Anti-clubroot brassica napus gene BnaC09g44020D and application thereof

Abstract

The invention discloses an anti-clubroot brassica napus gene BnaC09g44020D and application thereof, and relates to the technical field of gene screening and application thereof, and the technical key points are as follows: the nucleotide sequence of the anti-clubroot brassica napus gene BnaC09g44020D is SEQ ID No.1; by identifying and applying the clubroot-resistant brassica napus gene BnaC09g44020D, a new way is provided for solving the problem that clubroot-resistant resources of brassica napus are scarce, the gene is located on a C09 chromosome and can positively regulate and control the clubroot resistance of plants, and the discovery has important significance on breeding work of the clubroot-resistant brassica napus.

Description

Technical Field

[0001] The invention relates to the technical field of gene screening and application thereof, and in particular to a clubroot-resistant Brassica napus gene BnaC09g44020D and application thereof. Background Art

[0002] Brassica napus L. is the main source of domestic edible oil, accounting for 50% of domestic edible vegetable oil. However, clubroot (caused by Plasmodiophorabrassicae) poses a serious threat to cruciferous crops such as rapeseed, resulting in reduced or even total crop failure.

[0003] The root-knot fungus mainly harms the roots of plants, forming tumors and affecting the plant's absorption of water and nutrients. The life cycle of the root-knot fungus includes three stages: dormant spore stage, root hair infection stage and cortical infection stage. The root-knot fungus infects plants under suitable soil temperature (18-25°C), humidity (60%-98%) and pH value (5.4-6.5). The dormant spores of the root-knot fungus can survive in the soil for up to 20 years. It is highly contagious and spreads quickly. Biological and chemical control effects are poor. The lack of broad-spectrum antigenic plants makes root-knot a global and devastating soil-borne plant disease.

[0004] In the research on clubroot resistance genes, some clubroot resistance genes / sites have been found in vegetables such as European turnip / cabbage, kale, black mustard, and radish. In Brassica napus, at least 28 QTLs related to clubroot resistance have been located on the A01, A02, A03, A06, and A08 chromosomes of cabbage, of which 12 resistance QTLs are located on chromosome A03. The clubroot resistance in Brassica napus mainly comes from cabbage. However, the resistance sources of existing clubroot-resistant Brassica napus germplasms or varieties are relatively single, mainly from the resistance sites on the A03 and A08 chromosomes of cabbage, resulting in a single disease resistance that cannot meet actual needs.

[0005] Therefore, the present invention hybridizes cabbage resistant to clubroot with cabbage through distant hybridization, artificially synthesizes cabbage-type rapeseed resistant to clubroot, and uses whole genome resequencing to locate the disease resistance gene BnaC09g44020D, providing a theoretical basis and gene resources for breeding new rapeseed varieties with durable resistance. This innovative method aims to solve the problem of scarce resources for clubroot resistance in cabbage-type rapeseed, and by aggregating different disease resistance genes, breed new excellent cabbage-type rapeseed varieties with broad-spectrum resistance to cope with the complexity and variability of root-root fungi, improve the yield and quality of rapeseed, and ensure the safety of national edible oil supply. Summary of the invention

[0006] The purpose of the present invention is to solve the above problems and provide a clubroot-resistant Brassica napus gene BnaC09g44020D and its application to solve the problem that clubroot-resistant resources in Brassica napus are scarce, the existing resistance sources are single and cannot meet actual needs.

[0007] In order to achieve the above object, the technical solution of the present invention is as follows: a clubroot-resistant Brassica napus gene BnaC09g44020D, the nucleotide sequence of the clubroot-resistant Brassica napus gene BnaC09g44020D is SEQ ID No.1.

[0008] The present invention is further configured that: the gene is located on chromosome C09 and can positively regulate the plant's resistance to clubroot disease.

[0009] The present invention is further provided that the gene plays an important role in the breeding of clubroot-resistant Brassica napus.

[0010] Another object of the present invention is to provide a primer combination for identifying the clubroot resistance Brassica napus gene BnaC09g44020D, the primer combination comprising BnaC09g44020D-F and BnaC09g44020D-R, the sequence of BnaC09g44020D-F is SEQ ID No.2; the sequence of BnaC09g44020D-R is SEQ ID No.3.

[0011] Another object of the present invention is to provide a method for extracting the clubroot resistance Brassica napus gene BnaC09g44020D, comprising the following steps:

[0012] (a) extracting genomic DNA from Brassica napus;

[0013] (b) using the genomic DNA as a template and using specific primers to perform PCR amplification to obtain a reaction product;

[0014] (c) purifying the reaction product to obtain a purified product;

[0015] (d) cloning the purified product, transforming it into competent Escherichia coli cells using a heat shock method, and then culturing it to obtain a bacterial solution;

[0016] (e) Identifying the bacterial solution to confirm the presence of the gene.

[0017] Another object of the present invention is to provide a method for cultivating clubroot-resistant Brassica napus using gene BnaC09g44020D, comprising the following steps:

[0018] S1: The CDS sequence of BnaC09g44020D in the disease-resistant parent was constructed into the 2*CaMV 35S overexpression vector;

[0019] S2: Infect wild-type Arabidopsis to obtain Arabidopsis lines overexpressing BnaC09g44020D;

[0020] S3: Observe the resistance of Arabidopsis thaliana overexpressing BnaC09g44020D to clubroot disease to verify the effect of the BnaC09g44020D gene on clubroot disease resistance.

[0021] Another object of the present invention is to use the BnaC09g44020D gene to improve the ability of plants to resist clubroot disease, and to transfer the BnaC09g44020D gene into other cruciferous crops through genetic engineering to improve the resistance of these crops to clubroot disease.

[0022] A further configuration of the present invention is that the cruciferous plant is rapeseed, Arabidopsis thaliana, Chinese cabbage or Brassica oleracea.

[0023] Compared with the prior art, the beneficial effects of this scheme are as follows: the clubroot-resistant Brassica napus gene BnaC09g44020D and its application provided by the present invention have significant beneficial effects, which are not only reflected in enhancing the disease resistance of Brassica napus itself, but also have a profound impact on agricultural production and food safety.

[0024] First, through the BnaC09g44020D gene located on the C09 chromosome, the present invention provides a new genetic resource for Brassica napus, which helps to break the limitations of existing resistance resources. The discovery and application of this new gene can significantly improve the resistance of Brassica napus to clubroot and reduce the yield loss caused by the disease, thus playing an important role in ensuring the safety of the country's edible oil supply.

[0025] Secondly, the primer combination and gene extraction method provided by the present invention provide a fast and accurate tool for researchers and breeding experts to identify and extract the BnaC09g44020D gene. The standardization of this method helps to improve the efficiency of breeding work, accelerate the development process of new varieties, and also reduce breeding costs.

[0026] Furthermore, the present invention verifies the potential of the gene to be expressed in different plants by transferring the BnaC09g44020D gene into Arabidopsis and testing its resistance. This method not only confirms the function of the BnaC09g44020D gene, but also demonstrates its application prospects in other cruciferous crops, providing the possibility for cultivating a wider range of clubroot-resistant crop varieties.

[0027] Finally, the implementation of the present invention helps to reduce the use of pesticides by improving the disease resistance of crops, which is of great significance to environmental protection and sustainable development of agriculture. At the same time, the cultivation of disease-resistant crops also helps to improve the economic benefits of farmers because it reduces economic losses caused by diseases and improves the overall yield and quality of crops.

[0028] In summary, the present invention not only provides a new clubroot resistance gene resource in science, but also has a positive impact on agricultural production, food safety, environmental protection and agricultural economy in practical application by improving the disease resistance of crops. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 Schematic diagram of the location of clubroot resistance sites in an embodiment of the present invention;

[0030] Figure 2 Schematic diagram of identification of clubroot resistance of Arabidopsis thaliana strains heterologously overexpressing BnaC09g44020D in the embodiments of the present invention;

[0031] Among them, A: symptoms of root knot disease in wild-type Arabidopsis 30 days after inoculation with root knot fungi; B, C: symptoms of root knot disease in Arabidopsis overexpressing BnaC09g44020D 30 days after inoculation with root knot fungi; D: statistical data of disease index of different materials. DETAILED DESCRIPTION

[0032] In order to enable those skilled in the art to better understand the solution of the present invention, the technical solution of the present invention will be further described in detail below in conjunction with the embodiments of the present invention and the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work should fall within the scope of protection of the present invention.

[0033] It should be noted that, in the absence of conflict, the embodiments and features in the embodiments of the present invention can be combined with each other. The present invention will be described in detail below in conjunction with the embodiments.

[0034] Example 1: A clubroot-resistant Brassica napus gene BnaC09g44020D, the nucleotide sequence of which is SEQ ID No. 1. The gene is located on chromosome C09 and can positively regulate the plant's resistance to clubroot.

[0035] 1. Inoculation of root knot fungus

[0036] The present invention places the seeds to be tested on moist filter paper and waits for them to germinate. After about three or four days, select seedlings with uniform growth and transplant them into nutrient soil, perlite and vermiculite mixed in a ratio of 3:1:1. When the seedlings grow to the three-leaf stage, use a syringe to inject 5 ml of 1×10 7 spores / mL of the root-knot fungus suspension.

[0037] The preparation process of the root knot fungus spore suspension is as follows: take the diseased root knot tissue, soak it in water overnight, then cut it into small pieces and crush it with a sample grinder. Use eight layers of gauze to filter the crushed sample to remove the plant tissue and obtain a liquid containing the dormant spores of the root knot fungus. Remove the supernatant by centrifugation, leaving the precipitated dormant spores. Add an appropriate amount of water according to the size of the root knot to resuspend the spores, use a hemocytometer to detect the concentration of the spore solution, and then dilute it to 1×10 7 Concentration of spores / mL.

[0038] For the resistant and susceptible parents, F1 and F2 populations used in the experiment, the test method of inoculating with root knot fungi is the same. After inoculation with root knot fungi, after a 40-day observation period, the resistance and susceptible phenotype is determined by checking whether root knots form on the roots of the plants. The observation results are usually presented in the form of graphs, such as Figure 2 The above method provides an experimental procedure for evaluating the resistance of plants to clubroot disease, which is helpful for studying and breeding plant varieties resistant to clubroot disease.

[0039] 2. Extraction of genomic DNA

[0040] 1) Take a thumb-sized piece of fresh young plant leaves and grind them into powder in liquid nitrogen.

[0041] 2) Transfer the powder into a 2 ml centrifuge tube, add 500 μl of 65°C preheated CTAB solution, mix thoroughly, and place in a 65°C water bath for 1 hour, shaking and mixing once every ten minutes or so

[0042] 3) After the water bath, add 500 μl of chloroform / isoamyl alcohol solution (24:1), mix gently, let stand at room temperature for 10 minutes, and centrifuge at 10,000 rpm for 10 minutes.

[0043] 4) Take the supernatant and add an equal volume of isopropanol and let it stand until a precipitate is formed. Centrifuge at 10000r / min for 10min.

[0044] 5) After discarding the supernatant, rinse the precipitate with 70% ethanol two to three times, then invert the centrifuge tube to air dry naturally, add an appropriate amount of ddH2O to dissolve it, and store it in a -20℃ refrigerator.

[0045] 3. Vector Construction

[0046] By analyzing the sequence of the candidate gene, Primer Premier 5.0 was used to design forward and reverse primers BnaC09g44020D-F / R with higher scores that could cover the full length of the gene, among which BnaC09g44020D-F: CTGACTCTAGCAGATCTATGGAAGGATA TGATGATGG; BnaC09g44020D-R: TTGCCCATGGCTCTAGAAAAAGAAGAGTAGATTTGCA; high-fidelity enzyme (Novozyme, P505) was used to amplify the gene DNA as a template.

[0047] The reaction system is: 2×Phanta Max Buffer (containing Mg 2+ , final concentration 2mM): 25μl,

[0048] dNTP Mix (10mM each): 1μl, forward and reverse primers 2μl each,

[0049] Phanta Max Super-Fidelity DNAPolymerase: 1μl,

[0050] Template DNA (concentration 50-100 ng / μl): 1 μl, ddH2O: 18 μl.

[0051] Reaction procedure: pre-denaturation at 95°C for 3 min, denaturation at 95°C for 15 s, annealing for 15 s, extension at 72°C for 30-60 sec / kb, complete extension at 72°C for 5 min, 35 cycles from denaturation to extension.

[0052] The target band of the product after the reaction was determined by agarose gel electrophoresis, and then the target band was cut out and purified and recovered using a gel recovery kit (Omega, D2500-01). The general process is as follows: add Binding Buffer (1g / ml) to the gel block, place it in a 60°C water bath, transfer the liquid to a HiBindTM DNA column after the gel block is completely dissolved, and centrifuge at 10,000×g at room temperature for 1 min; discard the waste liquid in the collection tube, add 300μl Binding Buffer HiBind, and centrifuge at 10,000×g at room temperature for 1 min; discard the waste liquid and add 700μl SPW Wash buffer HiBind DNA column, centrifuge at 10,000×g at room temperature for 1 min, repeat twice; discard the waste liquid and centrifuge at 10,000×g at room temperature for 1 min; put the column into a new 1.5ml centrifuge tube, add 50μl elution buffer, let it stand for 2 min, and centrifuge at 10,000×g for 1 min.

[0053] The purified product was cloned by TA and transformed into competent E. coli cells by heat shock method: the TA cloned product was added to competent E. coli cells on ice, allowed to stand for 30 minutes, then placed in a 42°C water bath for 60 seconds, and then placed on ice for 2 minutes. 500 μl of antibiotic-free LB liquid culture medium was added and revived on a shaker at 37°C for 40 minutes. Subsequently, 200 μl of bacteria were pipetted with a liquid transfer gun and evenly spread on LB solid culture medium with kanamycin, and cultured at 37°C overnight. The grown monoclonal clone was picked and placed in a liquid culture medium with kanamycin and cultured on a shaker at 37°C for 4-5 hours. The positive monoclonal clone was identified by PCR on the bacterial solution, and the positive monoclonal clone was sent to Qingke Company for first-generation sequencing to obtain the sequence of the target gene.

[0054] Example 2: Plasmid extraction and Agrobacterium transformation

[0055] The obtained positive recombinant vector was subjected to plasmid extraction for long-term storage. Plasmid extraction was performed using a plasmid extraction kit (Tiangen, DP103). First, the bacterial solution cultured overnight at 37°C was enriched, and then Buffer P1, Buffer P2, and Buffer P3 were added to resuspend, lyse, and precipitate the bacteria. The first step required thorough resuspension, and the following two steps required slight mixing. The obtained liquid was transferred to an adsorption column, centrifuged at 10,000 r / min for 1 min, the supernatant was discarded, 500 μl of deproteinized solution PD was added, and centrifuged at 10,000 r / min for 1 min, the supernatant was discarded, 700 μl of rinsing solution was added, and centrifuged at 10,000 r / min for 1 min, the rinsing was repeated twice, the supernatant was discarded, and the centrifugation was performed at 10,000 r / min for 2 min. After 50 μl of ddH20 was added to the adsorption column and allowed to stand for two minutes, the collection tube was replaced with a new 1.5 ml centrifuge tube and centrifuged at 10,000 r / min for 1 min. The centrifuge tube contained the extracted plasmid.

[0056] Agrobacterium transformation uses the freeze-thaw method. The basic steps are: add no more than 1 μg of plasmid to the Agrobacterium competent cell GV3101 strain, let it stand on ice for 5 minutes, freeze it in liquid nitrogen for 5 minutes, bath it in 37℃ water for 5 minutes, let it stand on ice for 2 minutes, add 500 μl of non-antibiotic YEP liquid medium to revive it at 28℃ for 2-3 hours, and evenly apply 200 μl to the YEP solid medium with rifampicin, gentamicin and kanamycin resistance. Two days later, pick a single clone and perform bacterial liquid PCR identification on it. Add 50% glycerol (v:v, 2:1) to the positive Agrobacterium, mix it well and store it in a -80℃ refrigerator for later use.

[0057] Example 3: Agrobacterium-mediated transformation of Arabidopsis thaliana

[0058] Cultivate Agrobacterium in a shaker at 28°C overnight until the OD value of the bacterial solution is between 0.8-1.2, centrifuge at 5000×g for 5 minutes to enrich the bacterial solution, resuspend it in 5% sucrose solution, add 20,000 to 50,000 parts of a surfactant (selwet-77), use a pipette to absorb the bacterial solution and apply it to the unopened flowers of Arabidopsis, let it stand for a few minutes, wipe off the bacterial solution and culture it in the dark for 16-24 hours. Positive seeds can be obtained after 20-30 days.

[0059] The above specific embodiments are merely explanations of the present invention and are not limitations of the present invention. After reading this specification, those skilled in the art may make modifications to the embodiments without any creative contribution as needed. However, such modifications are protected by the patent law as long as they are within the scope of the claims of the present invention.

Claims

1. A clubroot-resistant Brassica napus gene BnaC09g44020D, characterized by: The nucleotide sequence of the clubroot-resistant Brassica napus gene BnaC09g44020D is SEQ ID No.

1.

2. A primer combination for identifying the clubroot resistance gene BnaC09g44020D of Brassica napus, characterized by: The primer combination includes BnaC09g44020D-F and BnaC09g44020D-R, the sequence of BnaC09g44020D-F is SEQ ID No.2; the sequence of BnaC09g44020D-R is SEQ ID No.

3.

3. The clubroot-resistant Brassica napus gene BnaC09g44020D according to claim 1, characterized in that: The gene is located on chromosome C09 and can positively regulate the plant's resistance to clubroot disease.

4. A method for extracting the clubroot resistance gene BnaC09g44020D of Brassica napus, characterized in that: The following steps are involved: (a) extracting genomic DNA from Brassica napus; (b) using the genomic DNA as a template and using specific primers to perform PCR amplification to obtain a reaction product; (c) purifying the reaction product to obtain a purified product; (d) cloning the purified product, transforming it into competent Escherichia coli cells using a heat shock method, and then culturing it to obtain a bacterial solution; (e) Identifying the bacterial solution to confirm the presence of the gene.

5. The clubroot-resistant Brassica napus gene BnaC09g44020D according to claim 1 is characterized in that: The gene plays an important role in the breeding of clubroot-resistant Brassica napus.

6. A method for cultivating clubroot-resistant Brassica napus using gene BnaC09g44020D, characterized in that: The following steps are involved: S1: The CDS sequence of BnaC09g44020D in the disease-resistant parent was constructed into the 2*CaMV 35S overexpression vector; S2: Infect wild-type Arabidopsis to obtain Arabidopsis lines overexpressing BnaC09g44020D; S3: Observe the resistance of Arabidopsis thaliana overexpressing BnaC09g44020D to clubroot disease to verify the effect of the BnaC09g44020D gene on clubroot disease resistance.

7. An application of the BnaC09g44020D gene as claimed in claim 1 to improve the ability of plants to resist clubroot disease, characterized in that: The BnaC09g44020D gene was transferred into other cruciferous crops through genetic engineering to improve their resistance to clubroot.

8. The use according to claim 7, characterized in that: The cruciferous plant is rapeseed, Arabidopsis thaliana, Chinese cabbage or kale.

Images