Single base mismatch detection method based on chain competition

Abstract

The invention discloses a single base mismatch detection method based on chain competition, and belongs to the field of in-vitro nucleic acid detection. Gene single base mismatch is recognized through a competitive DNA molecular hybridization technology, and a series of specific sequences are designed for a gene base mismatch area; a chain hybridization competitive reaction is carried out between the two chains and a to-be-detected chain / mismatched chain in a target area, and a hybridization complex can be formed when no mutation or mismatching condition exists; when mutation and mismatch exist, as the hybridization competitiveness of one party is sharply reduced, the phenomenon of separating from the complex can occur; in combination with a fluorescence resonance energy transfer (FRET) technology, different fluorescence signals can be generated under the two conditions, and whether a single-base mismatched gene exists in a to-be-detected chain or not is judged by comparing the fluorescence signals. The effectiveness of the method in single base mismatch detection is further verified through a non-denaturing polyacrylamide gel electrophoresis technology. The method for detecting single base mismatch has the advantages of high specificity, high sensitivity and rapid detection.

Description

Technical Field

[0001] The present invention belongs to the field of in vitro nucleic acid detection, and in particular relates to a single base mismatch detection method based on chain competition. Background Art

[0002] Single base mismatch is a variation of one base in the DNA sequence, which is often associated with a variety of genetic diseases, cancers and drug responses. Therefore, accurate and rapid detection of single base mismatch is crucial to understanding genetic variation and its relationship with disease.

[0003] Early single-base mismatch detection technologies include Sanger sequencing, PCR-RFLP analysis, and PCR technology. As one of the earliest sequencing technologies, Sanger sequencing has high accuracy, but high cost and slow processing speed. PCR-RFLP analysis relies on specific enzymes, so its sensitivity and specificity are limited. Although PCR can effectively amplify the target DNA sequence, its ability to detect single-base mismatches is also limited.

[0004] With the rapid development of genomics and high-throughput sequencing technology, single-base mismatch detection technology is also changing with each passing day. In recent years, a variety of emerging single-base mismatch detection technologies have emerged, such as high-throughput sequencing technology, nanopore sequencing technology and probe technology. High-throughput sequencing technology has the characteristics of high throughput, high resolution and high sensitivity, and can provide detailed genomic information to help researchers identify disease-related mutations. Nanopore sequencing technology can achieve higher sensitivity and specificity by improving the design of sensors and detection platforms. In addition, the use of high-precision fluorescent labeled probes can also quickly and accurately detect single-base variations in DNA. At the same time, the application of artificial intelligence and machine learning algorithms has also improved the efficiency and accuracy of data analysis, providing more possibilities for the detection of single-base mismatches.

[0005] Single-stranded DNA molecules form stable double strands through hydrogen bonds between base pairs, and this process is called DNA hybridization. As a DNA hybridization technology, chain hybridization competition is referred to as chain competition, and its principle is similar to the chain displacement principle. In the chain displacement process, by introducing a chain with stronger complementarity to the target sequence, the foot chain end mediates recognition and binding, and replaces one chain in the double-stranded structure. In chain competition, a partially complementary competitive binding DNA chain is introduced, which competes with the target sequence for binding, and finally reaches an intermediate equilibrium state of partial complementary binding to form a competitive complex.

[0006] As an efficient optical "molecular ruler", FRET can provide sensitive and specific detection methods in different application scenarios. It has a wide range of applications in nucleic acid detection, biomacromolecule interactions, non-invasive characterization of molecular structure and dynamics, and immunoassay. Summary of the invention

[0007] In order to solve the problems existing in the prior art, the present invention provides a single base mismatch detection method based on chain competition, in which the chain competition force is related to the complementarity of the introduced competitive DNA chain and the position of the base mismatch. By comparing the fluorescence spectra of the test chain system and the non-mismatch competition system, it is detected and determined whether there is a gene with a single base mismatch in the test chain.

[0008] The technical solution adopted by the present invention is:

[0009] A single-base mismatch detection method based on strand competition, wherein the single-stranded DNA to be tested hybridizes with the complementary strand through the recognition region, and hybridizes and competes with the competing strand in the competition region to form an intermediate complex; the competition reaction is characterized by fluorescent labeling and used for the determination of single-base mismatch; specifically, the following steps are included:

[0010] The complementary chain A is modified with a Cy5 fluorescent group, and the partially complementary chain D is modified with a Cy3 fluorescent group;

[0011] (1) After mixing the competitive chain E and the complementary chain A, the temperature is raised and lowered for hybridization to form a hybrid double-stranded chain AE;

[0012] (2) After mixing the test chain TM and the partially complementary chain D and other substances, the temperature is raised and lowered for hybridization to form the hybrid test chain TMD;

[0013] (3) After mixing the non-mismatched strand T and the partially complementary strand D, the temperature is raised and lowered for hybridization to form a hybrid non-mismatched double-stranded strand TD;

[0014] (4) Mixing the hybridized double-stranded AE with the hybridized test chain TMD and other substances to form a chain competition complex; after incubation at room temperature, detecting the fluorescence signal of the test complex system;

[0015] (5) Mix the hybridized double-stranded AE and the hybridized non-mismatched double-stranded TD to form a non-mismatched complex; after incubation at room temperature, detect the fluorescence signal of the non-mismatched complex system; compare the fluorescence signal of the non-mismatched complex system with the fluorescence signal of the complex system to be tested. If there is a difference between the two, it means that there is a single base mismatch on the chain to be tested.

[0016] The ratio of the number of nucleotides in the competition region of the competition chain and the end binding region of the foot chain is 10:8.

[0017] The nucleic acid sequence number of the complementary chain A is 1, and the nucleic acid sequence is: GAGAAGTAGGAGGA AGTGTAAGAGGTGTGAGT.

[0018] The nucleic acid sequence numbers of the competitive chain E are 3 to 5, the nucleic acid sequence of the nucleic acid sequence number 3 is: CTTACACTTCCTCCTACTTCTC; the nucleic acid sequence of the nucleic acid sequence number 4 is: CTCTTACACT TCCTCCTACTTCTC; the nucleic acid sequence of the nucleic acid sequence number 5 is: ACCTCTTACACT TCCTCCTACTTCTC.

[0019] Preferably, the nucleic acid sequence number of the competed chain E is 4, and the nucleic acid sequence of the nucleic acid sequence number 4 is: CTCTTACACT TCCTCCTACTTCTC.

[0020] The nucleic acid sequence number of the partially complementary chain D is 6, and the nucleic acid sequence of the nucleic acid sequence number 6 is: AGTGGAGTTGAGTG.

[0021] The nucleic acid sequence number of the non-mismatched chain T is 7, and the nucleic acid sequence number 7 is: CACTCAACTCCACTACTCACAC CTCTTACACT.

[0022] The temperature-regulating hybridization is carried out in a thermal cycler, and the temperature-regulating hybridization program is: 90°C, 5 min; 85°C, 3 min; 80°C, 3 min; 75°C, 3 min; 70°C, 3 min; 65°C, 3 min; 60°C, 3 min; 55°C, 3 min; 50°C, 3 min; 45°C, 3 min; 40°C, 3 min; 35°C, 3 min; 30°C, 3 min; 25°C, 3 min; 20°C, 5 min; and keep warm at 4°C.

[0023] The room temperature incubation time is 5 to 10 min.

[0024] By introducing a stable chain competition DNA molecular hybridization mechanism to achieve an efficient competition mode, a single base mismatch detection method based on chain competition is provided to solve the shortcomings of the single base mismatch detection in the prior art, such as long cycle and low accuracy, and to provide a new method for related nucleic acid detection.

[0025] On the one hand, the present invention designs a set of sequences and realizes an efficient competition mode by introducing a stable chain competition DNA molecule hybridization mechanism.

[0026] On the one hand, the present invention designs a set of sequences and realizes an efficient competition mode by introducing a stable chain competition DNA molecule hybridization mechanism.

[0027] The above nucleotide sequences are shown in Table 1.

[0028] Table 1: Nucleotide sequences of strand-competing DNA molecules for hybridization

[0029]

[0030] In the method of the present invention, the fluorescence resonance energy transfer (FRET) technology is combined to assemble and hybridize multiple sequences with the sequence to be tested, and the detection of single base mismatch is achieved by detecting the change in the fluorescence signal value of the detection system.

[0031] In practical applications, because disease genes are usually mutant genes, it is necessary to design a detection system for the mutant gene sequence so that the complementary chain and the mutant test chain are completely complementary and become part of the competition complex, thereby generating a positive signal in the test; on the contrary, there is a mismatch between the wild-type sequence and the complementary chain, and an effective chain competition reaction cannot occur to form a complex, and no obvious FRET signal will appear, so a negative result will be given in the test.

[0032] This method is based on the specific binding of fluorescent molecules to specific nucleic acid sequences, and detects mutations through changes in fluorescent signals. When the emission spectrum and absorption spectrum of the donor and acceptor fluorescent groups overlap to a certain extent, and the distance between the two groups is less than 10 nm, FRET can occur when excitation light is given to the donor fluorescent group to make it emit light. As two commonly used and relatively stable organic molecular fluorescent dyes, Cy3 and Cy5 can be used as donor fluorescent groups and acceptor fluorescent groups to label DNA molecules, respectively. By measuring the fluorescence spectrum and calculating the ratio of the fluorescence intensity at 667 nm to the fluorescence intensity at 565 nm, the interaction between the labeled DNA molecules can be reflected.

[0033] Compared with the prior art, the outstanding advantages and technical effects of the present invention are:

[0034] (1) Improving the sensitivity of single-base mismatch detection: Traditional detection methods have the problem of insufficient sensitivity when detecting single-base mismatches. By combining chain competition DNA molecular hybridization with FRET technology, the present invention aims to significantly improve the sensitivity of detection, thereby being able to detect genes with lower abundance.

[0035] (2) Overcoming background interference: In complex biological samples, background signals may interfere with the accuracy of single-base mismatch detection. The present invention reduces background interference by optimizing the design of chain competition DNA molecules, ensuring that the target signal is clearly discernible.

[0036] (3) Rapid detection: Existing single-base mismatch detection methods usually take a long time. The present invention simplifies the reaction process and increases the reaction rate to achieve rapid detection of single-base mismatches, thereby improving experimental efficiency.

[0037] (4) Improved detection specificity: The prior art has the problem of false positives caused by non-specific binding of nucleic acids. The present invention enhances the specificity of detection by precisely designing the competitive conditions of the chain competition DNA molecules, ensuring that only the single base mismatch that actually exists is detected.

[0038] (5) Expanding the scope of application: Existing technologies are often limited to specific sample types or experimental conditions. The present invention expands the scope of application of single-base mismatch detection technology based on chain competition by optimizing the method, and is applicable to biological samples of different sources and types.

[0039] In the present invention, DNA chain competition, with its high specificity and high sensitivity in single-base mismatch detection, can form a hybridization complex when there is no mutation or mismatch; when there is a mutation or mismatch, the hybridization competitiveness of one party drops sharply, resulting in the phenomenon of separation from the complex; combined with FRET technology, it jointly promotes the development of genomic research and clinical applications. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] Figure 1 Schematic diagram of the mechanism of chain displacement and chain competition reaction provided by the present invention.

[0041] Figure 2 Schematic diagram of the mechanism of detecting single base mismatch by strand competition combined with FRET technology provided by the present invention.

[0042] Figure 3 The fluorescence emission spectra of the single-base mismatch sequence system and the normal sequence system provided by the present invention.

[0043] Figure 4 This is the idea of ​​optimizing the sequence length of system E provided by the present invention and the result diagram of the fluorescence intensity ratio (667 nm / 565 nm).

[0044] Figure 5 This is the idea of ​​investigating the site of single-base mismatch in the T sequence of the system provided by the present invention and the result diagram of the fluorescence intensity ratio (667 nm / 565 nm).

[0045] Figure 6 The non-denaturing polyacrylamide gel electrophoresis diagram of the preferred system provided by the present invention. DETAILED DESCRIPTION

[0046] The technical solution of the present invention will be clearly and completely described below in conjunction with specific embodiments.

[0047] Example 1

[0048] This example provides a method for obtaining fluorescence emission spectra of a single base mismatch sequence system and a normal sequence system, and the steps include the following:

[0049] (1) Synthesize the sequences in Table 1 to obtain a set of EP tubes containing dry powders of these sequences respectively;

[0050] (2) Centrifuge the EP tubes containing the sequence powder at 4000 rpm for 1 min before opening the caps one by one, then slowly open the caps, add an appropriate amount of 100 μM storage solution prepared with nuclease-free water, cover the caps and vortex to mix, and finally store in a -20°C refrigerator for long-term use;

[0051] (3) Prepare TM buffer solution containing 10 mM magnesium chloride (MgCl 2 ) and 10 mM Tris-HCl, and the pH of the solution was adjusted to 8.0 in a nuclease-free aqueous solution;

[0052] (4) Take equal amounts of A and E10 and add TM buffer to make a 4 μM mixture;

[0053] (5) Prepare a 4 μM mixture of T and D, TM1 and D, respectively, in the same manner as above;

[0054] (6) Place the above AE10, TD, and TM1D mixed solution in a common PCR instrument and perform a temperature ramp program;

[0055] (7) Further, equal volumes of the AE10 and TD mixed solution after the above temperature rise and fall were taken, and nucleic acid buffer was added to prepare a 1 μM mixed solution;

[0056] (8) Prepare a 1 μM solution of AE10 and TM1D in the same manner as above;

[0057] (9) The two systems obtained in steps (7) and (8) are incubated at room temperature for 5 to 10 min, diluted to 0.1 μM using a buffer solution, and placed in a fluorescence detector to detect the fluorescence emission spectrum.

[0058] Figure 3 The fluorescence emission spectra of the above two systems are shown in Figure 1. The figure shows that the non-mismatched competitive chain system (T) and its single-base mismatched chain system (TM1) exhibit different fluorescence spectra, which indicates that this detection method can specifically distinguish sequences with single-base mismatches.

[0059] Example 2

[0060] Based on the method for obtaining the fluorescence emission spectra of the single-base mismatch sequence system and the normal sequence system provided in Example 1, this example provides an idea for optimizing the sequence length of system E (i.e., the length ratio of the orange competition region to the purple footchain end) and a method for obtaining the fluorescence result graph, the steps of which include the following:

[0061] (1) Based on the number of nucleotides in the competitive region where chain competition occurs, four sequences, E0, E8, E10, and E12, were specially designed to conduct the following research:

[0062] (2) Based on the steps in Example 1, AE0, AE8, AE10, AE12, TD and TM1D mixed solutions were prepared respectively, and the temperature was raised and lowered;

[0063] (3) Further, equal volumes of the above AE0 and TD mixture were taken and nucleic acid buffer was added to prepare a 1 μM mixture;

[0064] (4) Using the same procedure as above, prepare 1 μM mixed solutions of AE0 and TM1D, AE8 and TD, AE8 and TM1D, AE10 and TD, AE10 and TM1D, AE12 and TD, and AE12 and TM1D, respectively;

[0065] (5) The eight systems obtained in steps (3) and (4) were incubated at room temperature for 5 to 10 min, diluted to 0.1 μM using a buffer solution, and placed in a fluorescence detector to detect the fluorescence signal.

[0066] Figure 4 The idea of ​​optimizing the length of the sequence E in the above system and the fluorescence ratio result diagram. The result diagram shows that the difference between the two groups with and without mismatches in the single-base mismatch detection of the E10 system is the most obvious, so the sequence length of E10 is optimized.

[0067] Example 3

[0068] Based on the idea of ​​optimizing the length of the sequence E and the method for obtaining the fluorescence result graph provided in Example 2, this example provides a method for investigating the site of single-base mismatch in the sequence T and obtaining the fluorescence result graph, and the steps include the following:

[0069] (1) To investigate the effect of the position of mismatch on chain competition and detection, based on the T sequence of the gene to be tested, single base mismatches were set at different positions in the two key regions, the foot chain end and the competition region, to obtain three sequences, TM1, TM2 and TM3, and the following investigations were conducted:

[0070] (2) Based on the steps in Example 2, equal volumes of AE10 and TD mixture were taken and nucleic acid buffer was added to prepare a 1 μM mixture;

[0071] (3) Using the same procedure as above, prepare 1 μM mixed solutions of AE10 and TM1D, AE10 and TM2D, and AE10 and TM3D, respectively;

[0072] (5) The four systems obtained in steps (2) and (3) were incubated at room temperature for 5 to 10 min, diluted to 0.1 μM using a buffer solution, and the fluorescence signal was detected.

[0073] Figure 5 The following is the idea of ​​investigating the site of single base mismatch in the T sequence of the above system and the fluorescence ratio result diagram. The result diagram shows that the single base mismatch (TM1) at the end of the foot chain is easier to detect because it has the greatest impact on the chain competition binding; and the farther away from the foot chain end, the smaller its impact. Therefore, this test shows that this design has the best effect on detecting single base mismatches occurring in the foot chain end region.

[0074] Example 4

[0075] Based on Example 2 and Example 3, this example provides a method for obtaining a non-denaturing polyacrylamide gel electrophoresis pattern of a preferred system, and the steps include the following:

[0076] (1) Prepare a 15% non-denaturing polyacrylamide gel containing 30% acrylamide / methylenebisacrylamide solution, tetramethylethylenediamine, 10% ammonium persulfate, 1 M MgCl 2 , 10×TAE buffer and nuclease-free water. The proportion of each component is precisely calculated to achieve the best electrophoresis effect.

[0077] (2) Further, the mixed gel solution is poured into a leak-tested vertical electrophoresis tank mold, and a comb is installed to form a sample tank, and the gel is solidified at room temperature. This step ensures the stability and consistency of the gel structure, laying the foundation for the subsequent electrophoresis process.

[0078] (3) Furthermore, the comb on the gel was gently removed and sufficient 1×TAE buffer was added to the electrophoresis tank to ensure that the gel was completely covered with the buffer, thereby maintaining a stable electrophoresis environment.

[0079] (4) When loading the sample, first mix the DNA sample with an appropriate amount of loading buffer to ensure that the sample can be evenly and stably loaded into the gel. The loading buffer not only helps the sample sink to the bottom of the gel, but also provides visualization during the electrophoresis process, making it easy to observe the electrophoresis process in real time. Then carefully load the samples one by one into the sample slot of the gel to ensure that there is no mixing between each sample. The precise operation of this step is crucial to maintaining the independence of the samples and the accuracy of the electrophoresis results. In this example, for each electrophoresis channel, 10 μL of a sample solution with a concentration of 1 μM was mixed with 2 μL of loading buffer, and then 10 μL was taken for loading.

[0080] (5) Further, the electrodes of the electrophoresis tank are connected to a power source, and appropriate voltage and time parameters are set for electrophoresis. In this embodiment, the voltage is set to 120 V and the electrophoresis time is 2 hours and 30 minutes to achieve effective separation of DNA fragments.

[0081] (6) After electrophoresis, the gel is placed in a dye solution containing a dye for staining so that the distribution of DNA fragments can be more clearly observed. The staining process is carried out at room temperature for about 10 minutes to ensure that the dye fully penetrates the gel and binds to the DNA.

[0082] (7) Finally, use a gel imaging system (such as a UV transilluminator) to photograph the stained gel and obtain a gel electrophoresis image. By comparing the position and size of DNA markers or control samples, the position and distribution of DNA fragments in the gel can be accurately analyzed.

[0083] Figure 6 The non-denaturing polyacrylamide gel electrophoresis diagram of the optimal system clearly shows the verification of the chain competition force.

Claims

1. A single base mismatch detection method based on strand competition, characterized in that: The single-stranded DNA to be tested hybridizes with the complementary strand through the recognition region, and competes with the competitive strand in the competitive region to form an intermediate complex; the competitive reaction is characterized by fluorescent labeling and used for the determination of single-base mismatches; The specific steps include: The complementary chain A is modified with a Cy5 fluorescent group, and the partially complementary chain D is modified with a Cy3 fluorescent group; (1) After mixing the competitive chain E and the complementary chain A, the temperature is raised and lowered for hybridization to form a hybrid double-stranded chain AE; (2) After mixing the test chain TM and the partially complementary chain D and other substances, the temperature is raised and lowered for hybridization to form the hybrid test chain TMD; (3) After mixing the non-mismatched strand T and the partially complementary strand D, the temperature is raised and lowered for hybridization to form a hybrid non-mismatched double-stranded strand TD; (4) Mixing the hybridized double-stranded AE with the hybridized test chain TMD and other substances to form a chain competition complex; after incubation at room temperature, detecting the fluorescence signal of the test complex system; (5) Mix the hybridized double-stranded AE and the hybridized non-mismatched double-stranded TD to form a non-mismatched complex; after incubation at room temperature, detect the fluorescence signal of the non-mismatched complex system; compare the fluorescence signal of the non-mismatched complex system with the fluorescence signal of the complex system to be tested. If there is a difference between the two, it means that there is a single base mismatch on the chain to be tested.

2. A single base mismatch detection method based on strand competition according to claim 1, characterized in that: The ratio of the number of nucleotides in the competition region of the competition chain and the end binding region of the foot chain is 10:

8.

3. A single base mismatch detection method based on strand competition according to claim 1, characterized in that: The nucleic acid sequence number of the complementary chain A is 1, and the nucleic acid sequence is: GAGAAGTAGGAGGA AGTGTAAGAG GTGTGAGT.

4. The method for detecting single base mismatch based on strand competition according to claim 1, characterized in that: The nucleic acid sequence numbers of the competitive chain E are 3 to 5, the nucleic acid sequence of the nucleic acid sequence number 3 is: CTTACACT TCCTCCTACTTCTC; the nucleic acid sequence of the nucleic acid sequence number 4 is: CTCTTACACT TCCTCCTACTTCTC; the nucleic acid sequence of the nucleic acid sequence number 5 is: ACCTCTTACACT TCCTCCTACTTCTC.

5. A single base mismatch detection method based on strand competition according to claim 4, characterized in that: The nucleic acid sequence number of the competition chain E is 4, and the nucleic acid sequence of the nucleic acid sequence number 4 is: CTCTTACACT TCCTCCTACTTCTC.

6. A single base mismatch detection method based on strand competition according to claim 1, characterized in that: The nucleic acid sequence number of the partially complementary chain D is 6, and the nucleic acid sequence of the nucleic acid sequence number 6 is: AGTGGAGTTGAGTG.

7. The method for detecting single base mismatch based on strand competition according to claim 1, characterized in that: The nucleic acid sequence number of the non-mismatched chain T is 7, and the nucleic acid sequence of the nucleic acid sequence number 7 is: CACTCAACTCCACT ACTCACACCTCTTACACT.

8. The method for detecting single base mismatch based on strand competition according to claim 1, characterized in that: The temperature-regulating hybridization is carried out in a thermal cycler, and the temperature-regulating hybridization program is: 90°C, 5 min; 85°C, 3 min; 80°C, 3 min; 75°C, 3 min; 70°C, 3 min; 65°C, 3 min; 60°C, 3 min; 55°C, 3 min; 50°C, 3 min; 45°C, 3 min; 40°C, 3 min; 35°C, 3 min; 30°C, 3 min; 25°C, 3 min; 20°C, 5 min; and keep warm at 4°C.

9. The method for detecting single base mismatch based on strand competition according to claim 1, characterized in that: The room temperature incubation time is 5 to 10 min.

Images