High-temperature-resistant glycosyltransferase mutant, preparation method and application thereof

By performing site-directed mutagenesis on the glycosyltransferase UGT91C1, especially the T363I and C445L mutations, its thermal stability was improved, solving the problem of insufficient thermal stability in existing technologies and realizing the efficient production of high-end sweeteners.

CN119331845BActive Publication Date: 2025-12-16CHINA UNIV OF PETROLEUM (EAST CHINA)
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202411286092.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-09-13
Publication Date
2025-12-16
Estimated Expiration
2044-09-13

AI Technical Summary

Technical Problem

The thermostability of the existing glycosyltransferase UGT91C1 mutant is insufficient to meet the needs of industrial production, leading to an increase in the amount of glycosyltransferase used in industrial production, which cannot meet the market demand for high-end sweeteners such as rebaudioside D.

Method used

By performing site-directed mutagenesis on the glycosyltransferase UGT91C1 mutant, especially the T363I and C445L mutations, its thermal stability was improved and its catalytic activity under high-temperature conditions was enhanced.

Benefits of technology

It significantly improves the thermal stability of glycosyltransferases, reduces the amount of enzyme used, and enhances catalytic efficiency under high-temperature conditions, making it suitable for the industrial production of high-end sweeteners.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119331845B_ABST
    Figure CN119331845B_ABST
Patent Text Reader

Abstract

The present application relates to a kind of high-temperature resistant glycosyltransferase mutant and its application, the amino acid sequence of the glycosyltransferase mutant is based on the amino acid sequence shown in SEQ ID NO:1 (UGT91C1-F208M(M0)) Occurs T363I mutation or C445L mutation, under the premise of maintaining relatively constant catalytic activity, T m Value is increased by 7.3 DEG C-8.4 DEG C than glycosyltransferase UGT91C1-F208M(M0). Thus, the mutation site T363I and C445L provided by the present application can significantly improve the heat resistance of glycosyltransferase M0, which is conducive to promoting its wide application in industrial production field.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of genetic engineering, and relates to a glycosyltransferase mutant and application thereof. BACKGROUND

[0002] Sugar has many positive effects on the human body. First, sugar is an essential nutrient for the human body, mainly composed of carbon, hydrogen and oxygen elements, and is a type of carbohydrate. When exercising or feeling tired, sugar can be quickly absorbed, increasing blood sugar, replenishing energy, relieving fatigue, and maintaining the body's normal activities. At the same time, appropriate intake of sugar can promote the secretion of dopamine, increase the content of serotonin in the human brain, improve appetite, and make people feel happy. However, excessive intake of sugar can also have adverse effects, such as potentially leading to elevated blood sugar levels, causing diabetes, obesity, cardiovascular and cerebrovascular diseases, etc. In recent years, the prevalence of dental caries, obesity, diabetes, hypertension, and cardiovascular disease has been increasing worldwide, and therefore, consumers are increasingly preferring low-calorie or non-calorie sweeteners.

[0003] Steviol glycosides are a class of natural sweeteners with high sweetness extracted from Stevia rebaudiana leaves, among which the most ideal components, Rebaudioside D (Reb D) and Rebaudioside M (Reb M), have high sweetness and no bitter aftertaste. However, due to the low level of β(1-2)-glycosylation in Stevia rebaudiana, their contents in leaves are relatively low. UGT91C1 is a uridine diphosphate glycosyltransferase (UGT) derived from rice, which can add a second glucose group to the C13 or C19 position of the steviol glycoside substrate by forming a β(1-2)-glycosidic bond, such as generating Reb D from Reb A by the latter way, and therefore plays an important role in the synthesis of high-quality sweeteners. In 2017, the U.S. Food and Drug Administration (FDA) also certified Reb D as a "GRAS" level. Therefore, Reb D is a potential natural sweetener of higher quality than Reb A.

[0004] With the increasing demand for taste of sweeteners, the demand for high-end products such as Reb D is increasing. However, in Stevia rebaudiana plants, the content of Reb D is extremely low, accounting for only about 0.5% of the dry leaf weight, and the separation and extraction cost is high, which cannot meet the market demand. And the thermal stability of the currently known glycosyltransferase UGT91C1 mutant UGT91C1-F208M (M0) with the highest catalytic activity cannot meet the needs of industrial production, thereby further increasing the amount of glycosyltransferase used in industrial production, leading to certain limitations in industrial production. SUMMARY

[0005] In view of the deficiencies of the prior art, the present application aims to provide a high-temperature-resistant glycosyltransferase mutant and application thereof.

[0006] To achieve the object of the present application, the present application adopts the following technical solutions:

[0007] In a first aspect, the present application provides a high-temperature-resistant glycosyltransferase mutant, wherein the amino acid sequence of the glycosyltransferase mutant is based on the amino acid sequence shown in SEQ ID NO:1 and has a T363I mutation or a C445L mutation.

[0008] The amino acid sequence with the T363I mutation is shown in SEQ ID NO:2.

[0009] The amino acid sequence with the C445L mutation is shown in SEQ ID NO:3.

[0010] SEQ ID NO:1:

[0011] MDSGYSSSYAAAAGMHVVICPWLAFGHLLPCLDLAQRLASRGHRVSFVSTPRNISRLPPVRPALAPLVAFVALPLPRVEGLPDGAESTNDVPHDRPDMVELHRRAFDGLAAPFSEFLGTACADWVIVDVFHHWAAAAALEHKVPCAMMLLGSAHMIASIADRRLERAETESPAAAGQGRPAAAPTFEVARMKLIRTKGSSGMSLAERMSLTLSRSSLVVGRSCVEFEPETVPLLSTLRGKPITFLGLMPPLHEGRREDGEDATVRWLDAQPAKSVVYVALGSEVPLGVEKVHELALGLELAGTRFLWALRKPTGVSDADLLPAGFEERTRGRGVVATRWVPQMSILAHAAVGAFLTHCGWNSTIEGLMFGHPLIMLPIFGDQGPNARLIEAKNAGLQVARNDGDGSFDREGVAAAIRAVAVEEESSKVFQAKAKKLQEIVADMACHERYIDGFIQQLRSYKDLEHHH HHH

[0012] SEQ ID NO:2:

[0013] MDSGYSSSYAAAAGMHVVICPWLAFGHLLPCLDLAQRLASRGHRVSFVSTPRNISRLPPVRPALAPLVAFVALPLPRVEGLPDGAESTNDVPHDRPDMVELHRRAFDGLAAPFSEFLGTACADWVIVDVFHHWAAAAALEHKVPCAMMLLGSAHMIASIADRRLERAETESPAAAGQGRPAAAPTFEVARMKLIRTKGSSGMSLAERMSLTLSRSSLVVGRSCVEFEPETVPLLSTLRGKPITFLGLMPPLHEGRREDGEDATVRWLDAQPAKSVVYVALGSEVPLGVEKVHELALGLELAGTRFLWALRKPTGVSDADLLPAGFEERTRGRGVVATRWVPQMSILAHAAVGAFLTHCGWNSIIEGLMFGHPLIMLPIFGDQGPNARLIEAKNAGLQVARNDGDGSFDREGVAAAIRAVAVEEESSKVFQAKAKKLQEIVADMACHERYIDGFIQQLRSYKDLEHHHHHH

[0014] SEQ ID NO:3:

[0015] MDSGYSSSYAAAAGMHVVICPWLAFGHLLPCLDLAQRLASRGHRVSFVSTPRNISRLPPVRPALAPLVAFVALPLPRVEGLPDGAESTNDVPHDRPDMVELHRRAFDGLAAPFSEFLGTACADWVIVDVFHHWAAAAALEHKVPCAMMLLGSAHMIASIADRRLERAETESPAAAGQGRPAAAPTFEVARMKLIRTKGSSGMSLAERMSLTLSRSSLVVGRSCVEFEPETVPLLSTLRGKPITFLGLMPPLHEGRREDGEDATVRWLDAQPAKSVVYVALGSEVPLGVEKVHELALGLELAGTRFLWALRKPTGVSDADLLPAGFEERTRGRGVVATRWVPQMSILAHAAVGAFLTHCGWNSTIEGLMFGHPLIMLPIFGDQGPNARLIEAKNAGLQVARNDGDGSFDREGVAAAIRAVAVEEESSKVFQAKAKKLQEIVADMALHERYIDGFIQQLRSYKDLEHHHHHH

[0016] The present application provides a high-temperature-resistant glycosyltransferase mutant, which is a protein mutated from the amino acid shown in SEQ ID NO: 1 (i.e. glycosyltransferase mutant UGT91C1-F208M (M0)) and having the enzyme activity of catalyzing rebaudioside A into rebaudioside D.

[0017] Preferably, the amino acid sequence of the glycosyltransferase mutant is based on the sequence shown in SEQ ID NO: 1, with the 363rd amino acid changed from Thr to Ile.

[0018] Preferably, the amino acid sequence of the glycosyltransferase mutant is based on the sequence shown in SEQ ID NO: 1, with the 445th amino acid of the glycosyltransferase changed from Cys to Leu.

[0019] The present application significantly improves the thermal stability of glycosyltransferase UGT91C1-F208M (M0) through site-directed mutation, and the optimal mutant T m The value is increased by 8.4℃, thus significantly reducing the amount of enzyme used, and having good application prospect.

[0020] In the second aspect, the present application provides a DNA molecule encoding the glycosyltransferase mutant of the first aspect.

[0021] Preferably, the DNA molecule comprises a DNA sequence encoding the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 3.

[0022] In a third aspect, the present application provides a recombinant expression plasmid, wherein the recombinant expression plasmid is linked with the DNA molecule of the second aspect.

[0023] In a fourth aspect, the present application provides a host cell, wherein the host cell is transformed with the recombinant expression plasmid of the third aspect.

[0024] Preferably, the host cell is Escherichia coli.

[0025] Preferably, the Escherichia coli is Escherichia coli C41 (DE3) strain.

[0026] In a fifth aspect, the present application provides a method for preparing the glycosyltransferase mutant of the first aspect, wherein the method comprises:

[0027] inserting the DNA molecule encoding the glycosyltransferase mutant of the first aspect into an expression plasmid, transforming the expression plasmid into a host cell, culturing the host cell in fermentation and isolating and purifying the glycosyltransferase mutant.

[0028] Preferably, the method for isolating and purifying the glycosyltransferase mutant is a method for breaking the host cell and extracting the glycosyltransferase mutant protein.

[0029] Preferably, the method for breaking the host cell can be a high-pressure homogenization method, and the method for extracting the glycosyltransferase mutant protein can be a nickel column gradient elution method.

[0030] In a sixth aspect, the present application provides the use of the glycosyltransferase mutant of the first aspect, the DNA molecule of the second aspect, the recombinant expression plasmid of the third aspect, the host cell of the fourth aspect and the method for preparing the glycosyltransferase mutant of the fifth aspect in the preparation of rebaudioside D.

[0031] In a seventh aspect, the present application provides a method for preparing rebaudioside D, wherein the method uses the glycosyltransferase mutant of the first aspect to catalyze a substrate to obtain the rebaudioside D.

[0032] Preferably, the substrate comprises rebaudioside A and a glycosyl donor.

[0033] Preferably, the glycosyl donor can be selected from guanosine diphosphate glucose (UDPG).

[0034] In an eighth aspect, the present application provides the use of the rebaudioside D prepared by the method of the seventh aspect in the field of food additives.

[0035] Compared with the prior art, the present application has the following beneficial effects:

[0036] The present application significantly improves the thermal stability of the glycosyltransferase UGT91C1-F208M (M0) by site-directed mutation, and the optimal mutant T m The value is increased by 8.4℃, thus the enzyme usage can be significantly reduced, and the application prospect is good. BRIEF DESCRIPTION OF DRAWINGS

[0037] Figure 1 is a graph of the enzyme catalytic activity determination results of the mutant protease prepared in Example 2;

[0038] Figure 2 is a graph of the surface denaturation temperature characterization results of the mutant protease prepared in Example 2;

[0039] Figure 3 is a graph of the optimal temperature T opt characterization results of the mutant protease prepared in Example 2;

[0040] Figure 4 is a graph of the optimal temperature T opt characterization results of the mutant protease prepared in Example 2;

[0041] Figure 5 is a graph of the half-inactivation temperature T 50 characterization results of the mutant protease prepared in Example 2;

[0042] Figure 6 is a graph of the half-life t 1 / 2 characterization results of the mutant protease prepared in Example 2 at 40℃;

[0043] Figure 7 is a graph of the half-life t 1 / 2 characterization results of the mutant protease prepared in Example 2 at 45℃. DETAILED DESCRIPTION

[0044] The technical solutions of the present application will be further described below through specific embodiments. Those skilled in the art should understand that the embodiments are only to help understand the present application, and should not be regarded as specific limitations on the present application.

[0045] In the following examples, unless otherwise specified, the reagents and consumables used are purchased from conventional reagent manufacturers in the art; unless otherwise specified, the experimental methods and technical means used are conventional methods and means in the art.

[0046] In the following examples, the E. coli host strain C41 (DE3) used is a commercial strain purchased from Beijing Chengke Biological Technology Co., Ltd.

[0047] The plasmid vector pET-32a used in the following examples is a commercial plasmid purchased from Beijing Eno Biotech Co., Ltd.

[0048] Example 1 Acquisition of Glycosyltransferase UGT91C1 Gene and Construction of Mutants

[0049] The amino acid sequence of glycosyltransferase UGT91C1 from rice was downloaded from GenBank (accession number: XP_015629141.1), and the sequence was optimized according to the codon bias of E. coli. At the same time, the 208th amino acid was changed from Phe to Met, and the codon-optimized UGT91C1-F208M (M0) gene sequence was obtained, which is SEQ ID NO: 1.

[0050] The full gene was synthesized by Beijing Eno Biotech Co., Ltd. and ligated to the multiple enzyme digestion site of the vector pET-32a, respectively, to obtain the recombinant plasmid pET-32a-M0.

[0051] Using the recombinant plasmid pET-32a-M0 as the template, full plasmid PCR was performed using the following primers, respectively, and site-directed mutagenesis was performed to construct the corresponding recombinant plasmid carrying the mutant:

[0052] G151F-F: GATGATGCTGCTGTTTAGTGCCCAC; (SEQ ID NO: 4)

[0053] G151F-R: GTGGGCACTAAACAGCAGCATCATC; (SEQ ID NO: 5)

[0054] T230Y-F: TGAACCGGAATATGTGCCTCTGC; (SEQ ID NO: 6)

[0055] T230Y-R: GCAGAGGCACATATTCCGGTTCA; (SEQ ID NO: 7)

[0056] T243V-F: GCGCGGTAAACCGATTGTGTTTCTGGGTCTGATGC; (SEQ ID NO: 8)

[0057] T243V-R: GCATCAGACCCAGAAACACAATCGGTTTACCGCGC; (SEQ ID NO: 9)

[0058] V264L-F: GAAGATGCCACCCTGCGCTGGCTGG; (SEQ ID NO: 10)

[0059] V264L-R: CCAGCCAGCGCAGGGTGGCATCTTC; (SEQ ID NO: 11)

[0060] A272P-F: GGATGCACAGCCGCCGAAATCAGTTG; (SEQ ID NO: 12)

[0061] A272P-R: CAACTGATTTCGGCGGCTGTGCATCC; (SEQ ID NO: 13)

[0062] A323P-F: CAGATTTACTGCCGCCGGGTTTTGAAGAAC; (SEQ ID NO: 14)

[0063] A323P-R: GTTCTTCAAAACCCGGCGGCAGTAAATCTG; (SEQ ID NO: 15)

[0064] A349P-F: GTCTATTCTGGCACATCCGGCAGTTGGCGCATTTC; (SEQ ID NO: 16)

[0065] A349P-R: GAAATGCGCCAACTGCCGGATGTGCCAGAATAGAC; (SEQ ID NO: 17)

[0066] T363I-F: GTGGCTGGAATAGTATTATTGAAGGTC; (SEQ ID NO: 18)

[0067] T363I-R: GACCTTCAATAATACTATTCCAGCCAC; (SEQ ID NO: 19)

[0068] A399P-F: GTCTGCAAGTTCCGCGTAATGATGG; (SEQ ID NO: 20)

[0069] A399P-R: CCATCATTACGCGGAACTTGCAGAC; (SEQ ID NO: 21)

[0070] G411S-F: CTTTGATCGTGAAAGCGTTGCAGCAGC; (SEQ ID NO: 22)

[0071] G411S-R: GCTGCTGCAACGCTTTCACGATCAAAG; (SEQ ID NO: 23)

[0072] C445L-F: CAGATATGGCACTGCATGAACGTTATATTG; (SEQ ID NO: 24)

[0073] C445L-R: CAATATAACGTTCATGCAGTGCCATATCTG; (SEQ ID NO: 25)

[0074] G452E-F: GTTATATTGATGAATTTATTCAGCAGCTGC; (SEQ ID NO: 26)

[0075] G452E-R: GCAGCTGCTGAATAAATTCATCAATATAAC; (SEQ ID NO: 27)

[0076] The obtained mutant plasmids were sequenced and identified by Beijing Genesee Biotech Co., Ltd. The plasmids pET-32a-M0-G151F, pET-32a-M0-T230Y, pET-32a-M0-T243V, pET-32a-M0-V264L, pET-32a-M0-A272P, pET-32a-M0-A232P, pET-32a-M0-A349P, pET-32a-M0-T363I, pET-32a-M0-A399P, pET-32a-M0-G411S, pET-32a-M0-C445L, pET-32a-M0-G452E and the template plasmid pET-32a-M0 were respectively transformed into host bacteria C41 (DE3) competent cells, and coated on LB solid plates (25 g / L LB Broth, 15 g / L Agar) containing 50 μg / mL ampicillin sodium (Ampicillin sodium), and cultured at 37°C under inversion, to screen positive transformants, and then obtain E. coli strains containing corresponding mutant plasmids, which were named as: M0, M0-G151F, M0-T230Y, M0-T243V, M0-V264L, M0-A272P, M0-A232P, M0-A349P, M0-T363I, M0-A399P, M0-G411S, M0-C445L, M0-G452E.

[0077] Example 2 Induced expression and extraction and purification of protease

[0078] The E. coli strain containing the mutant plasmid obtained in Example 1 was inoculated into LB medium (25 g / L LB Broth) and cultured at 170 rpm and 37°C for 8-12 h to obtain a primary seed liquid.

[0079] The first seed liquid was inoculated into 1000 mL of TB Media (12 g / L Trypton, 24 g / L Yeast Extract, 0.4% glycerol, 23.1 g / L KH2PO4, 164.32 g / L K2HPO4·3H2O) at a ratio of 10% (v / v) and cultured at 170 rpm and 37°C until the OD600 reached 0.6-0.8 to obtain a second seed liquid.

[0080] The second seed liquid was induced by IPTG (final concentration 0.5 mM) and the bacteria were cultured at 170 rpm and 18°C for 16 h for induced expression of the protease. The bacterial liquid was collected by centrifugation at 6000 rpm for 15 min at 4°C, the supernatant was discarded, and the bacterial slurry was resuspended in a lysis buffer (Tris 50 mM, NaCl 500 mM, imidazole 20 mM, glycerol 10% (v / v), β-mercaptoethanol 1 mM, 1% Tween 20, pH 8 adjusted) for lysis.

[0081] The bacterial liquid was lysed using a high-pressure homogenizer, and 1% PMSF was added before lysis. The specific experimental conditions were 4°C, lysis pressure 1500 bar, and lysis 5 times. The cell lysate was centrifuged at 9000 rpm for 20 min at 4°C, the precipitate was discarded, and the supernatant was collected.

[0082] The supernatant after centrifugation was filtered through a 0.45 μM filter head, and the filtrate was pumped into a Ni 2+ The mutant protein with His-tag was adsorbed on the Ni 2+ The affinity adsorption was collected on the column, and the flow-through was collected for subsequent verification.

[0083] After the A and B pumps of the AKTA primer plus system were balanced using Buffer A (Tris 50 mM, NaCl 500 mM, imidazole 20 mM, glycerol 10% (v / v), β-mercaptoethanol 1 mM, pH 8 adjusted) and Buffer B (Tris 50 mM, NaCl 500 mM, imidazole 250 mM, glycerol 10% (v / v), β-mercaptoethanol 1 mM, pH 8 adjusted), the nickel column combined with the mutant protein was connected, Buffer A was used to flush to the baseline, and Buffer A in this process could elute the unbound impurities in the nickel column. Then the content of Buffer B flowing through the nickel column was set to 10%, 20%, and 30%, respectively, and different concentrations of imidazole were used to compete and elute the impurities with weak binding force. After the baseline was balanced again, Buffer B was adjusted to 100% for elution of UGT91C1, and the peak liquid was collected.

[0084] To remove the high concentration of imidazole for subsequent experiments, the desalting column molecular sieve principle is used to replace Buffer B with Desalting Buffer (Tris 20 mM, glycerol 10%, β-mercaptoethanol 1 mM, adjust pH 8).

[0085] First, the Desalting Buffer is used to balance the A and B pumps of the AKTA primer plus system, the desalting column is connected and the desalting column is balanced with the Desalting Buffer. After the baseline is balanced, the protein sample is injected into the desalting column, and the peak liquid is collected. The sample volume is not more than 10% of the column volume each time to avoid premature outflow of mutant protease.

[0086] After desalting treatment, the volume of the enzyme solution increases, and its concentration decreases accordingly. Therefore, an ultrafiltration tube with a molecular weight cutoff of 10 kDa is used for concentration treatment.

[0087] The balanced ultrafiltration tube is centrifuged at 4°C and 5000 rpm for 10 min. After the concentration of the concentrated enzyme solution is determined by Nanodrop, it is aliquoted and stored in a -80°C refrigerator.

[0088] According to the above method, 13 kinds of glycosyltransferase UGT91C1 mutant pure enzyme solutions are obtained, respectively labeled as M0, M0-G151F, M0-T230Y, M0-T243V, M0-V264L, M0-A272P, M0-A232P, M0-A349P, M0-T363I, M0-A399P, M0-G411S, M0-C445L, M0-G452E.

[0089] Example 3 Enzyme activity determination of mutants

[0090] Three kinds of glycosyltransferase UGT91C1 mutant pure enzyme solutions obtained in Example 2 are taken to prepare reaction systems to determine enzyme activity, respectively. The M0 pure enzyme solution is used as a control, and the environmental temperature is 42°C. The 200 μL reaction system contains the following components:

[0091] The buffer is 50 mM phosphate, 5 mM MgCl2, 500 mM UDPG, 250 mM RebA, 0.8 mM protease, and the environmental pH is 7.0-8.0.

[0092] Reaction at 42°C, 170 rpm for 30 min; after the reaction is completed, take samples at 95°C for 5 min to terminate the reaction, and after cooling, add an equal volume of methanol, centrifuge at 12000 rpm for 5 min, and the supernatant is filtered through a 0.22 μM filter membrane, then used for high performance liquid chromatography detection to calculate the relative activity of the mutant protease.

[0093] The enzyme catalytic activity determination results are referred to the attached Figure 1Compared with M0, the relative activity of 3 mutant proteases among the 12 mutant proteases decreased obviously, and the relative activity of the remaining 9 mutant proteases remained above 80%.

[0094] Subsequently, V264L, A272P, A323P, A349P, T363I, A399P, G411S, C445L, and G452E, which had good relative activity, were selected and their surface denaturation temperatures T m , optimum temperatures T opt , half-inactivation temperatures T 50 , and half-lives t 1 / 2 were investigated to explore the influence of mutations on the thermal stability of the proteases.

[0095] Those skilled in the art can easily understand that, based on the amino acid sequence shown in SEQ ID NO: 1, a protein having catalytic activity of synthesizing rebaudioside D from rebaudioside A can be obtained by routine means such as substitution, deletion, or addition of one or more amino acid sequences, and thus these mutants also belong to the scope of the present application.

[0096] Example 4 Surface denaturation temperature T m characterization

[0097] In the characterization of enzyme stability, the surface denaturation temperature T m value is often used as an important parameter for the thermal stability of the reaction enzyme, and can be determined by circular dichroism (CD). In the thermal denaturation study of the mutant proteases, the same enzyme concentration of 0.7 μM was controlled, a 1 cm rotor-equipped cell was used, 222 nm was set as the detection wavelength, the temperature range was 20-95℃, and 3600 s was continuously collected at a step of 1℃.

[0098] Data analysis, with temperature as the abscissa and θMRE as the ordinate, the two-state model formula was used to fit the thermal denaturation results, and the T m value after fitting was obtained.

[0099] Surface denaturation temperature T m characterization results are shown in Table 1. Figure 2 Compared with M0, the T m value of 9 mutant proteases increased by 1-22℃.

[0100] Example 5 Optimum temperature T opt characterization

[0101] Generally, lower reaction temperature will reduce the intermolecular movement rate, thus limiting the enzymatic reaction rate; while too high reaction temperature will cause irreversible changes in the structure of the enzyme, thus reducing the enzyme activity, or even completely losing the enzyme activity. After diluting the purified mutant protein enzyme solution, the enzyme activity was measured at different temperatures of 15-65℃ (interval of 5℃). Taking the highest enzyme activity as 100%, the enzyme activity at other temperatures was the relative enzyme activity. The relative enzyme activity was taken as the vertical coordinate, and the temperature was taken as the horizontal coordinate to plot a graph, so as to determine the optimum temperature.

[0102] Optimum temperature T opt The characterization results refer to the attached Figure 3 , 4 , the attached Figure 3 contains the relative activity changes of each mutant protease in the 40-45℃ part. Compared with M0, the optimum temperature T opt of the nine mutant proteases is mostly concentrated in the 40-45℃ interval. The optimum temperature T opt of C445L is the highest, reaching 45℃ and showing the highest relative enzyme activity. The optimum temperature T 50 of other mutant proteases is not much different from that of M0. And at their respective optimum temperatures, their catalytic activities all remain at a high level.

[0103] Example 6 Half-inactivation temperature T 50 characterization

[0104] After incubating the purified enzyme solution at 30-70℃ for 10 min (interval of 5℃), the enzyme solution was quickly placed on ice to cool for 10 min. The enzyme activity was measured by the above method. Taking the enzyme activity under the non-incubation condition as 100%, the relative specific activity under each temperature condition was calculated. When the relative residual enzyme activity is reduced to 50%, the corresponding temperature is the half-inactivation temperature T 50 . The relative enzyme activity was taken as the vertical coordinate, and the temperature was taken as the horizontal coordinate to plot a graph, so as to determine the half-inactivation temperature T 50 .

[0105] Half-inactivation temperature T 50 The characterization results refer to the attached Figure 5 , in which the T 50 of M0 is about 42.5℃, and the T 50 of mutant proteases M0-T363I and M0-C445L is increased by about 5℃ and 7.5℃ respectively compared with that of M0, indicating that both of them still have certain catalytic activity under high temperature conditions.

[0106] Example 7 Half-life t 1 / 2 characterization

[0107] The purified enzyme solution was incubated at 40℃ and 45℃ for specific times, with samples taken periodically and immediately cooled on ice for 10 minutes. Enzyme activity was then determined using the method described above. The enzyme activity under unincubated conditions was set as 100%, and the relative enzyme activity at each time point was calculated. The time corresponding to the relative remaining enzyme activity decreasing to 50% is the half-life t. 1 / 2 The residual enzyme activity was measured to calculate kd (kd is the inactivation constant, defined as ln(residual enzyme activity) / incubation time t), and the half-life t was calculated. 1 / 2 The calculation formula is t 1 / 2 =ln2 / kd.

[0108] Half-life t at 40℃ and 45℃ 1 / 2 The characterization results are respectively referred to Figure 6 and Figure 7 Under two incubation temperature conditions, the half-lives of the mutant proteases M0-T363I and M0-C445L were significantly longer than those of M0. Specifically, M0-T363I showed a 2.35-fold and 3.38-fold increase in half-life compared to M0 under the two temperature gradient conditions, while M0-C445L showed a 3.78-fold and 4.63-fold increase in half-life compared to M0 under the two temperature gradient conditions.

[0109] In summary, the glycosyltransferase mutant provided by this invention has stronger heat resistance and is more suitable for application in the field of food additives.

[0110] The applicant declares that the technical solution of this invention is illustrated by the above embodiments, but this invention is not limited to the above embodiments, that is, it does not mean that this invention must rely on the above embodiments to be implemented. Those skilled in the art should understand that any improvements to this invention, equivalent substitutions of raw materials for the products of this invention, addition of auxiliary components, selection of specific methods, etc., all fall within the protection scope and disclosure scope of this invention.

[0111] The preferred embodiments of the present invention have been described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the scope of the technical concept of the present invention, various simple modifications can be made to the technical solution of the present invention, and these simple modifications all fall within the protection scope of the present invention.

[0112] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, the present invention will not describe the various possible combinations separately.

Claims

1. A thermostable glycosyltransferase mutant, characterized in that, The amino acid sequence of the glycosyltransferase mutant is based on the amino acid sequence shown in SEQ ID NO:1, with a T363I mutation or a C445L mutation.

2. A DNA molecule, characterized in that, The DNA molecule encodes the glycosyltransferase mutant of claim 1.

3. The DNA molecule according to claim 2, characterized in that, The DNA molecule encodes an amino acid sequence as shown in SEQ ID NO:2 or SEQ ID NO:

3.

4. A recombinant expression plasmid, characterized in that, The recombinant expression plasmid is linked to the DNA molecule as described in claim 2 or 3.

5. A host cell, characterized in that, The host cell expresses the recombinant expression plasmid as described in claim 4, and the host cell is Escherichia coli.

6. The method for preparing the glycosyltransferase mutant according to claim 1, characterized in that, The preparation method includes: The DNA molecule encoding the glycosyltransferase mutant of claim 1 is inserted into the expression plasmid, the expression plasmid is transformed into the host cell, the host cell is fermented and cultured, and the glycosyltransferase mutant is isolated and purified.

7. The application of the glycosyltransferase mutant of claim 1, the DNA molecule of claim 2, the recombinant expression plasmid of claim 4, the host cell of claim 5, and the method for preparing the glycosyltransferase mutant of claim 6 in the preparation of rebaudioside D.

8. A method for preparing rebaudioside D, characterized in that, The preparation method includes: The rebaudioside D was obtained by catalyzing the substrate using the glycosyltransferase mutant of claim 1.

9. The method for preparing rebaudioside D according to claim 8, characterized in that, The substrates include rebaudioside A and a glycosyl donor.

Citation Information

Patent Citations

  • Glycosyltransferase mutant with improved thermal stability and activity

    CN116064454A