Probe library construction

Abstract

The present invention generally relates to systems and methods for producing nucleic acids. In some aspects, relatively large amounts of oligonucleotides may be produced, and in some cases, oligonucleotides may have a variety of different sequences and / or lengths. For example, relatively small amounts of oligonucleotides can be amplified to produce large amounts of nucleotides. In one set of embodiments, the oligonucleotides may be amplified using PCR and then transcribed to produce RNA. The RNA may then be reverse transcribed to produce DNA, and optionally, the RNA may be selectively degraded or removed relative to the DNA. In one set of embodiments, the oligonucleotides may be chemically modified. These modifications may include, but are not limited to, the addition of fluorescent dyes or other signaling entities.

Description

[0001] This application is a divisional application of Chinese invention patent application No. 201580051029.5, whose application date is July 29, 2015 and invention name is “Probe Library Construction”.

[0002] Related Applications

[0003] This application claims the benefit of U.S. Provisional Patent Application Serial No. 62 / 050,636, filed by Zhuang et al. on September 15, 2014, entitled “Probe Library Construction”; U.S. Provisional Patent Application Serial No. 62 / 031,062, filed by Zhuang et al. on July 30, 2014, entitled “Systems and Methods for Determining Nucleic Acids”; and U.S. Provisional Patent Application Serial No. 62 / 142,653, filed by Zhuang et al. on April 3, 2015, entitled “Systems and Methods for Determining Nucleic Acids”. Each of the above is incorporated herein by reference.

[0004] Government funding

[0005] This invention was made with government support under Grant No. GM096450 awarded by the National Institutes of Health. The government has certain rights in this invention. field

[0007] The present invention generally relates to systems and methods for producing nucleic acids. background

[0009] Custom synthesized oligonucleotide probes have emerged as powerful tools for identifying and isolating specific nucleic acid targets by hybridization. Applications of such hybridization probe sets range from next generation sequencing (where such probes are used to enrich or deplete samples of specific nucleic acid targets) to imaging of fixed samples (where fluorescently labeled hybridization probes allow direct measurement of the quantity and spatial organization of target species).

[0010] There is now a wide commercial source of such probes.Such probes are prepared conventionally by using standard solid phase synthesis methods to synthesize each oligonucleotide member.Unfortunately, due to requiring each oligonucleotide member to be synthesized individually and individually, this limits the probe quantity in a single set and the quantity of a unique set.

[0011] Recent advances in array-based oligonucleotide synthesis by several companies have reduced the cost of producing oligonucleotides. However, these methods also result in oligonucleotide probes that are 1 / 1000 of the oligonucleotide probes required for a single hybridization reaction, thus limiting their usefulness. Therefore, there is a need to improve oligonucleotide production. Overview

[0013] The present invention generally relates to systems and methods for producing nucleic acids. In some cases, the subject matter of the present invention relates to related products, alternative solutions to a particular problem and / or multiple different uses of one or more systems and / or articles.

[0014] In one aspect, the invention generally relates to a method. According to one set of embodiments, the method comprises amplifying at least some of a plurality of oligonucleotides using real-time PCR to produce amplified oligonucleotides, transcribing at least some of the amplified oligonucleotides in vitro to produce RNA, reverse transcribing the RNA to produce transcribed DNA, and selectively degrading the RNA relative to the transcribed DNA.

[0015] In another set of embodiments, the method includes simultaneously amplifying at least some of the plurality of oligonucleotides in a common solution using PCR to produce amplified oligonucleotides, in vitro transcribing at least some of the amplified oligonucleotides to produce RNA, reverse transcribing the RNA to produce transcribed DNA, and selectively degrading the RNA relative to the transcribed DNA.

[0016] In another set of embodiments, the method includes the steps of providing a plurality of oligonucleotides having an average length of 10-200 nucleotides and comprising at least 100 unique oligonucleotide sequences, using real-time PCR to produce amplified oligonucleotides comprising one of the plurality of oligonucleotides and a promoter, transcribing at least some of the amplified oligonucleotides using an RNA polymerase to produce RNA, reverse transcribing the RNA using a primer comprising a signaling entity to produce DNA, and chemically reducing the RNA.

[0017] In yet another group of embodiments, the method comprises the steps of providing a plurality of oligonucleotides having an average length of 10 to 200 nucleotides and comprising at least 100 unique oligonucleotide sequences, using PCR to produce amplified oligonucleotides in a common solution comprising one of the plurality of oligonucleotides and a promoter, transcribing at least some of the amplified oligonucleotides using an RNA polymerase to produce RNA, reverse transcribing the RNA using a primer comprising a signaling entity to produce DNA, and chemically reducing the RNA.

[0018] In another aspect, the invention includes methods of making one or more embodiments described herein, e.g., oligonucleotides, including but not limited to modified oligonucleotides, such as those described herein (e.g., labeled with a signaling entity). In another aspect, the invention includes methods of using one or more embodiments described herein, e.g., oligonucleotides, including but not limited to modified oligonucleotides, such as those described herein (e.g., labeled with a signaling entity).

[0019] The present invention relates to the following scheme:

[0020] 1. A method comprising:

[0021] amplifying at least some of the plurality of oligonucleotides using real-time PCR to produce amplified oligonucleotides;

[0022] in vitro transcribing at least some of the amplified oligonucleotides to produce RNA;

[0023] reverse transcribing the RNA to produce transcribed DNA; and

[0024] The RNA is selectively degraded relative to the transcribed DNA.

[0025] 2. The method of embodiment 1, wherein the plurality of oligonucleotides have an average length of 10 to 200 nucleotides.

[0026] 3. The method of any one of embodiments 1 or 2, wherein the plurality of oligonucleotides comprises at least 10 unique oligonucleotide sequences.

[0027] 4. The method of any one of embodiments 1-3, wherein the plurality of oligonucleotides comprises at least 100 unique oligonucleotide sequences.

[0028] 5. The method of any one of embodiments 1-4, wherein the plurality of oligonucleotides comprises at least 1,000 unique oligonucleotide sequences.

[0029] 6. The method of any one of embodiments 1-5, wherein the plurality of oligonucleotides comprises at least 10,000 unique oligonucleotide sequences.

[0030] 7. The method of any one of embodiments 1-6, wherein the plurality of oligonucleotides comprises at least 100,000 unique oligonucleotide sequences.

[0031] 8. The method of any one of embodiments 1-7, wherein each of the unique oligonucleotide sequences comprises a first region that is identical among the unique oligonucleotide sequences and a second region that is different among the unique oligonucleotide sequences.

[0032] 9. The method of embodiment 8, wherein each of the unique oligonucleotide sequences comprises a third region that is identical among the unique oligonucleotide sequences, wherein the second region separates the first region and the third region.

[0033] 10. The method of any one of embodiments 1-9, wherein amplifying at least some of the plurality of oligonucleotides comprises exposing at least some of the plurality of oligonucleotides to a sequence containing a primer.

[0034] 11. The method of embodiment 10, wherein at least some of the primer-containing sequences further comprise a promoter, whereby the promoter is added to at least some of the amplified oligonucleotides.

[0035] 12. The method of any one of embodiments 1-10, wherein at least some of the amplified oligonucleotides contain a promoter.

[0036] 13. The method of any one of embodiments 11 or 12, wherein the promoter is a T7 promoter.

[0037] 14. The method of any one of embodiments 11 or 12, wherein the promoter is a T3 promoter.

[0038] 15. The method according to any one of embodiments 11 or 12, wherein the promoter is an SP6 promoter.

[0039] 16. The method of any one of embodiments 1-15, wherein at least some of the plurality of oligonucleotides comprises at least a first set of oligonucleotides having a first common index region and a second set of oligonucleotides having a second common index region distinguishable from the first common index region.

[0040] 17. The method of embodiment 16, comprising amplifying the first set of oligonucleotides but not amplifying the second set of oligonucleotides.

[0041] 18. The method of any one of embodiments 16 or 17, wherein the plurality of oligonucleotides comprises at least 2 sets of oligonucleotides having distinguishable common index regions.

[0042] 19. The method of any one of embodiments 16-18, wherein the plurality of oligonucleotides comprises at least 4 groups of oligonucleotides having distinguishable common index regions.

[0043] 20. The method of any one of embodiments 16-19, wherein the plurality of oligonucleotides comprises at least 10 groups of oligonucleotides having distinguishable common index regions.

[0044] 21. The method of any one of embodiments 16-20, wherein the plurality of oligonucleotides comprises at least 20 sets of oligonucleotides having distinguishable common index regions.

[0045] 22. The method of any one of embodiments 16-21, wherein the plurality of oligonucleotides comprises at least 96 sets of oligonucleotides having distinguishable common index regions.

[0046] 23. The method of any one of embodiments 16-22, wherein the plurality of oligonucleotides comprises at least 100 sets of oligonucleotides having distinguishable common index regions.

[0047] 24. The method of any one of embodiments 16-23, wherein the plurality of oligonucleotides comprises at least 192 sets of oligonucleotides having distinguishable common index regions.

[0048] 25. The method of any one of embodiments 1-24, wherein amplifying at least some of the plurality of oligonucleotides comprises generating an amplified oligonucleotide comprising one of the plurality of oligonucleotides and a promoter.

[0049] 26. The method of any one of embodiments 1-27, wherein transcribing at least some of the amplified oligonucleotides comprises an amount of RNA that is at least 100 times the amount of amplified oligonucleotides.

[0050] 27. The method of any one of embodiments 1-26, wherein transcribing at least some of the amplified oligonucleotides comprises exposing the amplified oligonucleotides to an RNA polymerase.

[0051] 28. The method of embodiment 27, wherein the RNA polymerase is T7 RNA polymerase.

[0052] 29. The method of embodiment 27, wherein the RNA polymerase is T3 RNA polymerase.

[0053] 30. The method of embodiment 27, wherein the RNA polymerase is SP6 RNA polymerase.

[0054] 31. The method of embodiment 27, wherein the RNA polymerase is RNA polymerase I, RNA polymerase II, RNA polymerase III, RNA polymerase IV or RNA polymerase V.

[0055] 32. The method of embodiment 27, wherein the RNA polymerase is a viral RNA polymerase.

[0056] 33. The method of any one of embodiments 1-32, wherein transcribing at least some of the amplified oligonucleotides to produce RNA comprises producing an average of at least 10 RNA copies per said amplified oligonucleotide.

[0057] 34. The method of any one of embodiments 1-33, wherein transcribing at least some of the amplified oligonucleotides to produce RNA comprises producing an average of at least 100 RNA copies per said amplified oligonucleotide.

[0058] 35. The method of any one of embodiments 1-34, wherein transcribing at least some of the amplified oligonucleotides to produce RNA comprises producing an average of at least 1,000 copies of RNA per said amplified oligonucleotide.

[0059] 36. The method of any one of embodiments 1-35, wherein transcribing at least some of the amplified oligonucleotides to produce RNA comprises producing an average of at least 10,000 RNA copies per said amplified oligonucleotide.

[0060] 37. The method of any one of embodiments 1-36, wherein reverse transcribing the RNA comprises exposing the RNA to a reverse transcriptase.

[0061] 38. The method of embodiment 37, wherein the reverse transcriptase is a viral reverse transcriptase.

[0062] 39. The method of any one of embodiments 1-38, wherein the RNA is reverse transcribed to produce transcribed DNA without first purifying the RNA from components used to produce the RNA.

[0063] 40. The method of any one of embodiments 1-39, further comprising purifying the RNA from components used to produce the RNA before reverse transcribing the RNA to produce transcribed DNA.

[0064] 41. The method of any one of embodiments 1-40, wherein reverse transcribing the RNA to produce transcribed DNA comprises reverse transcribing the RNA to produce transcribed DNA using a sequence containing a transcription primer.

[0065] 42. The method of embodiment 41, wherein the sequence containing a transcription primer is incorporated into the transcribed DNA.

[0066] 43. The method of any one of embodiments 41 or 42, wherein the sequence containing the transcription primer further comprises a biotin moiety.

[0067] 44. The method of any one of embodiments 41-43, wherein the sequence containing the transcription primer further comprises a digoxigenin portion.

[0068] 45. The method of any one of embodiments 41-44, wherein the sequence containing the transcription primer further comprises a fluorophore.

[0069] 46. ​​The method according to any one of embodiments 41 to 45, wherein the sequence containing the transcription primer further comprises a non-nucleic acid portion.

[0070] 47. The method of any one of embodiments 41-46, wherein the sequence containing the transcription primer further comprises a signaling entity linked thereto.

[0071] 48. The method of embodiment 47, wherein the signaling entity is fluorescent.

[0072] 49. The method of any one of embodiments 47 or 48, wherein the signaling entity is photo-switchable between a first state capable of emitting light at a first wavelength and a second state incapable of emitting light at the first wavelength.

[0073] 50. The method of any one of embodiments 47-49, wherein the signaling entity is photoactivatable.

[0074] 51. The method of embodiment 47, wherein the signaling entity is a nucleic acid sequence.

[0075] 52. The method of embodiment 51, wherein the additional nucleic acid sequence is capable of selectively hybridizing to a second nucleic acid sequence containing an additional signaling entity by Watson-Crick base pairing.

[0076] 53. The method of any one of embodiments 1-52, wherein selectively degrading the RNA relative to the transcribed DNA comprises chemically reducing the RNA.

[0077] 54. The method of any one of embodiments 1-53, wherein selectively degrading the RNA relative to the transcribed DNA comprises exposing the RNA to a pH of at least about 9.

[0078] 55. The method of any one of embodiments 1-54, wherein selectively degrading the RNA relative to the transcribed DNA comprises subjecting the RNA to alkaline hydrolysis.

[0079] 56. The method of any one of embodiments 1-55, wherein selectively degrading the RNA relative to the transcribed DNA comprises enzymatically digesting the RNA.

[0080] 57. The method of any one of embodiments 1-56, wherein the transcribed DNA is substantially single-stranded.

[0081] 58. The method according to any one of embodiments 1 to 57, wherein the steps are performed in the order described.

[0082] 59. The method of any one of embodiments 1-58, further comprising purifying the transcribed DNA.

[0083] 60. The method of embodiment 59, comprising purifying the transcribed DNA by column purification.

[0084] 61. The method of any one of embodiments 59 or 60, comprising purifying the transcribed DNA by ethanol precipitation.

[0085] 62. The method according to any one of embodiments 59-61, comprising purifying the transcribed DNA by solid phase reversible immobilization.

[0086] 63. The method of any one of embodiments 1-62, further comprising concentrating the transcribed DNA.

[0087] 64. The method of embodiment 63, comprising concentrating the transcribed DNA by evaporation.

[0088] 65. The method of any one of embodiments 1-64, wherein the plurality of oligonucleotides are computationally designed.

[0089] 66. The method of any one of embodiments 1-65, wherein the plurality of oligonucleotides are produced synthetically.

[0090] 67. The method of any one of embodiments 1-66, wherein the plurality of oligonucleotides are from cells.

[0091] 68. The method of any one of embodiments 1-67, wherein the plurality of oligonucleotides are produced on a substrate.

[0092] 69. The method of embodiment 68, wherein the plurality of oligonucleotides are produced in an array on a substrate.

[0093] 70. The method of any one of embodiments 1-69, further comprising isolating a subset of the DNA.

[0094] 71. The method of any one of embodiments 1-70, wherein each oligonucleotide in the subset of oligonucleotides comprises the same index portion.

[0095] 72. The method of any one of embodiments 1-71, wherein each transcribed DNA in the subset of oligonucleotides comprises the same index portion, and the method further comprises separating the subsets of transcribed DNA based on the same index portion.

[0096] 73. A method comprising:

[0097] simultaneously amplifying at least some of the plurality of oligonucleotides in the common solution using PCR to produce amplified oligonucleotides;

[0098] in vitro transcribing at least some of the amplified oligonucleotides to produce RNA;

[0099] reverse transcribing the RNA to produce transcribed DNA; and

[0100] The RNA is selectively degraded relative to the transcribed DNA.

[0101] 74. The method of embodiment 73, wherein the plurality of oligonucleotides have an average length of 10 to 200 nucleotides.

[0102] 75. The method of any one of embodiments 73 or 74, wherein the plurality of oligonucleotides comprises at least 10 unique oligonucleotide sequences.

[0103] 76. The method of any one of embodiments 73-75, wherein the plurality of oligonucleotides comprises at least 100 unique oligonucleotide sequences.

[0104] 77. The method of any one of embodiments 73-76, wherein the plurality of oligonucleotides comprises at least 1,000 unique oligonucleotide sequences.

[0105] 78. The method of any one of embodiments 73-77, wherein the plurality of oligonucleotides comprises at least 10,000 unique oligonucleotide sequences.

[0106] 79. The method of any one of embodiments 73-78, wherein the plurality of oligonucleotides comprises at least 100,000 unique oligonucleotide sequences.

[0107] 80. The method of any one of embodiments 73-79, wherein amplifying at least some of the plurality of oligonucleotides comprises exposing at least some of the plurality of oligonucleotides to a sequence containing a primer.

[0108] 81. The method of embodiment 80, wherein at least some of the primer-containing sequences further comprise a promoter, thereby adding a promoter to at least some of the amplified oligonucleotides.

[0109] 82. The method of any one of embodiments 1-80, wherein at least some of the amplified oligonucleotides contain a promoter.

[0110] 83. The method of any one of embodiments 81 or 82, wherein the promoter is a T7 promoter.

[0111] 84. The method of any one of embodiments 81 or 82, wherein the promoter is a T3 promoter.

[0112] 85. The method of any one of embodiments 81 or 82, wherein the promoter is an SP6 promoter.

[0113] 86. The method of any one of embodiments 73-85, wherein at least some of the plurality of oligonucleotides comprise at least a first set of oligonucleotides having a first common index region and a second set of oligonucleotides having a second common index region distinguishable from the first common index region.

[0114] 87. The method of embodiment 86, comprising amplifying the first set of oligonucleotides but not amplifying the second set of oligonucleotides.

[0115] 88. The method of any one of embodiments 86 or 87, wherein the plurality of oligonucleotides comprises at least 2 sets of oligonucleotides having distinguishable common index regions.

[0116] 89. The method of any one of embodiments 86-88, wherein the plurality of oligonucleotides comprises at least 4 groups of oligonucleotides having distinguishable common index regions.

[0117] 90. The method of any one of embodiments 86-89, wherein the plurality of oligonucleotides comprises at least 10 groups of oligonucleotides having distinguishable common index regions.

[0118] 91. The method of any one of embodiments 86-90, wherein the plurality of oligonucleotides comprises at least 20 groups of oligonucleotides having distinguishable common index regions.

[0119] 92. The method of any one of embodiments 86-91, wherein the plurality of oligonucleotides comprises at least 96 sets of oligonucleotides having distinguishable common index regions.

[0120] 93. The method of any one of embodiments 86-92, wherein the plurality of oligonucleotides comprises at least 100 sets of oligonucleotides having distinguishable common index regions.

[0121] 94. The method of any one of embodiments 86-93, wherein the plurality of oligonucleotides comprises at least 192 sets of oligonucleotides having distinguishable common index regions.

[0122] 95. The method of any one of embodiments 73-94, wherein amplifying at least some of the plurality of oligonucleotides comprises generating an amplified oligonucleotide comprising one of the plurality of oligonucleotides and a promoter.

[0123] 96. The method of any one of embodiments 73-95, wherein transcribing at least some of the amplified oligonucleotides comprises an amount of RNA that is at least 100 times the amount of amplified oligonucleotides.

[0124] 97. The method of any one of embodiments 73-96, wherein transcribing at least some of the amplified oligonucleotides comprises exposing the amplified oligonucleotides to an RNA polymerase.

[0125] 98. The method of embodiment 97, wherein the RNA polymerase is T7 RNA polymerase.

[0126] 99. The method of embodiment 97, wherein the RNA polymerase is T3 RNA polymerase.

[0127] 100. The method of embodiment 97, wherein the RNA polymerase is SP6 RNA polymerase.

[0128] 101. The method of embodiment 97, wherein the RNA polymerase is RNA polymerase I, RNA polymerase II, RNA polymerase III, RNA polymerase IV or RNA polymerase V.

[0129] 102. The method of embodiment 97, wherein the RNA polymerase is a viral RNA polymerase.

[0130] 103. The method of any one of embodiments 73-102, wherein transcribing at least some of the amplified oligonucleotides to produce RNA comprises producing an average of at least 10 RNA copies per said amplified oligonucleotide.

[0131] 104. The method of any one of embodiments 73-103, wherein transcribing at least some of the amplified oligonucleotides to produce RNA comprises producing an average of at least 100 RNA copies per said amplified oligonucleotide.

[0132] 105. The method of any one of embodiments 73-104, wherein transcribing at least some of the amplified oligonucleotides to produce RNA comprises producing an average of at least 1,000 copies of RNA per the amplified oligonucleotide.

[0133] 106. The method of any one of embodiments 73-105, wherein transcribing at least some of the amplified oligonucleotides to produce RNA comprises producing an average of at least 10,000 RNA copies per amplified oligonucleotide.

[0134] 107. The method of any one of embodiments 73-106, wherein reverse transcribing the RNA comprises exposing the RNA to a reverse transcriptase.

[0135] 108. The method of embodiment 107, wherein the reverse transcriptase is a viral reverse transcriptase.

[0136] 109. The method of any one of embodiments 73-108, wherein the RNA is reverse transcribed to produce transcribed DNA without first purifying the RNA from components used to produce the RNA.

[0137] 110. The method of any one of embodiments 73-109, further comprising purifying the RNA from components used to produce the RNA before reverse transcribing the RNA to produce transcribed DNA.

[0138] 111. The method of any one of embodiments 73-110, wherein reverse transcribing the RNA to produce transcribed DNA comprises reverse transcribing the RNA to produce transcribed DNA using a sequence containing a transcription primer.

[0139] 112. The method of embodiment 111, wherein the sequence containing the transcription primer is incorporated into the transcribed DNA.

[0140] 113. The method of any one of embodiments 111 or 112, wherein the sequence containing the transcription primer further comprises a biotin moiety.

[0141] 114. The method of any one of embodiments 111-113, wherein the sequence containing the transcription primer further comprises a digoxigenin portion.

[0142] 115. The method of any one of embodiments 111-114, wherein the sequence containing the transcription primer further comprises a fluorophore.

[0143] 116. The method according to any one of embodiments 111-115, wherein the sequence containing the transcription primer further comprises a non-nucleic acid portion.

[0144] 117. The method of any one of embodiments 111-116, wherein the sequence containing the transcription primer further comprises a signaling entity linked thereto.

[0145] 118. The method of embodiment 117, wherein the signaling entity is fluorescent.

[0146] 119. The method of any one of embodiments 117 or 118, wherein the signaling entity is photo-switchable between a first state capable of emitting light at a first wavelength and a second state incapable of emitting light at the first wavelength.

[0147] 120. The method of any one of embodiments 117-119, wherein the signaling entity is photoactivatable.

[0148] 121. The method of embodiment 120, wherein the signaling entity is a nucleic acid sequence.

[0149] 122. The method of embodiment 121, wherein the additional nucleic acid sequence is capable of selectively hybridizing to a second nucleic acid sequence containing an additional signaling entity by Watson-Crick base pairing.

[0150] 123. The method of any one of embodiments 73-122, wherein selectively degrading the RNA relative to the transcribed DNA comprises chemically reducing the RNA.

[0151] 124. The method of any one of embodiments 73-123, wherein selectively degrading the RNA relative to the transcribed DNA comprises exposing the RNA to a pH of at least about 9.

[0152] 125. The method of any one of embodiments 73-124, wherein selectively degrading the RNA relative to the transcribed DNA comprises subjecting the RNA to alkaline hydrolysis.

[0153] 126. The method of any one of embodiments 73-125, wherein selectively degrading the RNA relative to the transcribed DNA comprises enzymatically digesting the RNA.

[0154] 127. The method of any one of embodiments 73-126, wherein the transcribed DNA is substantially single-stranded.

[0155] 128. The method of any one of embodiments 73-127, wherein the steps are performed in the order described.

[0156] 129. The method of any one of embodiments 73-128, further comprising purifying the transcribed DNA.

[0157] 130. The method of embodiment 129, comprising purifying the transcribed DNA by column purification.

[0158] 131. The method of any one of embodiments 129 or 130, comprising purifying the transcribed DNA by ethanol precipitation.

[0159] 132. The method of any one of embodiments 129-131, comprising purifying the transcribed DNA by solid phase reversible immobilization.

[0160] 133. The method of any one of embodiments 73-132, further comprising concentrating the transcribed DNA.

[0161] 134. The method of embodiment 133, comprising concentrating the transcribed DNA by evaporation.

[0162] 135. The method of any one of embodiments 73-134, wherein the plurality of oligonucleotides are computationally designed.

[0163] 136. The method of any one of embodiments 73-135, wherein the plurality of oligonucleotides are produced synthetically.

[0164] 137. The method of any one of embodiments 73-136, wherein the plurality of oligonucleotides are from cells.

[0165] 138. The method of any one of embodiments 73-137, wherein the plurality of oligonucleotides are produced on a substrate.

[0166] 139. The method of embodiment 138, wherein the plurality of oligonucleotides are produced in an array on a substrate.

[0167] 140. The method of any one of embodiments 73-139, further comprising isolating a subset of the DNA.

[0168] 141. The method of any one of embodiments 73-140, wherein each oligonucleotide in the subset of oligonucleotides comprises the same index portion.

[0169] 142. The method of any one of embodiments 73-141, wherein each transcribed DNA of the subset of oligonucleotides comprises the same index portion, and the method further comprises separating the subset of transcribed DNA based on the same index portion.

[0170] When considered in conjunction with the accompanying drawings, other advantages and novel features of the present invention will become apparent from the following detailed description of various non-limiting embodiments of the present invention. In the case where this specification and the documents incorporated by reference include conflicting and / or inconsistent disclosures, this specification shall prevail. If two or more documents incorporated by reference include conflicting and / or inconsistent disclosures, the document with the later effective date shall prevail. BRIEF DESCRIPTION OF THE DRAWINGS

[0172] Non-limiting embodiments of the present invention will be described by way of example with reference to the accompanying drawings, which are schematic and are not intended to be drawn to scale. In the drawings, each identical or nearly identical component shown is generally represented by a single numeral. For the sake of clarity, where illustration is not necessary for an ordinary technician in the field to understand the present invention, not every component is marked in each figure, nor is every component of each embodiment of the present invention shown. In the drawings:

[0173] Figure 1 describes the generation of a DNA probe according to one set of embodiments; and

[0174] Figure 2 illustrates a template molecule (SEQ ID NO: 3) produced according to one embodiment of the present invention;

[0175] FIG3 lists optimized primers from the E. coli transcriptome in another embodiment of the present invention (sequences correspond to SEQ ID NOs: 4-57, 58-111, 112-165, and 166-201 from top to bottom and from left to right on the page); and

[0176] Figure 4 shows various probes according to another embodiment of the present invention. The sequences in Figure 4 correspond to SEQ ID NOs: 202-221, 222-243, 244-265, 266-287, 288-309, 310-331, 332-353, 354-375, 376-397, 398-419, 420-441, 442-463, 464-485, 486-507, 508-529, 530-551, 552-573 from top to bottom and from left to right. ,574-595,596-617,618-639,640-661,662-683,684-705,706-727,728-749,750-771,772-793,794-815,816-837,838-859,860-881,882-903,904-925,and 926-937. Detailed Description

[0178] The present invention generally relates to systems and methods for producing nucleic acids. In some respects, relatively large amounts of oligonucleotides can be produced, and in some cases, oligonucleotides can have a variety of different sequences and / or lengths. For example, relatively small amounts of oligonucleotides can be amplified to produce a large amount of nucleotides. In one group of embodiments, PCR amplification of oligonucleotides can be used, and then transcribed to produce RNA. RNA can then be reverse transcribed to produce DNA, and optionally, RNA can be selectively degraded or removed relative to DNA. In one group of embodiments, oligonucleotides can be chemically modified. These modifications can include, but are not limited to, adding fluorescent dyes or other signaling entities.

[0179] U.S. Provisional Patent Application Serial No. 62 / 031,062, filed on July 30, 2014 by Zhuang et al., and entitled “Systems and Methods for Determining Nucleic Acids,” is incorporated herein by reference in its entirety.

[0180] On the one hand, the present invention generally relates to an in vitro method for amplifying multiple oligonucleotides. In some cases, a relatively large number of unique oligonucleotides within a plurality of oligonucleotides can be amplified. For example, a plurality of oligonucleotides to be amplified can include 10, 100, 1,000 or more unique sequences.

[0181] In addition, in some embodiments, oligonucleotide can be amplified, and need not be some oligonucleotides (for example due to competitive effect) with respect to other oligonucleotide selective amplification.Although some drifts may occur, it is expected that the relative ratio of the oligonucleotide in a plurality of oligonucleotides keeps substantially the same after amplification, at least so for some applications.However, in many amplification techniques, due to the combination of different oligonucleotides or the difference of avidity, some oligonucleotides can be amplified to a greater extent than other oligonucleotides, therefore, it is necessary to utilize specific techniques to reduce or eliminate this problem, for example, by amplifying each oligonucleotide respectively before oligonucleotides are combined to form a plurality of oligonucleotides.On the contrary, as discussed herein, in certain embodiments, a plurality of oligonucleotides can be amplified without causing substantial changes or variations in oligonucleotide ratios, without the need to separate oligonucleotides, generate oligonucleotides or other troublesome technologies separately.

[0182] Reference now Figure 1 , an example of an embodiment of the present invention is now shown. In the figure, a plurality of oligonucleotides 10 are provided. This can include 1, 10, 100, 1,000, 10,000, 100,000 or any other suitable number of unique oligonucleotide sequences. Of course, any specific unique oligonucleotide more than a copy can also be present in a plurality of oligonucleotides. Unique oligonucleotides can have identical or different lengths. In some cases, a plurality of oligonucleotides have a total average length (number average or arithmetic mean) less than 200nt (nucleotide), but longer average length is also possible in some embodiments.

[0183] Initially, multiple oligonucleotides 10 can be amplified using PCR (polymerase chain reaction) or another suitable oligonucleotide amplification method to produce multiple amplified oligonucleotides 20. In some cases, PCR can be used to produce thousands to millions of copies of each oligonucleotide in the multiple oligonucleotides. In some embodiments, the multiple oligonucleotides can be amplified while still being contained in a common solution, e.g., without the need to separate the oligonucleotides before amplification, such as required in some techniques such as emulsion PCR.

[0184] While it is possible for different oligonucleotides of a plurality of oligonucleotides to be amplified at different rates in a common solution (e.g., resulting in uneven amplification of the plurality of oligonucleotides and potential loss of complexity or species within the plurality of oligonucleotides during the amplification process), in certain embodiments this can be reduced or minimized by using a variety of oligonucleotide structures and / or by using certain types of PCR techniques, as discussed herein.

[0185] As an example, in one set of embodiments, multiple oligonucleotides can all be selected to minimize competitive effects (e.g., caused by differences in binding or affinity of reagents of the oligonucleotides in a common solution or preferential enzymatic amplification of some sequence features). For example, in one set of embodiments, multiple oligonucleotides can be selected to have similar lengths and / or sequences.

[0186] like Figure 1 As shown, the plurality of oligonucleotides may each contain one or more index regions 15, 16 at one or both ends of the oligonucleotide that can be recognized by certain reagents. In some cases, the oligonucleotides of the plurality of oligonucleotides may have one or more index regions with which suitable primers may interact to allow PCR or other amplification to occur. In some embodiments, these index regions may be used to selectively generate DNA probes from only a subset of the plurality of oligonucleotides 10.

[0187] In some cases, these index regions can also be used to add additional sequence to the sequence of multiple oligonucleotides, e.g. Figure 1 As shown, oligonucleotide 11 can include index region 15, and sequence 17 comprising T7 promoter can be combined with it and introduced into the oligonucleotide of amplification (for example, as region 23).Therefore, various sequences can be applied to a plurality of oligonucleotides comprising the part that can be combined with index region.In some cases, if substantially all a plurality of oligonucleotides contain similar or identical index region, then the relative affinity or the combination of enzyme such as polymerase to the index region of oligonucleotide can be substantially similar or identical, and this can allow relatively uniform amplification to occur.A plurality of oligonucleotides can also comprise other different regions (for example region 12) that can change to produce a plurality of unique oligonucleotides.These regions can change in length and / or sequence etc.

[0188] In some embodiments, the amplification amount that occurs can be carefully controlled by monitoring the pcr amplification reaction, for example, using a technology such as real-time PCR. This can for example use an oligonucleotide with a common index region, substantially similar length and / or sequence, etc. (including those discussed previously) or with other suitable multiple oligonucleotides to occur. For example, in some embodiments, the PCR reaction can be monitored by containing the solution of the oligonucleotide with suitable light irradiation and determining the amount of the fluorescence (which can be relevant to the DNA present in the sample). The technology for monitoring the PCR reaction, for example the real-time PCR method, is known to those of ordinary skill in the art. In some embodiments, the PCR reaction can also be controlled by the amount and / or concentration of the nucleotides and / or cofactors present in control.

[0189] After amplification, the plurality of amplified oligonucleotides 20 can be transcribed to produce a plurality of RNAs 30, such as Figure 1This can be done, for example, by exposing the amplified oligonucleotide to a suitable RNA polymerase, such as T7 RNA polymerase, which can transcribe the oligonucleotide to produce the corresponding RNA. In some embodiments, the amount of RNA produced can be controlled by controlling the amount and / or concentration of the nucleotides and / or cofactors present and the duration of the in vitro transcription reaction.

[0190] The plurality of RNAs 30 can then be used to generate additional amounts of DNA 40, for example by using reverse transcription. For example, a suitable enzyme such as reverse transcriptase can be used to perform reverse transcription. In some cases, primers can be used to facilitate transcription, and in some embodiments, primers can also be used to attach additional entities to the DNA. For example, a signaling entity such as Figure 1 Alternatively, additional nucleic acid sequences can be appended that can be used to recruit additional oligonucleotides via Watson-Crick base pairing. The amount of DNA produced can be controlled, for example, by controlling the amount and / or concentration of nucleotides and / or cofactors present and the duration and temperature of the reverse transcription reaction.

[0191] In some embodiments, multiple copies of DNA can be generated from each RNA molecule. In addition, optionally, the RNA can then be removed or selectively degraded relative to the DNA, for example by alkaline hydrolysis, enzymatic digestion or other techniques.

[0192] Thus, in certain aspects, the invention generally relates to systems and methods for amplifying a plurality of oligonucleotides. In one set of embodiments, a relatively large number or mass of oligonucleotides, such as at least about 10 -3 pmol, at least about 10 -2 pmol, at least about 10 -1 pmol, at least about 10 0 pmol, at least about 10 1 pmol, at least about 10 2 pmol, at least about 10 3 pmol, etc. In addition, in some embodiments, the plurality of oligonucleotides may be substantially different. For example, the plurality of oligonucleotides may include at least about 10 1 , at least about 10 2 , at least about 10 3 , at least about 10 4 , at least about 10 5 , or at least about 10 6(It should also be noted that a plurality or a population of oligonucleotides may include more than one copy of a given unique oligonucleotide sequence.) In contrast, certain prior art techniques are capable of amplifying large numbers of unique oligonucleotides, but only to small or therapeutic amounts (e.g., about 10 -3 pmol or less), or can generate large numbers or masses of oligonucleotides, but only against one or a few unique sequences (e.g., fewer than 10 sequences).

[0193] As discussed, in certain embodiments, multiple oligonucleotides (which can include multiple unique oligonucleotide sequences, such as those described above) can be increased, without the need to substantially select some oligonucleotide sequences to be increased (such as due to competitive effects) relative to other oligonucleotide sequences, which is different from many prior arts. Although some drifts may occur during the amplification process, drift can be relatively small. For example, in certain embodiments, representative unique oligonucleotide sequences can be no more than about 10% relative to the starting ratio or percentage change of the oligonucleotide sequence before amplification after amplification relative to the average ratio of the initial total population or percentage, no more than about 8%, no more than about 6%, no more than about 5%, no more than about 4%, no more than about 3%, no more than about 2%, no more than about 1%. However, it should be noted that the oligonucleotide sequence itself can also show some variability before any amplification, which is not included in the above-mentioned figures.

[0194] The unique oligonucleotide in multiple oligonucleotides can have the same or different lengths.If there is more than one unique oligonucleotide, the unique oligonucleotide can independently have the same or different lengths.For example, in some cases, multiple oligonucleotides can have at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 50, at least 60, at least 65, at least 75, at least 100, at least 125, at least 150, at least 175, at least 200, at least 250, at least 300, at least 350, at least 400, or the average length (number average) of at least 450 nucleotides. In some cases, the average length may be no more than 500, no more than 450, no more than 400, no more than 350, no more than 300, no more than 250, no more than 200, no more than 175, no more than 150, no more than 125, no more than 100, no more than 75, no more than 60, no more than 65, no more than 60, no more than 55, no more than 50, no more than 45, no more than 40, no more than 35, no more than 30, no more than 20, or no more than 10 nucleotides. Any combination of these is also possible, for example, the average length may be between 10 and 30 nucleotides, between 20 and 40 nucleotides, between 5 and 50 nucleotides, between 10 and 200 nucleotides, or between 25 and 35 nucleotides, between 10 and 300 nucleotides, etc.

[0195] In one set of embodiments, the plurality of oligonucleotides may be amplified using any suitable technique. In some cases, for each oligonucleotide to be amplified, at least about 100, at least about 300, at least about 500, at least about 1,000, at least about 3,000, at least about 5,000, at least about 10,000, at least about 30,000, at least about 50,000 at least about 100,000, at least about 300,000, at least about 500,000, at least about 1,000,000 copies, at least about 3,000,000 copies, at least about 5,000,000 copies, at least about 10,000,000 copies, at least about 30,000,000 copies, at least about 50,000,000 copies, or at least about 100,000,000 copies of the oligonucleotide can be generated using any of the amplification techniques discussed herein (e.g., including PCR amplification, in vitro transcription, etc.). As discussed, in some cases, amplification can occur without substantial selective amplification of some oligonucleotide sequences relative to other oligonucleotide sequences.

[0196] Can use any suitable technology to produce a plurality of oligonucleotides.For example, a plurality of oligonucleotides can be synthetically produced, generated in a cell, generated on a substrate (for example, in an array), etc.The technology for producing oligonucleotides is known to those of ordinary skill in the art.In some embodiments, a plurality of oligonucleotides can also be computationally designed.

[0197] In one embodiment, PCR (polymerase chain reaction) amplification oligonucleotides can be used. In some cases, oligonucleotides can be amplified when being contained in a common liquid or solution. This is contrasted with some PCR techniques (such as emulsion PCR or digital PCR), which need to separate oligonucleotides into, for example, separated compartments or droplets before amplification to prevent the relative selective amplification of some oligonucleotides from occurring. However, surprisingly, it has been found that this separation is not needed, and other techniques (such as described herein) can be used to prevent or reduce selective amplification, while oligonucleotides are maintained together in a common solution.

[0198] As described, in some cases, by using some oligonucleotide structures and / or some types of PCR techniques, the amount of selective amplification that may occur can be reduced or eliminated. For example, in one group of embodiments, oligonucleotides are selected to minimize the competitive effect. For example, oligonucleotides can have substantially the same length, and / or share identical or similar parts or regions.

[0199] For example, in one set of embodiments, the oligonucleotides can have a distribution of lengths such that no more than about 10%, no more than about 5%, no more than about 3%, or no more than about 1% of the oligonucleotides have a length that is less than about 80% or greater than about 120%, less than about 90% or greater than about 110%, or less than about 95% or greater than about 105% of the total average length of the plurality of nucleotides.

[0200] In another group of embodiments, oligonucleotide can share one or more identical or substantially similar regions, such as index regions.The oligonucleotide sharing index or other regions can have substantially the same length (as described above) or different lengths.In some embodiments, oligonucleotide can comprise at least two identical or substantially similar index regions around the variable regions with different nucleotide sequences and optionally different lengths.For example, oligonucleotide can include in order the first region identical or substantially similar to other oligonucleotide, the second region that is not identical, and optionally, the third region identical or substantially similar to other oligonucleotide.In some embodiments, the competition of oligonucleotide can be controlled by using the oligonucleotide selected to reduce the bias of amplification.For example, in some cases, the oligonucleotide group with similar composition can be amplified together.

[0201] In some cases, the index region can have a length greater than 5, 7, 10, 12, 14, 16, 18, or 20 nucleotides, and / or have a length less than 30, 28, 25, 22, 20, 18, 16, 14, 12, or 10 nucleotides. For example, the identical or substantially similar region can have a length of 18 to 22 nucleotides. The regions can be identical, or differ by no more than 1, 2, 3, 4, or 5 nucleotides (contiguous or non-contiguous) within the region.

[0202] In certain embodiments, primer sequences can be added to promote PCR reactions. For example, primer sequences can include sequences that are substantially complementary to a region (e.g., an index region) within an oligonucleotide. A variety of such sequences that are suitable for PCR or in vitro transcription can be easily commercially available.

[0203] In some embodiments, the primer sequence may also include other sequences, such as a promoter sequence or other sequences that can be added to the oligonucleotide during PCR amplification, such as in Figure 1 , wherein the oligonucleotides are shown as T7 promoters. Therefore, oligonucleotides comprising the original sequence and one or more promoter sequences can be produced in some cases. In addition to the T7 promoter, other suitable promoters that can be used include but are not limited to T3 promoters or SP6 promoters. Such promoters can be used, for example, to promote transcription to produce RNA, as discussed in more detail below. In addition, in some embodiments, more than one promoter can be added.

[0204] In one group of embodiments, more than one sequence comprising PCR primers can be used, for example, to increase different subsets of multiple oligonucleotides. If more than one sequence containing primers is used, the PCR primers included in each of them can be identical or different. The example of suitable PCR primers includes those described herein. Therefore, for example, in one group of embodiments, for example, multiple oligonucleotides can include different sub-libraries with different index regions or other regions as described above, which can be selectively amplified by using the appropriate sequence comprising PCR primers. Any suitable number of sub-libraries can be created for multiple oligonucleotides. For example, at least 1, 2, 4, 10, 20, 96, 100 or 192 sub-libraries of multiple oligonucleotides can be selectively amplified by using specific PCR primers.

[0205] Therefore, in some cases, oligonucleotide can be formed into oligonucleotide " storehouse " or group or set in multiple oligonucleotides sharing one or more common features (such as index region or other identical sequence).For example, the common feature in the oligonucleotide of one group or a set can have at least 5,7,10,12,14,16,18 or 20 nucleotides and / or the same nucleotide sequence less than 30,28,25,22,20,18,16,14,12 or 10 nucleotides.For example, the common region identical or substantially similar in a group of oligonucleotide can have a length of 18 to 22 nucleotides.The common region can be identical, or differ in the region by no more than 1,2,3,4 or 5 nucleotides (continuous or non-continuous).In some embodiments, each group or storehouse can contain two (or more) unique index regions not used in any other storehouse, for example to reduce the pollution of the amplification product of missing the target from another amplification product.

[0206] In certain embodiments, PCR amplification can be monitored and controlled to reduce or minimize selective amplification. For example, in one group of embodiments, real-time PCR techniques can be used. In some embodiments, the degree of PCR reaction can be monitored or controlled, for example, by irradiating a solution containing an oligonucleotide with suitable light and measuring the amount of fluorescence present to monitor the PCR reaction. Therefore, for example, reaction conditions can be controlled so that the oligonucleotide reacts under conditions that minimize the amount of selective amplification, for example, by providing excessive nucleotides, ions (e.g., Mg 2+), ... 2+ ), enzymes, etc. Once the oligonucleotide concentration has reached a point where competition effects may begin to occur, the reaction can be stopped before significant selective amplification begins.

[0207] After amplification as described above, the oligonucleotides amplified can then be transcribed to produce RNA. Further amplification can also occur in this step. For example, in some cases, each oligonucleotide can be used to produce on average at least about 50, at least about 100, at least about 300, at least about 500, at least about 1,000, at least about 3,000, at least about 5,000, at least about 10,000, at least about 30,000, at least about 50,000 at least about 100,000, at least about 300,000, at least about 500,000, or at least about 1,000,000 RNA molecules transcribed. In some cases, the quality of the RNA produced can be at least about 10, at least about 20, at least about 30, at least about 50, at least about 100, at least about 200, at least about 300, or at least about 500 times of the treatment of the oligonucleotide. Thus, for example, one microgram of oligonucleotide can be converted into at least 10 micrograms, at least 30 micrograms, or at least 100 micrograms of RNA.

[0208] In one group of embodiments, transcription can occur in vitro by exposing the oligonucleotide of amplification to a suitable RNA polymerase. A variety of RNA polymerases are commercially available, including T7, T3 or SP6 RNA polymerases. Other non-limiting examples of RNA polymerases include RNA polymerase I, RNA polymerase II, RNA polymerase III, RNA polymerase IV or RNA polymerase V. RNA polymerase can be from any suitable source, such as bacteria, viruses or eukaryotes. In some embodiments, more than one RNA polymerase can be used. In addition, as previously mentioned, in some embodiments, the oligonucleotide of amplification can include a promoter sequence that can be used to promote the transcription process, such as one or more of T7, T3 or SP6 promoter sequences. One of ordinary skill in the art will appreciate the suitable conditions for using RNA polymerase to cause transcription in vitro.

[0209] In some embodiments, the overall amplification bias can be reduced by changing the relative amounts of amplification produced by PCR and in vitro transcription. For example, PCR can be used to produce a smaller amount of DNA than would normally be produced in PCR to reduce the amplification bias of the process. However, in some cases, this reduced yield can be compensated for by increasing the duration of the in vitro transcription reaction.

[0210] RNA can then be transcribed to produce DNA. In one group of embodiments, reverse transcription can occur by exposing the RNA to a suitable reverse transcriptase. In some cases, the reverse transcriptase can be a viral reverse transcriptase, such as M-MLV reverse transcriptase, AMV reverse transcriptase, etc. A variety of reverse transcriptases are commercially available. One of ordinary skill in the art will know the appropriate conditions that cause reverse transcription to occur.

[0211] In certain embodiments, reverse transcription can be promoted by using a sequence containing a primer (e.g., containing a primer for reverse transcription). In some cases, the sequence containing a primer may also include other sequences or entities, although this is not necessarily required. The sequence containing a primer may be added at any suitable point, such as just before starting the transcription reaction. Suitable transcription primers for reverse transcription are commercially available.

[0212] In one group of embodiments, the sequence containing the primer can be incorporated into the DNA during the production of DNA by reverse transcriptase. In some cases, the sequence containing the primer can contain other entities and / or sequences suitable for connecting other entities (e.g., at the 5' or 3' end, inside, etc.). For example, the sequence containing the primer can contain non-nucleic acid parts located at the 5' end, the 3' end, inside, etc., such as digoxin parts, biotin parts, etc. In some cases, the signaling entity that can be subsequently detected or measured can be introduced into the DNA. For example, the signaling entity can be fluorescent, or can be a specific nucleotide sequence that can be determined, for example, by enzymology. The example of the signaling entity is discussed in more detail below.

[0213] In some cases, the RNA can be purified prior to reverse transcription. However, it should be noted that purification is not required, and in other embodiments, the RNA can be reverse transcribed to form DNA without any intermediate purification steps. If the RNA is purified, the RNA can be purified using any suitable technique, such as by passing the RNA through a suitable column to remove oligonucleotides.

[0214] Optionally, in some embodiments, RNA can be separated from DNA or DNA can be purified in some way. For example, relative to DNA, RNA can be selectively degraded. In one group of embodiments, RNA can be degraded relative to DNA by alkaline hydrolysis. For example, the pH of the solution can be increased to at least about 8, at least about 9, at least about 10, etc. Any suitable alkali can be used to increase the pH. In some cases, after RNA degradation, the pH can also be reduced to, for example, about 7, about 7.4, physiological conditions, etc. In some cases, relative to DNA, techniques such as enzymatic degradation can be used for selective degradation of RNA. Techniques such as column purification, ethanol precipitation and / or solid phase reversible fixation techniques can also be used to purify DNA. In addition, in some cases, the DNA can be concentrated, for example, by evaporation techniques.

[0215] In addition, techniques such as those described above can be scaled up or "numbered-up" to produce larger quantities of material. For example, the process can be repeated using multi-well techniques or by running multiple reactions in parallel at the same time, etc., to produce larger quantities or large masses of oligonucleotides. As a non-limiting example, in one embodiment, processes such as those discussed herein can be performed using multiple wells of a microtiter plate (e.g., having 96, 384, 1536 wells, etc.) to increase output.

[0216] In various embodiments of the invention, DNA can be used for a variety of purposes. For example, in certain embodiments, DNA can be hybridized with nucleic acid species in a liquid sample, such as extracted from a variety of biological sources, including humans. In some cases, DNA can be used to physically separate one group of nucleic acids from another group of nucleic acids, or used as a primer for PCR or reverse transcription.

[0217] Furthermore, as previously described, in certain aspects, in some embodiments, the signaling entity is incorporated into the DNA. The signaling entity can be assayed for a variety of purposes. For example, the DNA produced can be used as a biological probe, and the signaling entity can be assayed in some manner, such as quantitatively or qualitatively, to determine a characteristic or property of the probe. Examples include, but are not limited to, the location of the probe, the activity of the probe, the concentration of the probe, etc.

[0218] In some cases, various techniques can be used, for example, to spatially determine the signaling entity within a sample. In some embodiments, the signaling entity can be fluorescent, and techniques for determining fluorescence within a sample (e.g., fluorescence microscopy or confocal microscopy) can be used to spatially identify the location of the signaling entity within the cell. In some cases, the location of the entity within the sample can be determined in two or even three dimensions.

[0219] In some embodiments, the spatial location of a signaling entity can be determined with a relatively high resolution. For example, the location can be determined with a spatial resolution of better than about 100 microns, better than about 30 microns, better than about 10 microns, better than about 3 microns, better than about 1 micron, better than about 800 nm, better than about 600 nm, better than about 500 nm, better than about 400 nm, better than about 300 nm, better than about 200 nm, better than about 100 nm, better than about 90 nm, better than about 80 nm, better than about 70 nm, better than about 60 nm, better than about 50 nm, better than about 40 nm, better than about 30 nm, better than about 20 nm, or better than about 10 nm, etc.

[0220] There are multiple technologies that can, for example, optically measure the spatial position of an entity using a fluorescence microscope or image it. In some cases, the spatial position can be measured with super-resolution or with a resolution better than the wavelength of light. Non-limiting examples include STORM (stochastic optical reconstruction microscopy), STED (stimulated emission depletion microscopy), NSOM (near-field scanning optical microscopy), 4Pi microscopy, SIM (structured illumination microscopy), SMI (spatial modulation illumination) microscopy, RESOLFT (reversible saturable optical linear fluorescence conversion microscopy), GSD (ground state depletion microscopy), SSIM (saturated structured illumination microscopy), SPDM (spectral precise distance microscopy), photoactivated localization microscopy (PALM), fluorescence photoactivated localization microscopy (FPALM), LIMON (3D optical microscopy nanomicroscopy), super-resolution optical wave imaging (SOFI), etc. See, for example, U.S. Pat. No. 7,838,302, entitled “Sub-Diffraction Limit Image Resolution and Other Imaging Techniques,” issued on November 23, 2010 to Zhuang et al.; U.S. Pat. No. 8,564,792, entitled “Sub-diffraction Limit Image Resolution in Three Dimensions,” issued on October 22, 2013 to Zhuang et al.; or International Patent Application Publication No. WO 2013 / 090360, entitled “High Resolution Dual-Objective Microscopy,” issued on June 20, 2013 to Zhuang et al., each of which is incorporated herein by reference in its entirety.

[0221] Additionally, in some cases, the signaling entity can be inactivated. For example, in some embodiments, a first secondary nucleic acid probe containing a signaling entity can be applied to a sample that can recognize a first reading sequence, and then the first secondary nucleic acid probe can be inactivated before a second secondary nucleic acid probe is applied to the sample. If multiple signaling entities are used, the same or different techniques can be used to inactivate the signaling entities, and some or all of the multiple signaling entities can be inactivated, for example, sequentially or simultaneously.

[0222] Inactivation can be caused by removing the signaling entity (e.g., from the sample or from the nucleic acid probe, etc.) and / or by chemically altering the signaling entity in some manner (e.g., by photobleaching the signaling entity, bleaching or chemically altering the structure of the signaling entity, etc.). For example, in one set of embodiments, the fluorescent signaling entity can be inactivated by chemical or optical techniques such as oxidation, photobleaching, chemical bleaching, stringent washing or enzymatic digestion, or by exposure to an enzyme reaction, dissociation of the signaling entity from other components (e.g., probes), chemical reaction of the signaling entity (e.g., with a reactant capable of altering the structure of the signaling entity), etc.

[0223] In some embodiments, various nucleic acid probes (including primary and / or secondary nucleic acid probes) may include one or more signaling entities. If more than one nucleic acid probe is used, the signaling entities may be the same or different from each other. In certain embodiments, the signaling entity is any entity capable of emitting light. For example, in one embodiment, the signaling entity is fluorescent. In other embodiments, the signaling entity may be phosphorescent, radioactive, absorptive, etc. In some cases, the signaling entity is any entity that can be measured in a sample with a relatively high resolution (e.g., with a resolution better than the wavelength of visible light). The signaling entity may be, for example, a dye, a small molecule, a peptide, or a protein, etc. In some cases, the signaling entity may be a single molecule. If multiple secondary nucleic acid probes are used, the nucleic acid probe may contain the same or different signaling entities.

[0224] Non-limiting examples of signaling entities include fluorescent entities (fluorophores) or phosphorescent entities, such as cyanine dyes (e.g., Cy2, Cy3, Cy3B, Cy5, Cy5.5, Cy7, etc.), Alexa Fluor dyes, Atto dyes, photoswitchable dyes, photoactivatable dyes, fluorescent dyes, metal nanoparticles, semiconductor nanoparticles or "quantum dots", fluorescent proteins such as GFP (green fluorescent protein) or photoactivatable fluorescent proteins such as PAGFP, PSCFP, PSCFP2, Dendra, Dendra2, EosFP, tdEos, mEos2, mEos3, PAmCherry, PAtagRFP, mMaple, mMaple2 and mMaple3. Other suitable signaling entities are known to those of ordinary skill in the art. See, for example, U.S. Patent No. 7,838,302 or U.S. Patent Application Serial No. 61 / 979,436, each of which is incorporated herein by reference in its entirety.

[0225] As used herein, the term "light" generally refers to electromagnetic radiation having any suitable wavelength (or equivalently, frequency). For example, in some embodiments, light can include wavelengths in the optical or visible range (e.g., having a wavelength between about 400nm and about 700nm, i.e., "visible light"), infrared wavelengths (e.g., having a wavelength between about 300 microns and 700nm), ultraviolet wavelengths (e.g., having a wavelength between about 400nm and about 10nm), etc. In some cases, as discussed in detail below, more than one entity can be used, i.e., chemically different or, for example, structurally different entities. However, in other cases, the entities can be chemically identical or at least substantially chemically identical.

[0226] In one set of embodiments, the signaling entity is "switchable", that is, the entity can be switched between two or more states, at least one of which emits light of a desired wavelength. In other states, the entity may not emit light, or emit light of different wavelengths. For example, the entity can be "activated" to a first state capable of producing light of a desired wavelength, and "deactivated" to a second state in which light of the same wavelength cannot be emitted. If the entity can be activated by incident light of a suitable wavelength, the entity is "photoactivated". As a non-limiting example, Cy5 can be switched between fluorescence and dark states in a controlled and reversible manner by light of different wavelengths, i.e., 633nm (or 642nm, 647nm, 656nm) red light can switch or deactivate Cy5 to a stable dark state, while 405nm green light can switch or activate Cy5 back to a fluorescent state. In some cases, an entity can be reversibly switched between two or more states, for example, when exposed to an appropriate stimulus. For example, a first stimulus (e.g., light of a first wavelength) can be used to activate a switchable entity, and a second stimulus (e.g., light of a second wavelength) can be used to deactivate a switchable entity, e.g., to a non-luminescent state. Any suitable method can be used to activate the entity. For example, in one embodiment, incident light of a suitable wavelength can be used to activate the entity to emit light, i.e., the entity is "photo-switchable". Therefore, a photo-switchable entity can be switched between different luminescent or non-luminescent states by, for example, incident light of different wavelengths. The light can be monochromatic (e.g., generated using a laser) or polychromatic. In another embodiment, the entity can be activated when stimulated by an electric field and / or a magnetic field. In other embodiments, the entity can be activated when exposed to a suitable chemical environment (e.g., by adjusting pH, or inducing a reversible chemical reaction involving the entity, etc.). Similarly, any suitable method can be used to inactivate the entity, and the methods for activating and deactivating the entity do not need to be the same. For example, the entity can be deactivated when exposed to incident light of a suitable wavelength, or the entity can be deactivated by waiting for a sufficient time.

[0227] Typically, one of ordinary skill in the art can identify a "switchable" entity by determining conditions under which the entity in the first state can emit light when exposed to an excitation wavelength, switching the entity from the first state to the second state (e.g., when exposed to light at a switching wavelength), and then showing that the entity in the second state is no longer able to emit light (or emits light at a greatly reduced intensity) when exposed to the excitation wavelength.

[0228] In one set of embodiments, as discussed, the switchable entity can be switched when exposed to light. In some cases, the light used to activate the switchable entity can come from an external source, for example, a light source such as a laser light source, another light emitting entity close to the switchable entity, etc. In some cases, the second light emitting entity can be a fluorescent entity, and in certain embodiments, the second light emitting entity itself can also be a switchable entity.

[0229] In some embodiments, the switchable entity includes a first luminescent moiety (e.g., a fluorophore) and a second moiety that activates or "switches" the first moiety. For example, upon exposure to light, the second moiety of the switchable entity can activate the first moiety, causing the first moiety to emit light. Examples of activator moieties include, but are not limited to, Alexa Fluor 405 (Invitrogen), Alexa Fluor 488 (Invitrogen), Cy2 (GE Healthcare), Cy3 (GE Healthcare), Cy3B (GE Healthcare), Cy3.5 (GE Healthcare), or other suitable dyes. Examples of luminescent moieties include, but are not limited to, Cy5, Cy5.5 (GE Healthcare), Cy7 (GE Healthcare), Alexa Fluor 647 (Invitrogen), Alexa Fluor 680 (Invitrogen), Alexa Fluor 700 (Invitrogen), Alexa Fluor 750 (Invitrogen), Alexa Fluor 790 (Invitrogen), DiD, DiR, YOYO-3 (Invitrogen), YO-PRO-3 (Invitrogen), TOT-3 (Invitrogen), TO-PRO-3 (Invitrogen), or other suitable dyes.These can be linked together, for example, covalently, e.g., directly or via a linker, to form compounds such as, but not limited to, Cy5-Alexa Fluor 405, Cy5-Alexa Fluor 488, Cy5-Cy2, Cy5-Cy3, Cy5-Cy3.5, Cy5.5-AlexaFluor 405, Cy5.5-Alexa Fluor 488, Cy5.5-Cy2, Cy5.5-Cy3, Cy5.5-Cy3.5, Cy7-AlexaFluor 405, Cy7-Alexa Fluor 488, Cy7-Cy2, Cy7-Cy3, Cy7-Cy3.5, Alexa Fluor 647-AlexaFluor 405, Alexa Fluor 647-Alexa Fluor 488, Alexa Fluor 647-Cy2, Alexa Fluor 647-Cy3, Alexa Fluor 647-Cy3.5, Alexa Fluor 750-Alexa Fluor 405, Alexa Fluor 750-Alexa Fluor 488, Alexa Fluor 750-Cy2, Alexa Fluor 750-Cy3, or Alexa Fluor 750-Cy3.5. Those of ordinary skill in the art know the structures of these and other compounds (many of which are commercially available). The moieties may be connected by covalent bonds or by joints such as those described in detail below. Other luminescent or activator moieties may include moieties having two quaternized nitrogen atoms connected by a polymethylene chain, wherein each nitrogen is independently a part of a heteroaromatic moiety such as pyrrole, imidazole, thiazole, pyridine, quinoline, indole, benzothiazole, etc., or a part of a non-aromatic amine. In some cases, there may be 5, 6, 7, 8, 9 or more carbon atoms between the two nitrogen atoms.

[0230] In some cases, when separated from each other, the luminescent portion and the activator portion can each be a fluorophore, i.e., an entity that can emit light of a certain emission wavelength when exposed to a stimulus (e.g., an excitation wavelength). However, when a switchable entity comprising a first fluorophore and a second fluorophore is formed, the first fluorophore forms a first luminescent portion, and the second fluorophore forms an activator portion that activates or "switches" the first portion in response to a stimulus. For example, the switchable entity may comprise a first fluorophore directly bonded to a second fluorophore, or the first and second entities may be connected via a joint or a common entity. Whether a pair of luminescent portions and activator portions produce a suitable switchable entity can be tested by methods known to those of ordinary skill in the art. For example, light of various wavelengths can be used to excite the pair of luminescent portions and activator portions, and the emitted light from the luminescent portions can be measured to determine whether the pair forms a suitable switch.

[0231] As a non-limiting example, Cy3 and Cy5 can be linked together to form such an entity. In this example, Cy3 is an activator portion that can activate Cy5 (the luminescent portion). Therefore, light at or near the absorption maximum of the activation or second portion of the entity (e.g., for Cy3, light close to 532nm) can cause the portion to activate the first luminescent portion, thereby causing the first portion to emit light (e.g., for Cy5, close to 647nm). See, for example, U.S. Patent No. 7,838,302, which is incorporated herein by reference in its entirety. In some cases, the first luminescent portion can be subsequently deactivated by any suitable technique (e.g., by directing 647nm red light to the Cy5 portion of the molecule).

[0232] Other non-limiting examples of potentially suitable activator moieties include 1,5IAEDANS, 1,8-ANS, 4-methylumbelliferone, 5-carboxy-2,7-dichlorofluorescein, 5-carboxyfluorescein (5-FAM), 5-carboxynaphthofluorescein, 5-carboxytetramethylrhodamine (5-TAMRA), 5-FAM (5-carboxyfluorescein), 5-HAT (hydroxytryptamine), 5-hydroxytryptamine (HAT), 5-ROX (carboxy-X-rhodamine), 5-TAMRA (5-carboxytetramethylrhodamine), 6-carboxyrhodamine 6G, 6-CR 6G, 6-JOE, 7-amino-4-methylcoumarin, 7-aminoactinomycin D (7-AAD), 7-hydroxy-4-methylcoumarin, 9-amino-6-chloro-2-methoxyacridine, ABQ, acid fuchsin, ACMA (9-amino-6-chloro-2-methoxyacridine), acridine orange, acridine red, acridine yellow, acridine flavin, acridine flavin Feulgen SITSA, Alexa Fluor 350, Alexa Fluor 405, Alexa Fluor 430, Alexa Fluor 488, Alexa Fluor 500, Alexa Fluor 514, Alexa Fluor 532, Alexa Fluor 546, Alexa Fluor 555, Alexa Fluor 568, Alexa Fluor 594, Alexa Fluor 610, Alexa Fluor 633, Alexa Fluor 635, Alizarin complex, Alizarin red, AMC, AMCA-S, AMCA (aminomethylcoumarin), AMCA-X, aminoactinomycin D, aminocoumarin, aminomethylcoumarin (AMCA), aniline blue, stearic acid anthracene, APTRA-BTC, APTS, astrazone brilliant red 4G, astrazone orange R, astrazone red 6B, astrazone yellow 7GLL, mepaline, ATTO390, ATTO 425, ATTO 465, ATTO 488, ATTO 495, ATTO 520, ATTO 532, ATTO 550, ATTO 565, ATTO 590, ATTO 594, ATTO 610, ATTO 611X, ATTO 620, ATTO 633, ATTO 635, ATTO 647, ATTO647N, ATTO 655, ATTO 680, ATTO 700, ATTO 725, ATTO 740, ATTO-TAG CBQCA, ATTO-TAG FQ, Auramine, Aurophosphine G, Aurophosphine, BAO 9 (diaminophenyloxadiazole), BCECF (high pH), BCECF (low pH), berberine sulfate, Bimane, Bis-benzamide, Bis-benzimide (Hoechst), Bis-BTC, BlancophorFFG,Blancophor SV, BOBO-1, BOBO-3, Bodipy 492 / 515, Bodipy 493 / 503, Bodipy 500 / 510, Bodipy 505 / 515, Bodipy 530 / 550, Bodipy 542 / 563, Bodipy 558 / 568, Bodipy 564 / 570, Bodipy 576 / 589, Bodipy 581 / 591, Bodipy 630 / 650-X, Bodipy 650 / 665-X, Bodipy 665 / 676, Bodipy Fl, Bodipy FL ATP, Bodipy Fl-ceramide, Bodipy R6G, Bodipy TMR, BodipyTMR-X conjugate, Bodipy TMR-X, SE, Bodipy TR, Bodipy TR ATP, Bodipy TR-X SE, BO-PRO-1, BO-PRO-3, Leucoflavin FF, BTC, BTC-5N, Calcein, Calcein Blue, Calcein Red, Calcein Green, Calcein Green-1Ca, 2+ Dye, Calcium Green-2Ca 2+ , Calcium Green-5N Ca 2+ , Calcium Green-C18 Ca 2+, calcium orange, fluorescent brightener, carboxy-X-rhodamine (5-ROX), Cascade Blue, Cascade Yellow, catecholamine, CCF 2 (GeneBlazer), CFDA, chromomycin A, chromomycin A, CL-NERF, CMFDA, coumarin phalloidin, CPM methylcoumarin, CTC, CTC methyl guanidine, Cy2, Cy3.1 8, Cy3.5, Cy3, Cy5.1 8, cyclic AMP fluoride sensor (FiCRhR), benzoyl, dansyl, dansylamide, dansylcadaverine, dansyl chloride, dansyl DHPE, dansyl fluoride, DAPI, Dapoxyl, Dapoxyl 2, Dapoxyl 3'DCFDA, DCFH (dichlorodihydrofluorescein diacetate), DDAO, DHR (dihydrorhodamine 123), Di-4-ANEPPS, Di-8-ANEPPS (non-ratiometric), DiA (4-Di-16-ASP), dichlorodihydrofluorescein diacetate (DCFH)), DiD-lipophilic tracer, DiD (DiIC18 (5)), DIDS, dihydrorhodamine 123 (DHR), DiI (DiIC18 (3)), dinitrophenol, DiO (DiOC18 (3)), DiR, DiR (DiIC18 (7)), DM-NERF (high pH), DNP, dopamine, DTAF, DY-630-NHS, DY-635-NHS, DyLight405, DyLight 488, DyLight 549, DyLight633, DyLight 649, DyLight680, DyLight 800, ELF 97, Eosin, Erythrosine, Erythrosine ITC, Ethidium Bromide, Ethidium Homodimer-1 (EthD-1), Euchrysin, EukoLight, Europium (III) Chloride, Fast Blue, FDA, Feulgen (p-nitroaniline), FIF (Formaldehyde Induced Fluorescence), FITC, Flazo Orange, Fluo-3, Fluo-4, Fluorescein (FITC), Fluorescein diacetate, Fluoro-Emerald, Fluoro-Gold (Hydroxystilbene), Fluor-Ruby, FluorX, FM1-43, FM 4-46, Fura Red (High pH), Fura Red / Fluo-3, Fura-2, Fura-2 / BCECF, Genacryl Brilliant Red B, Genacryl Brilliant Yellow 10GF, Genacryl Pink 3G, Genacryl Yellow 5GF, GeneBlazer (CCF2), Gloxalic Acid, Granular Blue, Hematoporphyrin, Hoechst 33258, Hoechst 33342, Hoechst34580, HPTS, Hydroxycoumarin, Hydroxystilbene (FluoroGold), Serotonin, Indo-1, High Calcium, Indo-1, Low Calcium, Indodicarbocyanine (DiD), Indotricarbocyanine (DiR), Intrawhite Cf, JC-1, JO-JO-1, JO-PRO-1, LaserPro, Laurodan, LDS 751 (DNA), LDS 751 (RNA), Leucophor PAF, Leucophor SF, Leucophor WS, Lissamine Rhodamine, Lissamine Rhodamine B, Calcein / Ethidium Homodimer, LOLO-1, LO-PRO-1, Lucifer Yellow, Lyso Tracer Blue, Lyso Tracer Blue-White, Lyso Tracer Green, Lyso Tracer Red, Lyso Tracer Yellow, LysoSensor Blue, LysoSensor Green, LysoSensor Yellow / Blue, Mag Green, Naphthalene Red (Root Bark Red B), Mag-Fura Red, Mag-Fura-2, Mag-Fura-5, Mag-Indo-1, Magnesium Green, Magnesium Orange, Peacock Green, Sea Blue, Maxilon Brilliant Yellow 10GFF, Maxilon Brilliant Yellow 8GFF, Merocyanin, Methoxycoumarin, Mitotracker Green FM, Mitotracker Orange, Mitotracker Red, Dinitromycin, Monobromomethane, Monobromomethane (mBBr-GSH), Monochlorobimane, MPS (Methyl Green Pyronitrile), NBD, NBD Amine, Nile Red, Nitrobenzoxadiazole, Norepinephrine, Nuclear Fast Red, Nuclear Yellow, Nylosan BrilliantIavin E8G, Oregon Green, Oregon Green 488-X, Oregon Green, Oregon Green 488, Oregon Green 500, Oregon Green 514, Pacific Blue, Feulgen, PBFI, Phloxin B (Magdala Red), Phorwite AR, Phorwite BKL, Phorwite Rev, Phorwite RPA, Phosphine 3R, PKH26 (Sigma), PKH67, PMIA, Pontochrome Blue Black, POPO-1, POPO-3, PO-PRO-1, PO-PRO-3, Primulin, Prosin Yellow, Propidium Iodide (PI), PyMPO, Pyrene, Pyronine, Pyronine B, Pyzel Brilliant Yellow 7GF, QSY 7. Resorufin, RH414, Rhod-2, Rhodamine, Rhodamine 110, Rhodamine 123, Rhodamine 5GLD, Rhodamine 6G, Rhodamine B, Rhodamine B200, Rhodamine B Extra, Rhodamine BB, Rhodamine BG, Rhodamine Green, Rhodamine Phallicidine, Rhodamine Phalloidin, Rhodamine Red, Rhodamine WT, Rose Bengal, S65A, S65C, S65L, S65T, SBFI, 5-HT, Swinney Brilliant Red 2B, Swinney Brilliant Red 4G, Swinney Brilliant Red B, Swinney Orange, Swinney Yellow L, SITS, SITS (Primrose Lin), SITS (Stilbene Isothiosulfonic Acid), SNAFL Calcein, SNAFL-1, SNAFL-2, SNARF Calcein, SNARF1, Sodium Green, SpectrumAqua, SpectrumGreen, SpectrumOrange, SpectrumRed, SPQ (6-methoxy-N-(3-sulfopropyl)quinoline), Stilbene, Sulforhodamine B can C, Sulforhodamine Extra, SYTO 11, SYTO 12. SYTO 13, SYTO14, SYTO 15, SYTO 16, SYTO 17, SYTO 18, SYTO 20, SYTO 21, SYTO 22, SYTO 23, SYTO 24, SYTO 25, SYTO 40, SYTO 41, SYTO 42, SYTO 43, SYTO 44, SYTO 45, SYTO 59. SYTO 60, SYTO 61, SYTO 62, SYTO 63, SYTO 64, SYTO 80, SYTO 81, SYTO 82, SYTO 83, SYTO 84, SYTO 85, SYTOX Blue, SYTOX Green, SYTOX Orange, Tetracycline, Tetramethylrhodamine (TAMRA), Texas Red, Texas Red-X-conjugate, Thiadiazole cyanine (DiSC3), Thiazide Red R, Thiazole Orange, Thioflavin 5, Thioflavin S, Thioflavin TCN, Thiolyte, Thiazole Orange, Tinopol CBS (fluorescent brightener), TMR, TO-PRO-1, TO-PRO-3, TO-PRO-5, TOTO-1, TOTO-3, TRITC (tetramethylisocyanate), True Blue, TruRed, Ultralite, Fluorescein sodium B, Uvitex SFC, WW 781, X-rhodamine, XRITC, xylene orange, Y66F, Y66H, Y66W, YO-PRO-1, YO-PRO-3, YOYO-1, YOYO-3, SYBR Green, thiazole orange (inter-chelating dyes), or a combination thereof.

[0233] In some aspects, nucleotides can be used to study samples, such as biological samples. For example, nucleotides can be used to measure nucleic acids in cells or other samples. Samples can include cell cultures, cell suspensions, biological tissues, biopsies, organisms, etc. Samples can also be cell-free, but still contain nucleic acids. If the sample contains cells, the cells can be human cells or any other suitable cells, such as mammalian cells, fish cells, insect cells, plant cells, etc. In some cases, more than one cell can be present.

[0234] The nucleic acid to be determined can be, for example, DNA, RNA, or other nucleic acids present in a cell (or other sample). The nucleic acid can be endogenous to the cell, or added to the cell. For example, the nucleic acid can be viral or artificially produced. In some cases, the nucleic acid to be determined can be expressed by the cell. In some embodiments, the nucleic acid is RNA. RNA can be coding and / or non-coding RNA. Non-limiting examples of RNA that can be studied in cells include mRNA, siRNA, rRNA, miRNA, tRNA, lncRNA, snoRNA, snRNA, exRNA, piRNA, etc. In some embodiments, for example, at least some of the multiple oligonucleotides are complementary to a portion of a specific chromosome sequence (e.g., a human chromosome).

[0235] In some cases, a significant portion of the nucleic acids in a cell can be studied. For example, in some cases, sufficient RNA present in a cell can be assayed to generate a partial or complete transcriptome of the cell. In some cases, at least 4 types of mRNA are assayed in a cell, and in some cases, at least 3, at least 4, at least 7, at least 8, at least 12, at least 14, at least 15, at least 16, at least 22, at least 30, at least 31, at least 32, at least 50, at least 63, at least 64, at least 72, at least 75, at least 100, at least 127, at least 128, at least 140, at least 255, at least 256, at least 500, at least 630, at least 640, at least 720, at least 750, at least 1000, at least 1270, at least 1280, at least 1400, at least 2550, at least 2560, at least 50 ... , at least 1,000, at least 1,500, at least 2,000, at least 2,500, at least 3,000, at least 4,000, at least 5,000, at least 7,500, at least 10,000, at least 12,000, at least 15,000, at least 20,000, at least 25,000, at least 30,000, at least 40,000, at least 50,000, at least 75,000 or at least 100,000 types of mRNA.

[0236] In some cases, the transcriptome of the cell can be determined. It should be understood that the transcriptome generally includes all RNA molecules produced in the cell, not just mRNA. Therefore, for example, the transcriptome can also include rRNA, tRNA, etc. In some embodiments, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or 100% of the transcriptome of the cell can be determined.

[0237] The determination of one or more nucleic acids in a cell or other sample can be qualitative and / or quantitative. In addition, the determination can also be spatial, for example, the position of the nucleic acid in a cell or other sample can be determined in two or three dimensions. In some embodiments, the position, quantity and / or concentration of the nucleic acid in a cell (or other sample) can be determined.

[0238] One non-limiting example of such a system can be found in U.S. Provisional Patent Application Serial No. 62 / 031,062, entitled “Systems and Methods for Determining Nucleic Acids,” filed by Zhuang et al. on July 30, 2014, which is incorporated herein by reference in its entirety.

[0239] The following documents are each incorporated herein by reference in their entirety: U.S. Patent No. 7,838,302, entitled “Sub-Diffraction Limit Image Resolution and Other Imaging Techniques,” issued by Zhuang et al. on November 23, 2010; U.S. Patent No. 8,564,792, entitled “Sub-diffraction Limit Image Resolution in Three Dimensions,” issued by Zhuang et al. on October 22, 2013; and International Patent Application Publication No. WO 2013 / 090360, entitled “High Resolution Dual-Objective Microscopy,” published by Zhuang et al. on June 20, 2013. In addition, incorporated by reference in their entirety are U.S. Provisional Patent Application Serial No. 62 / 031,062, entitled “Systems and Methods for Determining Nucleic Acids,” filed by Zhuang et al. on July 30, 2014; U.S. Provisional Patent Application Serial No. 62 / 050,636, entitled “Probe Library Construction,” filed by Zhuang et al. on September 15, 2014; U.S. Provisional Patent Application Serial No. 62 / 142,653, entitled “Systems and Methods for Determining Nucleic Acids,” filed by Zhuang et al. on April 3, 2015; and a PCT application entitled “Systems and Methods for Determining Nucleic Acids,” filed by Zhuang et al. on the same day as this application.

[0240] The following examples are intended to illustrate certain embodiments of the invention, but are not intended to illustrate the full scope of the invention. Example 1

[0241] This example illustrates the high-throughput hybridization construction of DNA probes according to certain embodiments of the present invention.

[0242] Overview. This protocol uses a complex library of oligonucleotides as a template for enzymatic construction of a large number of single-stranded DNA molecules, which can be chemically labeled and designed to hybridize to a specific set of nucleic acid targets that can vary significantly in complexity (i.e., the number of unique target sequences). The use of this protocol involves several basic steps: 1) computational design and optimization of a set of oligonucleotide sequences (which will be used as hybridization regions on the sample of interest); 2) computational design and optimization of a large number of short oligonucleotide sequences as highly specific PCR primers; 3) computational construction of template molecules; 4) synthesis of template molecules to produce a template library; 5) selection of a subset of in vitro template molecules from the template library by PCR; 6) amplification of in vitro template molecules based on in vitro transcription into RNA, which serves as the final template for hybridization probes; 7) reverse transcription of RNA back to DNA using chemically modified primers; 8) removal of RNA by alkaline hydrolysis; and 9) purification of chemically modified ssDNA molecules, which are referred to as probes in this example. These steps are discussed in detail below.

[0243] Construction of probes. Selection of hybridization regions. In this example, a large number of potential hybridization regions in the E. coli transcriptome were designed using the software OligoArray 2.0. In short, the software selects hybridization regions that are within the length and melting temperature range specified by the user. The software also screens for off-target hybridization and potential secondary structures. The software was used to generate hybridization regions with a length of 30-nt, a melting temperature range of 80-85°C, a GC content of 50-60%, and a secondary structure melting threshold and a cross-hybridization melting temperature of 75°C using all annotated transcribed mRNAs in E. coli (K-12mg1655; NC90013.2).

[0244] Design of hundreds of orthogonal primers. A general hybridization probe set may require much fewer unique sequences than those provided in a complex set of oligonucleotides (oligopool) that are usually produced by array-based synthesis. In order to utilize the difference in this complexity and significantly reduce the cost of each experiment, the present embodiment uses a method to embed a large number of unique template sets in a single oligonucleotide pool. In short, each template molecule is flanked by a pair of unique PCR primers that are shared by the template molecules of all probes in a given group. In order to facilitate embedding hundreds of unique probe template sets in a single oligonucleotide pool, a scheme for constructing hundreds of orthogonal PCR primers was created.

[0245] Specifically, the protocol first truncated members of an existing library of 240,000 semi-orthogonal 25-mer oligonucleotides to 20-nt length and selected oligonucleotides with optimal parameters for PCR: narrow range of predicted melting temperature (65-70°C) and GC content (50-60%); no consecutive runs of the same base (i.e., AAAA) longer than 4; and the presence of a 3' GC-clamp (i.e., 2-3G / C) within the final 5nt. BLAST was then performed with these optimized primers against all annotated RNAs in the E. coli transcriptome, as well as the T7 promoter (TAATACGACTCACTATAGGG) (SEQ ID NO. 1) and the common priming region (P9: CAGGCATCCGAGAGGTCTGG) (SEQ ID NO. 2) and potential primers with hits to transcriptomes with homology of 12-nt or longer or with hits of any length within 3-nt of the 3' end of the potential primer were removed. Finally, the remaining primers were screened for homology to each other using BLAST again. Any primers with homology longer than 11-nt or with any homology within 3-nt of the 3' end of another primer were removed. These cuts reduced the original 240,000 oligonucleotides to 198 highly optimized primers for the E. coli transcriptome. The final set of 198 primers is listed in Figure 3.

[0246] If desired, more primers can be generated using established techniques or by relaxing the stringency of the above cleavage to produce a larger initial oligonucleotide set. Finally, this method can also be generalized to the generation of optimal index primers for any organism by varying the transcriptome used for screening primers.

[0247] Template Construction. To design a template library for generating our probe sets, the desired RNA targets were first selected for simultaneous staining. A single template molecule was designed by connecting the following sequences: i) the first of two unique primers for the appropriate mRNA set, ii) the common primer P9, iii) a site for the nickase Nb.BsmI, iv) the reverse complement of the hybridization region with the target, v) the reverse complement of the nickase Nb.BsrDI, and vi) the reverse complement of the second unique primer for a given mRNA set. Figure 2 This organization is shown. Multiple probe template combinations were combined into large oligonucleotide pools and these pools were synthesized by CustomArray.

[0248] Figure 2Show the example template sequence containing probe, mRNA acnB.The underlined at the beginning is the sequence of the first primer, the common P9 priming site is not underlined, the Nb.BsmI site is underlined subsequently, the reverse complementary sequence of the hybridization zone for acnB is not underlined, the reverse complementary sequence of the Nb.BsrDI site is then underlined, and the last ununderlined part is the second unique primer.This template is used to produce probes to stain one of 736 templates of all mRNAs expressed with the copy number range of each cell 1-10 that are transcribed from the Escherichia coli genome locus corresponding to base pair 1-100kb.The sequence of 736 probes is referring to Fig. 4.

[0249] Index PCR. Templates for specific probe sets were selected from a complex oligonucleotide library by limited cycle PCR. 0.5 to 1 ng of the complex oligonucleotide library was combined with 0.5 micromoles of each primer. The forward primer matched the priming sequence of the desired subset, while the reverse primer was a 5'-connection of this sequence to the T7 promoter. In order to avoid the generation of G-quadruplexes that may be difficult to synthesize, the terminal G required in the T7 promoter was generated from the G located 5' of the priming region when appropriate. All primers were synthesized by IDT. A 50 microliter reaction volume was amplified using a KAPA real-time library amplification kit (KAPA Biosystems; KK2701) or by a homemade qPCR mixture containing 0.8X EvaGreen (Biotum; 31000-T) and a hot start Phusion polymerase (New England Biolabs; M0535S). Amplification was performed in real time using Agilent's MX300P or Biorad's CFX Connect. Individual samples were removed before the amplification plateau, usually at a concentration about 10-fold lower than that corresponding to the plateau, to minimize distortion of template abundance due to over-amplification. Individual templates were purified with columns according to the manufacturer's instructions (Zymo DNAClean and Concentrator; D4003) and eluted in deionized water without RNase.

[0250] Amplification by in vitro transcription. Then amplification template by in vitro transcription. In brief, 0.5 to 1 microgram of template DNA is amplified to 100 to 200 micrograms of RNA in a single 20-30 microliter reaction with high yield RNA polymerase (New England Biolabs; E2040S). The reaction is supplemented with 1X RNAse inhibitor (Promega RNasin; N2611). Amplification is usually carried out at 37°C for 2 to 4 hours to maximize yield. RNA is not purified after the reaction and is stored at -80°C or converted into DNA immediately as described below.

[0251] Reverse transcription. Use the reverse transcriptase Maxima H- (Thermo Scientific; EP0751) to generate 1-2 nmol of fluorescently labeled ssDNA probe from the above in vitro transcription reaction. This enzyme is used because it has high processivity and temperature resistance, which allows large amounts of RNA to be converted to DNA in a small volume at temperatures that are not conducive to the formation of secondary structures. 1.6 mM of each dNPT, 1-2 nmol of fluorescently labeled P9 primer, 300 units of Maxima H-, 60 units of RNasin and a final concentration of 1X Maxima RT buffer are supplemented with the unpurified RNA generated above. The final 75 microliter volume is incubated at 50°C for 60 minutes.

[0252] Strand selection and purification. The template RNA in the above reaction was then removed from the DNA by alkaline hydrolysis. 75 microliters of a solution of 0.25M EDTA and 0.5N NaOH was added to each reverse transcription reaction, and the samples were incubated at 95°C for 10 minutes. The reaction was immediately neutralized by purifying the ssDNA probe with a modified version of the Zymo Oligo Clean and Concentrator protocol. Specifically, the 5 microgram capacity column was appropriately replaced with a 100 microgram capacity DNA column. The rest of the protocol was performed according to the manufacturer's instructions. The probe was eluted in 100 microliters of RNase-free deionized water and evaporated in a vacuum concentrator. The final pellet was resuspended in 10 microliters of RNase-free water and stored at -20°C. Denaturing polyacrylimide gel electrophoresis and absorption spectroscopy showed that the protocol typically produced 90-100% of fluorescent primer incorporation into the full-length probe and 60-75% recovery of the total fluorescent probe. Therefore, under the situation that is no more than 150 microliters of reaction volume, this scheme can be used for producing~2nmol fluorescent probe.Small reaction volume is conducive to using high-throughput fluid handling technology, and significantly reduces the cost of this reaction compared with alternative methods.Therefore, 24-96 probes can and parallel construction, have minimum manual operation time, span two days, and final cost is every 2nmol each probe group about $14.

[0253] Although several embodiments of the present invention have been described and illustrated herein, a person of ordinary skill in the art will easily envision various other methods and / or structures for performing the functions and / or obtaining the results and / or one or more advantages described herein, and each of such changes and / or modifications is considered to be within the scope of the embodiments of the present invention described herein. More generally, it will be readily understood by those skilled in the art that all parameters, dimensions, materials and configurations described herein are intended to be exemplary and that actual parameters, dimensions, materials and / or configurations will depend on the specific application for which the teachings of the present invention are used. Those skilled in the art will recognize or be able to determine many equivalents of the specific embodiments of the present invention described herein (by using no more than routine experiments). Therefore, it should be understood that the aforementioned embodiments are presented only by way of example, and within the scope of the appended claims and their equivalents, embodiments of the present invention may be implemented in a manner different from that explicitly described and claimed. The present invention relates to various individual characteristics, systems, articles, materials, kits and / or methods described herein. In addition, if such characteristics, systems, articles, materials, kits and / or methods are not mutually contradictory, any combination of two or more such characteristics, systems, articles, materials, kits and / or methods is included within the scope of the invention of the present disclosure.

[0254] As defined and used herein, all definitions should be understood to control over dictionary definitions, definitions in documents incorporated by reference, and / or ordinary meanings of the defined terms.

[0255] The indefinite articles "a" and "an," as used herein in the specification and claims, should be understood to mean "at least one," unless explicitly indicated to the contrary.

[0256] The phrase "and / or", as used herein in the specification and claims, should be understood to mean "either or both" of the connected elements, i.e., the elements are present in combination in some cases and separately in other cases. Multiple elements listed with "and / or" should be interpreted in the same manner, i.e., "one or more" of the connected elements. In addition to the elements explicitly identified by the "and / or" clause, other elements may optionally be present, whether related or unrelated to those elements explicitly identified. Thus, as a non-limiting example, a reference to "A and / or B", when used in conjunction with an open-ended phrase such as "comprising", may refer to A only (optionally including elements other than B) in one embodiment; may refer to B only (optionally including elements other than A) in another embodiment; may refer to A and B (optionally including other elements) in another embodiment; and so on.

[0257] As used herein in the specification and claims, "or" should be understood to have the same meaning as "and / or" as defined above. For example, when separating items in a list, "or" or "and / or" should be understood to be inclusive, i.e., including at least one, but also including more than one of a plurality of elements or a list of elements, and optionally, including additional unlisted items. Only terms that clearly indicate the opposite, such as "only one of..." or "exactly one of..." or "consisting of..." when used in the claims will refer to the inclusion of exactly one element of a plurality of elements or a list of elements. Generally, the term "or" as used herein should be interpreted as indicating an exclusive selection (i.e., "one or the other but not two") only when it is crowned with an exclusive term such as "either", "one of...", "only one of..." or "exactly one of...". "Substantially consisting of...", when used in the claims, should have its ordinary meaning used in the field of patent law.

[0258] As used herein in the specification and claims, the phrase "at least one" with respect to a list of one or more elements should be understood to mean at least one element selected from any one or more elements in the list of elements, but not necessarily including at least one of each element explicitly listed in the list of elements and not excluding any combination of elements in the list of elements. This definition also allows for the optional presence of elements other than the elements explicitly identified in the list of elements to which the phrase "at least one" refers, whether related or unrelated to those explicitly identified elements. Thus, as a non-limiting example, "at least one of A and B" (or, equivalently, "at least one of A or B" or, equivalently, "at least one of A and / or B") may refer in one embodiment to at least one (optionally including more than one) A without B present (and optionally including elements other than B); in another embodiment to at least one (optionally including more than one) B without A present (and optionally including elements other than A); in another embodiment to at least one (optionally including more than one) A and at least one (optionally including more than one) B (and optionally including other elements); and so on.

[0259] It should also be understood that, unless explicitly stated to the contrary, in any method claimed herein that includes more than one step or act, the order of the steps or acts of the method are not necessarily limited to the order in which the steps or acts of the method are recited.

[0260] In the claims, as well as in the foregoing specification, all transitional phrases such as "comprising," "including," "carrying," "having," "containing," "possessing," "involving," "holding," "consisting of," and the like are to be construed as open-ended, i.e., meaning including, but not limited to, "consisting of." Only the transitional phrases "consisting of" and "consisting essentially of" shall be closed or semi-closed transitional phrases, respectively, as set forth in Section 2111.03 of the U.S. Patent Office Manual of Patent Examining Procedures.

Claims

1. A method comprising: amplifying at least some of the plurality of oligonucleotides using real-time PCR to produce amplified oligonucleotides; in vitro transcribing at least some of the amplified oligonucleotides to produce RNA; reverse transcribing the RNA to produce transcribed DNA; and The RNA is selectively degraded relative to the transcribed DNA.

2. The method of claim 1, wherein the plurality of oligonucleotides comprises at least 10 unique oligonucleotide sequences.

3. The method of any one of claims 1-2, wherein each of the unique oligonucleotide sequences comprises a first region that is identical among the unique oligonucleotide sequences and a second region that is different among the unique oligonucleotide sequences.

4. The method of claim 3, wherein each of said unique oligonucleotide sequences comprises a third region that is identical among said unique oligonucleotide sequences, wherein said second region separates said first region and said third region.

5. The method of any one of claims 1-4, wherein amplifying at least some of the plurality of oligonucleotides comprises exposing at least some of the plurality of oligonucleotides to a sequence comprising a primer.

6. The method of claim 5, wherein at least some of said primer-containing sequences further comprise a promoter, whereby said promoter is added to at least some of said amplified oligonucleotides.

7. The method of any one of claims 1-6, wherein at least some of the plurality of oligonucleotides comprises at least a first set of oligonucleotides having a first common index region and a second set of oligonucleotides having a second common index region distinguishable from the first common index region.

8. The method of claim 7, comprising amplifying said first set of oligonucleotides but not amplifying said second set of oligonucleotides.

9. The method of any one of claims 7 or 8, wherein the plurality of oligonucleotides comprises at least 2 sets of oligonucleotides having distinguishable common index regions.

10. The method of any one of claims 1-9, wherein amplifying at least some of the plurality of oligonucleotides comprises generating an amplified oligonucleotide comprising an oligonucleotide from the plurality of oligonucleotides and a promoter.

11. The method of any one of claims 1-10, wherein transcribing at least some of the amplified oligonucleotides comprises an amount of RNA that is at least 100 times the amount of amplified oligonucleotides.

12. The method of any one of claims 1-11, wherein transcribing at least some of the amplified oligonucleotides comprises exposing the amplified oligonucleotides to an RNA polymerase.

13. The method of any one of claims 1-12, wherein transcribing at least some of the amplified oligonucleotides to produce RNA comprises producing an average of at least 10 RNA copies per said amplified oligonucleotide.

14. The method of any one of claims 1 to 13, wherein the RNA is reverse transcribed to produce transcribed DNA without first purifying the RNA from components used to produce the RNA.

15. The method of any one of claims 1-14, wherein selectively degrading the RNA relative to the transcribed DNA comprises chemically reducing the RNA.

16. The method of any one of claims 1-15, wherein each oligonucleotide in the subset of oligonucleotides comprises the same index portion.

17. A method comprising: simultaneously amplifying at least some of the plurality of oligonucleotides in the common solution using PCR to produce amplified oligonucleotides; in vitro transcribing at least some of the amplified oligonucleotides to produce RNA; reverse transcribing the RNA to produce transcribed DNA; and The RNA is selectively degraded relative to the transcribed DNA.

18. The method of claim 17, wherein at least some of the plurality of oligonucleotides comprise at least a first set of oligonucleotides having a first common index region and a second set of oligonucleotides having a second common index region distinguishable from the first common index region.

19. The method of claim 18, comprising amplifying the first set of oligonucleotides but not amplifying the second set of oligonucleotides.

20. The method of any one of claims 17-19, wherein transcribing at least some of the amplified oligonucleotides comprises exposing the amplified oligonucleotides to an RNA polymerase.

Images