) were molecularly docked using AutoDockVina 1.1.2 software. The size of the protein docking box is Grid Spacing The coordinates of the docking box are: x:y:z:-16.329:1.962:31.101. Other parameters remain at default values. The docking results are set to output the 9 best docking positions. The docking conformation with the lowest binding energy and the highest clustering frequency is considered to be the most potential binding mode between the ligand and the protein. Finally, the docking results were visualized using Pymol 2.4 software. In this way, the binding of the ligand to the receptor can be observed intuitively, and the stability and interaction of the complex can be further analyzed.

[0041] The results are as follows Figure 1 As shown, HK2 (Q1W674) was selected as the receptor, Gallocatechin gallate was selected as the ligand, and hydrogen bonds were indicated in yellow, showing the interaction site between (-)-Gallocatechin gallate and HK2.

[0042] Example 2: CCK-8 method to detect the effect of different concentrations of (-)-Gallocatechin gallate on ST cell activity

[0043] 2000 ST cells (100 μL) were mixed with 10% FBS DMEM medium in each well and inoculated in a 96-well plate, and cultured in a 37°C, 5% CO2 incubator for 24 h. When the cell density reached 80%, (-)-Gallocatechingallate (Shanghai Taoshu Biotechnology Co., Ltd.) was dissolved in DMSO to 10 μM, and then diluted with water to 1 μM, 2 μM, 5 μM, 10 μM, 20 μM, 50 μM, and 100 μM, respectively, and added to 96-well plates (3 replicates were set for each concentration), and a control group (only DMSO was added) was set at the same time, and the treatment time was set to 24 h. After that, the CCK-8 kit was used to detect cell viability, and the CCK-8 solution was added to the 96-well plate at 10 μL per well. The optical density value was detected at 450 nm using a Tecan Infinit200 microplate reader (Sunrise, Tecan, Switzerland). The data were analyzed using GraphPad 8.0.1 software and Student t test was used for statistical analysis. ns indicates no significant difference, *p<0.05 indicates a significant difference, and ***p<0.001 indicates an extremely significant difference.

[0044] The results are as follows Figure 2 As shown, compared with the blank group, (-)-Gallocatechin gallate had no significant effect on cell activity within the concentration range of 1 to 5 μM.

[0045] Example 3: Fluorescence quantitative PCR (RT-qPCR) detection of the effect of overexpression of HK2 gene on PDCoV-N gene in ST cells

[0046] ST cells were cultured at 2×10 5 The cells were inoculated at a density of 100 / well in a 12-well plate containing 1 mL of DMEM medium per well, and HK2 overexpression plasmid transfection was performed when the cell confluence reached about 60%. The steps of HK2 overexpression plasmid transfection are as follows: Using the cDNA of ST cells as a template, the CDS region of the porcine HK2 gene (NM_001122987.1) was amplified using PCR amplification technology; primers were designed based on the CDS region of HK2, and restriction sites (EcoR-I, BamH-I) were added to the primers. The primer sequence is OE-HK2-F:GTGACCGGCGCCTAC GAATTC AT GATCGCCTCGCATCTGCT (the underlined part is the EcoR-I restriction site); R:ATCGATGGACCGGTCG G GATCC CCGCTGTCCAGCCTCTCGGAT (the underline is the BamH-I restriction site). Amplification was performed using PCR amplification technology and gel verification to obtain a nucleotide fragment consistent with the size of the target fragment 2751bp. The target fragment was recovered by purification and sequenced. The sequencing results were compared with the sequence fragment to confirm that the sequence was correct. Among them, the amplification program: 98℃3min; 98℃10s; 60℃20s; 72℃90s; 72℃5min, 35 cycles; amplification system: cDNA: 2μL; Forward primer: 1μL; Reverse primer: 1μL; 2×Hieff Cana ce Plus PCR Master Mix (With Dye): 12.5μL; ddH2O: make up to 25μL. The sequence of the target fragment 2751bp is as follows:

[0047] ATGATCGCCTCGCATCTGCTCGCCTACTTCTTTACAGAGCTCAACCATGACCAA

[0048] GTGCAGAAGGTTGACCAGTATCTCTACCACATGCGCCTCTCCGATGAGACCCTTCT

[0049] GGAGATAGCTAAGCGGTTCCGCAAGGAGATGGAGAAAGGGCTTGGAGCTACCACC

[0050] CACCCCACTGCTTCAGTAAAAATGCTGCCCACCTTTGTGAGGTCTACTCCGGATGG

[0051] GACAGAACACGGAGAGTTCCTGGCTCTGGATCTTGGGGGGACCAATTTCCGGGTG

[0052] CTTTGGGTGAGAGTAACAGACAACGGACTCCAGAAGGTTGAGATGGAGAACCAG

[0053] ATCTACGCCATCCCCGAGGACATCATGCGAGGCAGTGGCACCCAGCTGTTCGACC

[0054] ACATTGCCGAGTGCCTGGCTAACTTCATGGATAAGCTACAAATCAAAGACAAGAA

[0055] GCTCCCTTTGGGTTTCACCTTCTCATTCCCTTGCATCCAAACCAAATTAGATGAGAG

[0056] TTTCCTGGTTTCATGGACCAAGGGTTTCAAGTCCAGTGGTGTGGAAGGGAAAGAC

[0057] GTGGTTACTCTAATCCGGAAGGCCATCCAGAGGAGAGGGGACTTTGATATTGATAT

[0058] TGTGGCCGTGGTGAATGACACAGTTGGGACCATGATGACCTGTGGTTATGATGACC

[0059] AGAACTGCGAGATCGGTCTCATTGTGGGCACGGGCAGCAACGCCTGCTACATGGA

[0060] GGAGATGCGTCACATCGACATGGTAGAAGGTGACGAGGGGCGTATGTGTATCAAC

[0061] ATGGAGTGGGGGGCCTTTGGGGATGACGGCGCCCTTGACGACATCCGCACCGAGT

[0062] TTGACCAGGAGATCGACATGGGCTCCTGAACCCCGGGGAAGCAACTATTTGAGAA

[0063] GATGATCAGTGGATTGTACATGGGGGAGCTGGTGAGGTTGATCCTGGTGAAGATGG

[0064] CCAAGGAGGAGCTGCTTTTCGGGGGAAGCTCAGTCCTGAACTCCTTGCCACGGG

[0065] CCACTTTGAGACCAAAGATGTTTCGGATATTGAAGGGGAGAAGGATGGCATCCGG

[0066] AAGGCCCGGGAGGTCCTGGTGCGGCTGGGCCTGGACCCGACACAGGAGGACTGT

[0067] GTGGCCACTCACCGGGTCTGCCAGATCGTGTCCACACGCTCAGCCAGCCTGTGTG

[0068] CGGCCACACTGGCGGCCGTGCTACGGCGCATCAAGGAGAACAAGGGCAGGAGC

[0069] GGCTGCGCTCCCACCATCGGCGTGGACGGCTCTGTCTACAAGAAACACCCCCATTTC

[0070] GCCAAGCGTCTTCACAAGACCTTGCGGCGCCTGGTGCCTGAACTGCGACATCCGCT

[0071] TCCTCCGCTCTGAGGACGGCAGTGGCAAGGGGGCTGCCATGGTGACAGCAGTGGC

[0072] CTACCGGCTGGCCGATCAACACCGAGCCCGCCAGAAGACTCTGGAGCCTCTAAAG

[0073] CTGAGCCGTGAGCAGCTGCTGGAGGTCAAGAGGAGGATGAAGGTGGAAATGGAG

[0074] CGAGGTCTGAGCAAGGAGACTCATGCCATTGCCCCAGTCAAGATGCTGCCCACCT

[0075] ATGTGTGTGCCACCCGGATGGCACAGAGAAAGGCGACTTCCTGGCCTTGGACCT

[0076] CGGGGGTACCAATTTCCGGGTCCTGCTGGTGCCGGTGCGGAATGGGAAGCGACGC

[0077] GGAGTGGAGATGCACAAAGATCTACTCGATCCCGCAGGAGGTCATGCACGGCA

[0078] CAGGGGACGAGCTCTTTGACCACATCGTCCAGTGCATTGCTGACTTCCTCGAGTAC

[0079] ATGGGCATGAAGGGCGTGTCCCTGCCTCTGGGTTTCACCTTCTCCTTCCCCTGCCA

[0080] GCAGAACAGCCTGGATGAGAGCATCCTTCTCAAGTGGACTAAAGGCTTCAAGGCC

[0081] TCTGGCTGTGAGGGCGAGGACGTGGTCACACTGCTGAAGGAAGCCATCCACCGGC

[0082] GAGAGGAGTTTGACCTGGACGTGGTCGCTGTGGTGAATGACACGGTTGGGACTAT

[0083] GATGACCTGTGGCTATGAAGACCCTCACTGCGAAGTCGGCCTCATCGTTGGCACG

[0084] GGCAGCAATGCCTGCTACATGGAGGAGATGCGGAATGTCGAGCTGGTGGAAGGGG

[0085] AAGAGGGGCGGATGTGTGTCAACATGGAGTGGGGGGCCTTCGGGACAATGGATG

[0086] CCTGGATGACTTCCGCACAGAATTTGATGCGGCCGTGGATGAACTTTCCCTCAATG

[0087] CTGGCAAACAGAGGTTCGAGAAAATGATCAGCGGCATGTACCTGGGTGAGATTGT

[0088] TCGTAACATCCTCATCGATTTCACCAAGCGTGGGCTGCTCTTTCGTGGCCGCATCTC

[0089] GGAGCGACTCAAGACGAGGGGCATCTTTGAAACCAAGTTCCTGTCTCAGATTGAG

[0090] AGTGACTGCCTGGCCCTGCTGCAGGTCCGCGCCATCCTGCACCACTTGGGGCTTG

[0091] AGAGCACTTGCGGCGACAGCATCATTGTCAAGGAGGTGTGCACGGTGGTGGCGCG

[0092] GCGGGCAGCCCAGCTCTGCGGTGCAGGCATGGCCGCCGTGGTGGACAAAATACGA

[0093] GAAAACCGGGGGCTGGACACCCTCAAAGTGACGGTGGGCGTGGACGGGACCCTC

[0094] TACAAGCTACATCCTCACTTTGCCAAAATCATGCATGAGACAGTGAAGGACCTGGC

[0095] TCCAAAATGTGACGTGTCCTTCCTGGAGTCAGAGGACGGCAGTGGGAAGGGGGC

[0096] AGCCCTCATCACTGCTGTGGCCTGCCGCATCCGAGAGGCTGGACAGCGG

[0097] The recovered products with correct sequencing were treated with double enzyme digestion and placed in a metal bath at 37℃ for 3h. After the digestion, the linearized fragments were recovered using a purification recovery kit and the recovered products were placed at -20℃ for standby use. The digestion products were further purified and connected to the digested pcDNA3.1(-) vector (enzyme digestion system: EcoR-I 1μL, BamH-I 1μL, rCutsmart 5μL, pcDNA3.1(-)2000ng, ddH2O supplemented to 50μL; digestion reaction: 37℃, 3h), 50℃5min, and successfully connected to the competent cell DH5αChemically Competent Cell, smeared on a plate containing ampicillin agarose gel, and incubated at 37℃ overnight. Bacteria were selected for sequencing, and the positive results were screened and submitted to Shanghai Sangon Biotechnology Co., Ltd. for sequencing. The HK2 overexpression vector was successfully constructed by comparing the sequencing results. The HK2 overexpression vector was subsequently transfected into ST cells.

[0098] 24h after transfection, ST cells were inoculated with PDCoV (MOI = 1). After 2h, the virus solution was discarded and replaced with a maintenance solution containing 2% FBS (containing 50mL of DMEM medium, 2% fetal bovine serum FBS, and 4μg / mL of trypsin). The cells were collected after continuing to be cultured at 37°C and 5% CO2 for 24h to obtain OE-HK2+PDCoV group cells. Control group (MOCK+PDCoV): blank ST cell poisoning group. Total RNA of cells treated with different methods was extracted: 1mL of TriZol was added to the cell wells, and the cells were lysed by blowing up and down, and collected into 1.5mL EP tubes. 200μL of chloroform was added to each tube, and the mixture was mixed thoroughly and placed on ice for 10 minutes; the tubes were centrifuged at 4°C and 13000rpm for 20 minutes. After centrifugation, the upper aqueous phase was transferred to a new 1.5mL EP tube, and an equal amount of pre-cooled isopropanol was added. The mixture was placed in a -20°C refrigerator to precipitate for 30 minutes, and centrifuged at 13,000 rpm for 20 minutes; the supernatant was discarded, and the RNA precipitate was washed with 1 mL of 75% alcohol; the mixture was centrifuged at 13,000 rpm for 15 minutes, and the RNA precipitate was washed again with 75% alcohol, and centrifuged at 13,000 rpm for 15 minutes; the supernatant was discarded, and the RNA precipitate was air-dried for 5 minutes. The extracted RNA was dissolved in 20 μL of DEPC water, and the purity and concentration of the extracted RNA were detected using a NanoDrop-1000 micronucleic acid assay instrument. The samples were stored at -80°C for future use. According to the gene sequence published in the GenBank database, GAPDH (accession number: NM_001206359.1) was used as the internal reference gene, and qPCR primers were designed using the NCBI website. The upstream primer of GAPDH was 5'-ACATC ATCCCTGCTTCTACTGG-3', the downstream primer was 5'-CTCGGACGCCTGCTTCAC-3', the upstream primer of PDCoV-N was 5'-AGCTGCTACCTCTCCGATTC-3', and the downstream primer was 5'-ACATTGGCACCA GTACGAGA-3'. The primers were prepared by TsingKe Biotechnology Co., Ltd. (TsingKe, Beijing, China). The HiScript Q RT SuperMix for qPCR (+gDNA wiper) reverse transcription kit was used to generate complementary DNA (cDNA) as an RT-PCR template: 20 μL of the reverse transcription system contained 1000 ng RNA, 4 μL of reverse enzyme 5×qRTSuperMix, and DEPC water was used to make up to 20 μL. The inversion program was 50°C for 15 minutes and 85°C for 5 seconds. GAPDH was used as an internal reference, and the expression of the PDCoV-N gene was detected by real-time fluorescence quantitative PCR using the GAPDH primers and PDCoV-N primers designed above.Real-time fluorescence quantitative kit (Vazyme, Nanjing, China) was used for qPCR analysis, and three independent replicates were set for each analysis sample. Data were analyzed using GraphPad 8.0.1 software, and statistical analysis was performed using Student t test. *p<0.05 indicates significant difference.

[0099] The results are as follows Figure 3 As shown, after transfection of HK2 gene overexpression plasmid, the expression level of PDCoV-N gene was downregulated, indicating that HK2 inhibited the proliferation of PDCoV.

[0100] Example 4: Western Blot Detection of the Effect of Overexpression of HK2 Gene on PDCoV-M Protein in ST Cells

[0101] As in Example 3, ST cells were cultured at 2×10 5 The cells were inoculated at a density of 100 / well in a 6-well plate containing 2 mL of culture medium per well, and the overexpression plasmid of HK2 was transfected when the cell confluence reached about 60%. 24 hours after transfection, ST cells were inoculated with PDCoV (MOI = 1). After 2 hours, the virus solution was discarded, and the maintenance solution containing 2% FBS was replaced and the cells were collected after continued culture for 24 hours. Protein lysis buffer (RIPA) was used, and protease inhibitors were added at a ratio of 1:100 for low-temperature lysis for 20 minutes, and centrifuged at 14,000 rpm at 4°C for 20 minutes to obtain the supernatant. The protein concentration was determined using a BCA protein assay kit (Beyotime, Shanghai, China) and denatured at 98°C for 10 minutes.

[0102] The samples were subjected to polyacrylamide gel electrophoresis and electrotransferred to PVDF membranes (Millipore, Canada, USA). After blocking at room temperature for 2 h, PDCoV-M antibody and anti-GAPDH antibody were used, respectively, and incubated overnight at 4°C. The PVDF membrane was rinsed with TBST and incubated with CoraLite594-conjugated Goat Anti-Mouse IgG (H+L) secondary antibody (Proteintech, Wuhan, China) at room temperature. The samples were washed with TBST and analyzed by ECL development.

[0103] The results show Figure 4 As shown in the figure, after transfection with HK2 gene overexpression plasmid, the expression of PDCoV-M protein was downregulated, indicating that HK2 inhibited the proliferation of PDCoV. Among them, OE-HK2: ST cells transfected with HK2 overexpression vector; PDCoV: PDCoV cells; PDCoV-M: PDCoV-M protein; GAPDH: GAPDH protein.

[0104] Example 5: Fluorescence quantitative PCR (RT-qPCR) detection of the effect of different concentrations of (-)-Gallocatechin gallate on the PDCoV-N gene in ST cells

[0105] As in Example 3, ST cells were cultured at 2×10 5The cells were inoculated at a density of 100 / well in a 12-well plate containing 1 mL of culture medium per well, and the overexpression plasmid of HK2 was transfected when the cell confluence reached about 60%. 24 hours after transfection, ST cells were inoculated with PDCoV (MOI = 1). After 2 hours, the virus solution was discarded, and the maintenance solution containing 2% FBS was replaced. Then 2 μM or 5 μM (-)-Gallocatechin gallate was added to each well, and the cells were collected after continuing to culture for 24 hours. Total RNA of cells treated with different methods was extracted: 1 mL TriZol was added to the cell wells, and the cells were lysed by blowing up and down, and collected in 1.5 mL EP tubes. 200 μL chloroform was added to each tube, and the mixture was mixed thoroughly and placed on ice for 10 minutes; centrifuged at 4°C, 13000 rpm for 20 minutes. After centrifugation, the upper aqueous phase was transferred to a new 1.5 mL EP tube, and an equal amount of pre-cooled isopropanol was added. The mixture was placed in a -20℃ refrigerator for precipitation for 30 minutes and centrifuged at 13000rpm for 20 minutes; the supernatant was discarded and the RNA precipitate was washed with 1mL75% alcohol; the mixture was centrifuged at 13000rpm for 15 minutes, the RNA precipitate was washed again with 75% alcohol, and the mixture was centrifuged at 13000rpm for 15 minutes; the supernatant was discarded and the RNA precipitate was air-dried for 5 minutes. The extracted RNA was dissolved in 20μL DEPC water and the purity and concentration of the extracted RNA were detected using a NanoDrop-1000 micronucleic acid measuring instrument. The sample was stored at -80℃ for future use. The HiScript Q RT SuperMix for qPCR (+gDNAwiper) reverse transcription kit was then used to generate complementary DNA (cDNA) as a template for RT-PCR: 20μL of the reverse system contained 1000ngRNA, 4μL of reverse enzyme 5×qRTSuper Mix, and DEPC water was used to make up to 20μL. The reverse program was 50℃ for 15 minutes and 85℃ for 5 seconds. GAPDH was used as an internal reference. GAPDH primers and PDCoV-N primers designed in Example 3 and HK2 primers were used to detect the expression of HK2 gene and PDCoV-N by real-time fluorescence PCR. Real-time fluorescence quantitative kit (Vazyme, Nanjing, China) was used for qPCR analysis, and 3 independent replicates were set for each analysis sample. Data were analyzed using GraphPad 8.0.1 software, and statistical analysis was performed using Student t test. *p<0.05 indicates significant difference, and **p<0.01 indicates extremely significant difference.

[0106] The results are as follows Figure 5 As shown in Figure 2, compared with the control group, after the addition of (-)-Gallocatechin gallate, the expression of HK2 gene was upregulated ( Figure 5 A), and the expression of PDCoV-N gene was significantly downregulated ( Figure 5 B), the proliferation of the virus is inhibited.

[0107] Example 6: Western Blot Detection of the Effect of Different Concentrations of (-)-Gallocatechin Gallate on PDCoV-M Protein in ST Cells

[0108] As in Example 3, ST cells were cultured at 2×10 5 The cells were inoculated at a density of 100 cells / well in a 6-well plate containing 2 mL of culture medium per well, and the overexpression plasmid of HK2 was transfected when the cell confluence reached about 60%. 24 hours after transfection, ST cells were inoculated with PDCoV (MOI = 1). After 2 hours, the virus solution was discarded, and the maintenance solution containing 2% FBS was replaced. Then 2 μM and 5 μM (-)-Gallocatechin gallate were added respectively and the cells were collected after continued culture for 24 hours. Protein lysis buffer (RIPA) (Applygen, Beijing, China) was used, and protease inhibitors (Target MOI, MA, USA) were added for low-temperature lysis for 20 minutes, and the supernatant was obtained by centrifugation at 14,000 rpm at 4°C for 20 minutes. The protein concentration was adjusted using a BCA protein assay kit (Beyotime, Shanghai, China) and denatured at 98°C for 10 minutes.

[0109] The samples were subjected to polyacrylamide gel electrophoresis and electrotransferred to PVDF membranes (Millipore, Canada, USA). After blocking at room temperature for 2 h, HK2 protein antibodies, PDCoV-M antibodies, and anti-GAPDH antibodies were used, respectively, and incubated overnight at 4°C. The PVDF membrane was rinsed with TBST and incubated with CoraLite594-conjugated Goat Anti-Mouse IgG (H+L) secondary antibodies for 2 h at room temperature. The samples were washed with TBST and analyzed by ECL development.

[0110] The results are as follows Figure 6 As shown, compared with the control group, after the addition of (-)-Gallocatechin gallate, the expression of HK2 protein was upregulated, and the expression of PDCoV-M protein was significantly downregulated, and the proliferation of the virus was inhibited.

[0111] The above results indicate that (-)-Gallocatechin gallate has the function of stabilizing and activating HK2 and inhibiting the replication of porcine deltacoronavirus.

Claims

1. Use of (-)-Gallocatechin gallate or a pharmaceutically acceptable salt thereof in the preparation of a medicament for preventing and / or treating porcine deltacoronavirus.

2. The application according to claim 1, characterized in that: Inhibit the proliferation of PDCoV.

3. The use according to claim 1 or 2, characterized in that: Down-regulate the expression of PDCoV-N gene or reduce the expression of PDCoV-M protein.

4. The use according to any one of claims 1 to 3, characterized in that: The proliferation of PDCoV was inhibited by activating the porcine HK2 gene with accession number NM_001122987.

1.

5. Use of (-)-Gallocatechin gallate or a pharmaceutically acceptable salt thereof in the preparation of a medicament for inhibiting the proliferation of PDCoV.

6. Use of (-)-Gallocatechin gallate or a pharmaceutically acceptable salt thereof in the preparation of a drug for down-regulating PDCoV-N gene expression or reducing PDCoV-M protein expression.

7. Use of (-)-Gallocatechin gallate or a pharmaceutically acceptable salt thereof in the preparation of a drug for activating the porcine HK2 gene with the accession number NM_001122987.

1.

8. The use according to any one of claims 1 to 7, characterized in that: The concentration of the (-)-Gallocatechin gallate is 2 μM to 5 μM.

9. The use according to any one of claims 1 to 8, characterized in that: The dosage form of the drug includes oral preparations, spray preparations or injection preparations.

Images