Application of Thrsp as a target in the preparation of drugs for the treatment of MASH

Abstract

This application relates to the field of biomedicine and discloses an application of Thrsp as a target in the preparation of a drug for treating MASH. Thrsp The high expression of the gene in the liver of the MASH mouse model and its confirmation in MASH patients provide important clues for further understanding the pathogenesis of MASH; this application further confirmed the high expression of the gene in the liver of the MASH mouse model and its confirmation in MASH patients through gene overexpression and knockdown experiments. Thrsp The key role of genes in driving the MASH process; Based on the above research, the present invention found Thrsp The gene is not only closely related to the onset of MASH, but also a potential drug target. Thrsp By monitoring the expression level of genes, it is expected that new treatments for MASH will be developed, which will bring new treatment hope for MASH patients and promote research progress in related fields.

Description

Technical Field

[0001] The present application relates to the field of biomedicine, and more specifically, to an application of Thrsp as a target in the preparation of a drug for treating MASH. Background Art

[0002] Metabolic dysfunction-associated fatty liver disease (MAFLD) is a liver disease associated with obesity, hyperlipidemia, insulin resistance, type 2 diabetes (T2DM) and metabolic syndrome. About 30% of the world's population suffers from MAFLD, which increases the risk of cardiovascular disease and death. The clinical histological phenotypes of MAFLD mainly include non-progressive metabolic dysfunction-associated fatty liver (MAFL) and progressive metabolic dysfunction-associated steatohepatitis (MASH). MASH can continue to develop into cirrhosis and liver cancer, leading to increased liver transplantation rates and mortality.

[0003] Although a large number of drug research and development efforts have been carried out worldwide, to date, only one drug for the treatment of MASH has been approved by the U.S. Food and Drug Administration (FDA), which is difficult to meet clinical needs. Therefore, finding new targets and strategies for the treatment of MASH is an urgent and challenging task. Summary of the invention

[0004] The purpose of the present invention is to find new targets and new strategies for treating MASH.

[0005] In this article, Thrsp refers to: Thyroid hormone responsive protein (Thrsp), which is a regulatory factor of fatty acid synthesis and is mainly distributed in lipid-producing tissues such as liver and adipose tissue.

[0006] Thrsp Refers to: Thyroid hormone responsive Spot 14 protein gene, or Spot 14 gene, which plays an important role in lipid synthesis.

[0007] In order to achieve the above invention objectives, this application adopts the following technical solutions:

[0008] In a first aspect, the present application provides the use of Thrsp as a target in the preparation of a drug for treating MASH.

[0009] Furthermore, the Thrsp as a target refers to reducing the expression of Thrsp protein by active substances, or knocking down by gene editing. Thrsp Express.

[0010] In a second aspect, the present application provides a drug for treating MASH, comprising reducing Thrsp Active ingredients in gene expression.

[0011] Furthermore, the drug also includes a pharmaceutically acceptable carrier or excipient.

[0012] Furthermore, the pharmaceutical dosage forms include tablets, powders, granules, capsules, oral solutions, injections or sustained-release preparations.

[0013] In a third aspect, the present application provides the use of Thrsp as a target in the preparation of drugs for treating cirrhosis and liver cancer.

[0014] Furthermore, the Thrsp target refers to reducing the expression of Thrsp protein by active substances, or knocking down by gene editing. Thrsp Express.

[0015] In a fourth aspect, the present application provides a drug for treating liver cirrhosis and liver cancer, comprising reducing Thrsp Active ingredients in gene expression.

[0016] Furthermore, the drug also includes a pharmaceutically acceptable carrier or excipient.

[0017] Furthermore, the pharmaceutical dosage forms include tablets, powders, granules, capsules, oral solutions, injections or sustained-release preparations.

[0018] In summary, this application has the following beneficial effects:

[0019] 1. This application first discovered Thrsp Genes highly expressed in the livers of MASH patients and mice:

[0020] This application reveals for the first time Thrsp Genes are abnormally overexpressed in liver tissues of patients with metabolic dysfunction-associated steatohepatitis (MASH) and corresponding experimental mouse models. This finding was made through spatial transcriptomic analysis of the livers of MAFL and MASH mice. Thrsp The high expression of the gene was not limited to the mouse model but was also verified in MASH patients, which provides important clues for further understanding the pathogenesis of MASH.

[0021] 2. Overexpression and knockdown experiments confirmed Thrsp Is the key gene driving the MASH process:

[0022] To explore in depth Thrsp To investigate the role of genes in the MASH process, this application conducted gene overexpression and knockdown experiments. Thrsp Mouse models and knockdown of genes Thrsp In mouse models expressing Thrsp In mouse models with knockdown of the gene, MASH-related pathological features were significantly aggravated; Thrsp The mouse model expressing TNF-α showed the opposite trend, and these pathological features were alleviated to a certain extent. Thrsp The key role of genes in driving the MASH process.

[0023] 3.Thrsp is a potential drug target for the treatment of MASH:

[0024] This application found Thrsp The gene is not only closely related to the onset of MASH, but also a potential drug target. Thrsp By studying the expression level of the gene, it is expected that a new treatment method for MASH can be developed. Future research will focus on developing efficient and specific inhibitors of Thrsp protein and its gene, and verifying its efficacy and safety through clinical trials. This will bring new treatment hope for MASH patients and promote research progress in related fields. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 : Phenotypes of MAFL and MASH mice. Figure A shows the HE staining, Oil Red O staining, and Sirius red staining of liver tissues of mice fed with normal diet (CD) and Western diet (WD) plus fructose water for 8 weeks (MAFL) and 16 weeks (MASH). Figure B shows the NAS scoring results of liver samples of MAFL and MASH mice. The NAS score of mice in the MASH group was greater than 5. Figure C shows the ratio of liver weight / body weight of MAFL and MASH mice. Figure D shows the ALT and AST levels in the serum of MAFL and MASH mice. Figure E shows the triglyceride (TG) and cholesterol (TC) levels in the liver of MAFL and MASH mice. Figure F shows the insulin level in the serum of MAFL and MASH mice. Figure G shows the fatty acid content in the liver of MAFL and MASH mice; among them, CDS: short-term (8w) normal feeding; CDL: long-term (16w) normal feeding. N=6-7 / group, data are expressed as mean±SE, *P<0.05, **P<0.01, ***P<0.001, all tested by Student's t test.

[0026] Figure 2 :Thrsp is highly expressed in liver samples of MASH mice and MASH patients. Figure A HE staining of mouse liver samples and Thrsp Expression and distribution on the corresponding slices. The redder the color, the higher the expression level. N=2 / group. Figure B shows the expression and quantification of Thrsp protein in the liver of mice in different groups. Figure C shows the expression and quantification of Thrsp protein in the liver of mice in different groups. ThrspFigure D shows the pathological sections of MAFL and MASH patient liver samples and the protein expression level of Thrsp. Figure E shows the NASH-related (NAS) score of the pathological sections of MAFL and MASH patient liver samples. Figure F shows the quantitative results of Thrsp protein expression in Figure D. All data are expressed as mean ± standard error, *P<0.05, **P<0.01, ***P<0.001, Figures B and C were analyzed by one-way analysis of variance, and Figures E and F were analyzed by Student's t test.

[0027] Figure 3 : Overexpression Thrsp Further aggravate the MASH induced by Western diet. Thrsp Overexpression group ( Thrsp ) in the liver Thrsp Figure 3. The mRNA levels of liver and body weight in the two groups. Figure 4. The ratio of liver weight to body weight in the two groups. Figure 5. The TG content in the liver of the two groups. Figure 6. The TC content in the liver of the two groups. Figure 7. The HE, Oil Red O (ORO) and Sirius Red staining of liver sections in the two groups. Figure 8. The fatty acid content in the liver of the two groups. All data are expressed as mean ± standard error, *P<0.05, **P<0.01, ***P<0.001, all using Student's t test.

[0028] Figure 4 : Thrsp Knockdown improved MASH induced by Western diet. A shows the control group (shNC) and Thrsp Knockdown group (sh Thrsp ) in the liver Thrsp Figure 3. mRNA levels of 10474 cells / mL. Figure B shows the ratio of liver weight to body weight of the two groups. Figure C shows the TG content in the liver of the two groups. Figure D shows the TC content in the liver of the two groups. Figure E shows HE, Oil Red O (ORO) and Sirius Red staining of liver sections of the two groups. Figure F shows the fatty acid content in the liver of the two groups. All data are expressed as mean ± standard error, *P<0.05, **P<0.01, ***P<0.001, all tested by Student's t test. DETAILED DESCRIPTION

[0029] The technical scheme and effects of the present application are further described in detail below in conjunction with the embodiments. It should be understood that the specific embodiments described herein are only used to explain the invention, rather than to limit the invention.

[0030] It is worth noting that the experimental materials used in the examples are commercially available unless otherwise specified; the methods used in the examples are existing methods unless otherwise specified.

[0031] Experimental Materials:

[0032] 1. Mice: Male, 8-week-old C57BL / 6J mice were purchased from Beijing Weitonglihua Experimental Animal Technology Co., Ltd.

[0033] 2. Liver samples of MAFL and MASH patients: The samples were obtained from patients with liver cancer / hepatic adenoma combined with MAFLD in the Department of General Surgery of the Sixth People's Hospital Affiliated to Shanghai Jiao Tong University School of Medicine. According to medical routine, the patients will undergo liver cancer / hepatic adenoma resection surgery, and the residual adjacent tumor tissue can be used for clinical research on MAFLD.

[0034] 4. Modified Western diet: purchased from Dyets.

[0035] 5. Adeno-associated virus (AAV): purchased from Heyuan Biotechnology (Shanghai) Co., Ltd.

[0036] 6. Antibodies: purchased from Proteintech, Abcam, CST and SantaCruz.

[0037] 7. Primers: purchased from Sangon Biotech (Shanghai) Co., Ltd.

[0038] Example 1: Construction of MAFL and MASH mouse models

[0039] HE staining, Oil Red O staining and Sirius red staining of mouse liver tissue:

[0040] MAFL mouse construction: 8-week-old C57BL / 6J male mice were fed a Western diet containing 0.2% cholesterol and fructose water (23.1g fructose and 18.9g glucose per 1L of water) for 8 weeks, during which they were allowed to eat freely, thus obtaining the MAFL model mice. Later, the mice were confirmed to be MAFL mice through pathological histochemical experiments, HE, Oil Red O, and Sirius Red staining (staining results are shown in Figure 2). Figure 1 ).

[0041] Construction of MASH mice: 8-week-old C57BL / 6J male mice were fed a Western diet containing 0.2% cholesterol and fructose water (23.1g fructose and 18.9g glucose per 1L of water) for 16 weeks, during which they were allowed to eat freely, thus obtaining MASH model mice. Later, the mice were confirmed to be MASH mice through pathological histochemical experiments, HE, Oil Red O, and Sirius Red staining (staining results are shown in Figure 2). Figure 1 ).

[0042] The pathological histochemical experimental process is as follows:

[0043] The liver tissues of mice and patients in each group were fixed with 4% paraformaldehyde for 24 h, embedded in paraffin and sliced;

[0044] Dewaxing and hydration of paraffin sections:

[0045] Dewaxing with xylene (Ⅰ) for 10 min;

[0046] Dewaxing with xylene (II) for 10 min;

[0047] Anhydrous ethanol (Ⅰ) 2 min;

[0048] Anhydrous ethanol (II) 2 min;

[0049] 95% ethanol for 2 min;

[0050] 80% ethanol for 2 min;

[0051] 70% ethanol for 2 min;

[0052] Distilled water for 2 min;

[0053] Stain with hematoxylin solution for 3-10 minutes (the specific time is adjusted according to the staining results and experimental requirements), and rinse with tap water for 5-10 seconds;

[0054] Differentiate in differentiation solution for 1-5 seconds, rinse with tap water for 20-30 seconds to wash off the differentiation solution;

[0055] The bluing liquid will turn blue for 10s-1min, then rinse with tap water for 20-30s to wash away the bluing liquid;

[0056] Stain with eosin or picrosirius red for 30 seconds to 2 minutes (the specific time is adjusted according to the staining results and experimental requirements), and rinse with tap water for 1 to 5 seconds;

[0057] Dehydration, transparency, and sealing;

[0058] 80% ethanol (Ⅰ) 2-3s;

[0059] 90% ethanol (II) 2-3s;

[0060] 95% ethanol (Ⅰ) 2-3s;

[0061] 95% ethanol (II) 2-3s;

[0062] Anhydrous ethanol (Ⅰ) 2-3s;

[0063] Anhydrous ethanol (II) 1 min;

[0064] Xylene (Ⅰ) 1 min;

[0065] Xylene (II) 1 min;

[0066] Seal with neutral gum and observe under microscope;

[0067] Oil Red O staining (ORO):

[0068] The thickness of the frozen sections was 6 to 10 μm, and they were left unfixed or fixed with 10% formalin for 10 min and then washed with water;

[0069] Rinse the slices briefly in distilled water;

[0070] Immerse the slices in 60% isopropanol for 20 to 30 seconds;

[0071] The sections were placed in modified Oil Red O staining solution (covered) and sealed for staining for 10 to 15 minutes;

[0072] Color separation: Wash briefly in 60% isopropyl alcohol to remove the dye;

[0073] Rinse briefly in distilled water;

[0074] Mayer's hematoxylin staining solution counterstained the nuclei for 1 to 2 minutes;

[0075] 1% hydrochloric acid solution slightly differentiated;

[0076] Rinse with tap water for 10 minutes or induce blueing in dilute lithium carbonate solution;

[0077] Rinse briefly in distilled water;

[0078] Use filter paper to absorb the surrounding moisture;

[0079] Seal with glycerol gelatin or arabic gum and observe under a microscope.

[0080] NAS scoring of MAFL and MASH mouse liver samples:

[0081] According to the results of case histology, the liver lipids, lobular inflammation, hepatocyte swelling and fibrosis were scored, and those with a score greater than 5 were identified as MASH (results as shown in Figure 1 (as shown in B in the figure).

[0082] Ratio of liver weight to body weight of MAFL and MASH mice:

[0083] The ratio of mouse liver weight to the corresponding mouse body weight (results are shown in Figure 1 as shown in C in the figure).

[0084] Serum ALT and AST levels and liver TC and TG levels of MAFL and MASH mice:

[0085] The test was performed according to the instructions of the biochemical kit of Nanjing Jiancheng Company (the results were as follows Figure 1 D and E in the figure).

[0086] Insulin levels in MAFL and MASH mice were measured (results as shown in Figure 1 F in (shown in ):

[0087] 1. Take out the required enzyme labeling strips according to the experimental dosage, add desiccant to the remaining strips, seal them in an aluminum foil bag and store them at 4°C, and use them up within one week;

[0088] 2. Add samples, set up zero well, standard well, and sample well. Add 100 µL of sample diluent to the zero well, and add 100 µL / well of graded diluted standard or sample to be tested to the remaining wells. Be careful not to generate bubbles (it is recommended to make duplicate wells for both standard and sample to avoid experimental errors as much as possible, ensure uninterrupted sample loading, and complete sample loading within 5-10 minutes);

[0089] 3. Cover the ELISA plate with a film and incubate at 37°C for 2 h;

[0090] 4. Washing

[0091] 1) Remove the sealing film (be gentle and avoid excessive movement that may cause the liquid to overflow from the holes), discard the liquid, and pat dry;

[0092] 2) Wash the strips with washing solution (1×), 350-400 µL per well. After washing, shake off the liquid and pat the strips dry. Repeat this step 4 times to prevent foreign matter from entering the wells and the strips from drying out.

[0093] 5. Add 100 µL of detection antibody (1×) to each well, cover with sealing film, and incubate at 37°C for 1 h;

[0094] 6. Repeat step 4;

[0095] 7. Add 100 µL HRP-labeled secondary antibody (1×) to each well, cover with sealing film, and incubate at 37°C for 40 min;

[0096] 8. Repeat step 4;

[0097] 9. Color development: Add 100 µL of TMB color development solution to each well and develop at 37°C in the dark for 15-20 min (if the color is lighter, the color development time can be appropriately extended, not exceeding 30 min; keep the color development substrate in the dark at all times, the color development substrate should be colorless and transparent before adding the sample, if there is any color change, do not use it);

[0098] 10. Stop: Add 100 µL of stop solution to each well, and the blue color will turn yellow. The order of adding the stop solution and TMB colorimetric solution is the same; (Note: Avoid contact of the stop solution with eyes and skin)

[0099] 11. Reading: Use 630 nm as the calibration wavelength and use a microplate reader to measure the optical density (OD value) of each well at a wavelength of 450 nm. Read within 5 minutes after adding the stop solution. If there is no 630 nm wavelength, you can also directly use the 450 nm wavelength for reading;

[0100] 12. Data analysis: The OD value of the zero well should be subtracted from the OD value of each standard and sample, and the duplicate wells should be set to take the average value. The concentration of the standard is used as the horizontal axis and the OD value is used as the vertical axis. Professional software (such as Origin, ELISACalc, etc.) is used for four-parameter fitting (4-PL). The fitting concentration is calculated from the standard curve according to the OD value of the sample, and then multiplied by the dilution factor to obtain the actual concentration of the sample.

[0101] Detection of fatty acid content in the liver of MAFL and MASH mice (results as shown in Figure 1 G in (shown in Figure 1):

[0102] based on Thrsp GC-MS targeted lipidomics technology was used to detect the content of 51 medium- and long-chain free fatty acids (FFA) in mouse liver to explore Thrsp Regulatory effect on FFA.

[0103] This experiment was commissioned by Suzhou Panomik Biopharmaceutical Technology Co., Ltd.

[0104] Embodiment 2: Thrsp Highly expressed in the liver of MASH mice and humans

[0105] HE staining of mouse liver samples and Thrsp Expression and distribution on the corresponding slices (results as shown in Figure 2 (as shown in A):

[0106] Spatial transcriptomics experiment: Fresh liver tissues (about 6.5 mm × 6.5 mm square tissue blocks) were obtained from mice in the MAFL group and the MASH group, embedded in 4°C pre-cooled OCT, and quickly transferred horizontally to a -80°C refrigerator or frozen in dry ice for 30 min. The sample name and embedding date were noted on the embedding box. After that, sample RNA and HE quality control, frozen sections and selection were performed, tissue permeabilization time was optimized, sections were fixed, HE stained, pathological features were observed under a microscope, and photos were taken in the bright field. After tissue permeabilization, cDNA synthesis, enrichment and library construction were performed, and then spatial transcriptome sequencing and data analysis were performed. Spatial transcriptomics technology was used to explore the key genes that drive NAFL to develop into NASH and their spatial distribution information, providing strong technical support for in-depth understanding of cell communication and molecular mechanisms in tissues with different spatial distributions during the progression of MASH.

[0107] The expression of Thrsp protein and mRNA levels in the liver of mice in different groups (results as shown in Figure 2 B and C in the figure):

[0108] Protein blot detection: After using lysis buffer to prepare tissues or cells into homogenate or cell lysate, centrifuge at 14000rpm and 4℃ for 15 minutes, take the supernatant for use, add loading buffer to the supernatant, and cook the sample at 95℃ in a metal bath for 10 minutes. Load the sample after cooling, electrophoresis at 80V for 30 minutes, adjust to 120V and continue electrophoresis until bromophenol blue reaches the bottom of the gel, and stop electrophoresis. Then transfer the membrane, block with 5% skim milk powder for one hour, incubate the primary antibody at 4℃ overnight, wash the primary antibody with TBST buffer, 15min each time, and wash 3 times. After incubating the secondary antibody at room temperature for one hour, wash the secondary antibody with TBST, 15min each time, and wash 3 times. Finally, use an exposure instrument to expose and develop.

[0109] Real-time quantitative PCR detection:

[0110] 1. Wash the cells (6 or 12-well plate) twice with PBS, add 1 mL Trizol to each well and place at room temperature for 5 min or freeze at -20°C. Blow the cells down into a 1.5 mL EP tube.

[0111] 2. For tissue samples, take about 10 mg of tissue and place it on ice. Add 300 μL RNAiso and grind it with a grinding rod until no obvious tissue pieces can be seen with the naked eye. Then add 700 μL RNAiso and place it on ice for lysis for 30 minutes.

[0112] 3. Add 200 μL chloroform to each tube, cover the tube, shake vigorously for 15 seconds, let stand at room temperature for 5 minutes, and centrifuge at 12,000 rpm at 4°C for 15 minutes.

[0113] 4. Take about 400μL of supernatant (do not touch the middle layer, which is DNA) into a new 1.5 mL EP tube. Add 500μL of isopropanol, mix by inversion, and let stand at room temperature for 10 minutes. Centrifuge at 4℃ and 12000rpm for 10 minutes.

[0114] 5. Carefully pour off the supernatant, add 1 mL of 75% ethanol to wash the precipitate, and centrifuge at 12000 rpm at 4°C for 10 min.

[0115] 6. Carefully pour out the supernatant, absorb the ethanol, and leave to dry at room temperature with the lid open.

[0116] 7. Add 20-30 μL DEPC water (Biyuntian) to each tube and place it at 55-60 ℃ for 10 min to dissolve.

[0117] 8. Determine RNA concentration. Determine RNA concentration. Then perform reverse transcription according to the steps in the kit instructions. Perform real-time quantitative PCR detection according to the steps in the kit instructions.

[0118] HE staining of liver samples from MAFL and MASH patients Thrsp Expression and distribution on the corresponding slices (results as shown in Figure 2 D in (shown in Figure ):

[0119] The experimental method is the same as above.

[0120] NAS scores of MAFL and MASH patient liver samples (results as shown in Figure 2 E in (as shown in the figure):

[0121] The experimental method is the same as above.

[0122] Quantification of Thrsp protein expression in the liver of MAFL and MASH patients (results as shown in Figure 2 D, F in the figure):

[0123] DAB staining was used to detect the expression level of Thrsp in paraffin-embedded liver tissue sections of MAFL (n=5) and MASH (n=5).

[0124] DAB staining specific steps:

[0125] 1. After incubation with horseradish peroxidase (HRP)-labeled antibody, wash 3-5 times with appropriate washing buffer, 3-5 minutes each time.

[0126] 2. Take 900 μL 1× PBS, add 50 μL solution A and 50 μL solution B and mix well to prepare DAB working solution (solutions A and B are provided by the kit).

[0127] 3. Add an appropriate amount of DAB working solution to the tissue sections to ensure that the samples are fully covered.

[0128] 4. Treat a batch of samples at the same time and incubate at room temperature for 3-10 minutes or longer, away from light, until the color develops to the desired depth.

[0129] 5. Remove the DAB staining solution and wash with distilled water 2-3 times to terminate the color development reaction. After the color development reaction is terminated, it can be restained with other dyes. Dry at room temperature and store away from light.

[0130] This example intends to use liver-specific overexpression or knockdown of key genes in mice for in vivo validation experiments. Transgenic mice are expensive and have a long breeding cycle. AAV serotype 8 has a strong affinity for the liver. Therefore, this study uses AAV8 with a liver-specific promoter, human thyroid binding globulin (TBG) promoter, as a vector construction. Thrsp Overexpression or knockdown mice. Thrsp Sequence (forward: CGCAAATGGGCGGTAGGCGTG, reverse: AAGAACGGAGCCGGTTGGCG) and knockdown Thrsp The target sequence (CCTGATCTCTATACCTACT) was provided to Heyuan Biotechnology (Shanghai) Co., Ltd. to prepare overexpression and knockdown vectors using adeno-associated virus serotype 8 (AAV8) Thrsp Virus. Overexpression / knockdown constructed by tail vein injection with insulin needle Thrsp AAV8 and negative control AAV8 (titer greater than 1x10 per mouse) 12 vg / mL). Detection of liver in mice 3 weeks after injection Thrsp Compared with the negative control group, the mRNA and protein expression levels of the overexpression or knockdown groups in the liver Thrsp The mRNA and protein expression levels of AAV8 were significantly increased or decreased, indicating that AAV8 was overexpressed / knocked down in the liver Thrsp The mice were successfully established.

[0131] Example 3: AAV-mediated Thrsp Overexpression further aggravates Western diet-induced MASH

[0132] Figure 3 The control group and Thrsp Overexpression in mouse liver Thrsp The mRNA level ( Figure 3 A in ); liver weight to body weight ratio ( Figure 3 B in the liver; TG content in the liver ( Figure 3 C in liver); TC content in liver ( Figure 3 D); HE, Oil Red O and Sirius Red staining results of liver sections ( Figure 3 E in liver); fatty acid content in liver ( Figure 3 The results show that AAV-mediated Thrsp Overexpression further aggravated Western diet-induced MASH.

[0133] The experimental methods used in this embodiment are the same as those described above.

[0134] Example 4: AAV-mediated Thrsp Knockdown improves Western diet-induced MASH

[0135] Figure 4 The control group and Thrsp Knockdown in mouse liver Thrsp The mRNA level ( Figure 4 A in ); liver weight to body weight ratio ( Figure 4 B in the liver; TG content in the liver ( Figure 4 C in liver); TC content in liver ( Figure 4 D); HE, Oil Red O and Sirius Red staining results of liver sections ( Figure 4 E in liver); fatty acid content in liver ( Figure 4 The results show that AAV-mediated Thrsp Knockdown improved Western diet-induced MASH.

[0136] The experimental methods used in this embodiment are the same as those described above.

[0137] This specific embodiment is merely an explanation of the present application and is not a limitation of the present application. After reading this specification, those skilled in the art may make modifications to the present embodiment without any creative contribution as needed, but such modifications are protected by the patent law as long as they are within the scope of the claims of the present application.

Claims

1. Inhibition Thrsp The use of a gene-expressed substance in the preparation of a drug for treating MASH is characterized in that: The inhibition Thrsp The gene expression substance is a knockdown substance containing the gene shown in SEQ NO:1 Thrsp AAV8 with target sequence; SEQ NO:1CCTGATCTCTATACCTACT。

Images