Application of molecular marker related to piglet growth traits

Abstract

The invention discloses application of a molecular marker related to piglet growth traits, relates to the field of livestock breeding, and aims to provide an InDel marker based on a pig HNF4A gene and application of the InDel marker in early selection of the growth traits. By detecting the InDel marker in the first intron region of the HNF4A gene of the pig, the breeding speed of the improved variety of the pig is accelerated by utilizing molecular marker-assisted selection. The molecular marker corresponds to 20bp insertion / deletion polymorphic sites which exist between the version sequences Chr17: 46, 821, 377-46, 821 and 378bp of an international pig reference genome Sscrofa11.1. The molecular marker has the advantages that the molecular marker can be used for identifying the Sscrofa11.1, and the molecular marker can be used for identifying the Sscrofa11.1. The method can be used for accurately establishing live pig groups with high growth speed, so that the selective breeding process of live pig growth traits is accelerated.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology and livestock breeding, and specifically relates to a molecular marker, a detection technology and an application thereof for selecting fast-growing piglets. Background Art

[0002] The growth and development performance of piglets is one of the key factors affecting the economic benefits of the pig industry, and the continuous selection of growth traits is the focus of pig breeding. Compared with conventional breeding, genomic selection analyzes the genetic composition of individuals at the DNA level to achieve direct selection of genotypes, thereby improving the speed and accuracy of selection.

[0003] Hepatocyte nuclear factor 4alpha (HNF4A) is a member of the hepatocyte nuclear factor (HNF) family and is highly expressed in the liver, kidneys and intestines. HNF4A was originally isolated from rat liver nuclear extracts. Studies by Ceccarelli et al. have shown that HNF4A regulates liver lipid metabolism by binding to the apolipoprotein C3 (APOC3) promoter to regulate the expression of APOC3. Studies by Pan et al. have found that HNF4A can directly target Stearoyl-CoADesaturase 1 (SCD1) to regulate liver lipogenesis. Li et al. reported that knocking down the HNF4A gene in hepatocytes significantly reduced microsomal triglyceride transfer protein (MTTP), apolipoprotein B-100 (APOB100), acyl-CoA dehydrogenase long chain (ACADL) and other hepatocyte proteins, thereby affecting the secretion of very-low-density lipoprotein (VLDL) and disrupting the lipid homeostasis of hepatocytes. In addition, many scholars have reported the important role of HNF4A in the intestine. Klapper et al. showed that the HNF4A gene participates in intestinal fatty acid metabolism by binding to the promoter of human intestinal fatty acid binding protein 2 (hFABP2) and regulating the expression of hFABP2 gene. Chen et al. found that HNF4A accelerates fatty acid oxidation, promotes energy generation, and regulates intestinal stem cell self-renewal by activating fatty acid β-oxidation genes, including Acsl5 long-chain acyl-CoA synthetase family member 5 (Acsl5), Acyl-CoA synthetase family member 2 (Acsf2), Solute Carrier Family 27Member 2 (Slc27a2), Fatty Acid-Binding Protein 2 (Fabp2), and Hydroxyacyl-CoADehydrogenase (Hadh).Leng et al. reported that porcine HNF4A affects intestinal lipid absorption by regulating the transcription and expression of apolipoprotein A-IV (APOA IV) and APOCⅢ genes. Verardo et al. found through genome-wide association analysis (GWAS) that HNF4A is a key transcription factor affecting the meat quality of Yorkshire pigs, and affects meat quality by affecting genes such as adenylyl Cyclase 9 (ADCY9), CREB-Binding Protein (CREBBP), Tumor Necrosis Factor Receptor-Associated Protein 1 (TRAP1), Neuregulin1 (NRG1), Protein Kinase, AMP-Activated, Gamma3-Non-Catalytic Subunit (PRKAG3), Villin 1 (VIL1) and Insulin-like Growth Factor-Binding Protein 5 (IGFBP5). Dai et al. performed ATAC-seq on the duodenum tissues of pigs with high and low feed efficiency and found that HNF4A was enriched in the duodenum of pigs with high feed efficiency and affected feed efficiency by participating in lipid metabolism and energy metabolism. These studies show that HNF4A plays a key role in lipid metabolism and energy metabolism in the liver and intestine, thereby affecting the growth and development of piglets. Summary of the invention

[0004] The present invention provides a molecular marker related to the growth rate of piglets and a detection method thereof by searching for the genetic variation of the pig HNF4A gene, establishes a molecular marker-assisted breeding technology, and applies it to pig breeding.

[0005] The invention provides a 20bp In / Del mutation associated with the growth rate of piglets, wherein the mutation site is located in the first intron of the pig HNF4 gene (NM_001044571.1).

[0006] The method for obtaining a partial genomic fragment of the HNF4A gene, the specific steps are as follows:

[0007] (1) Obtaining genomic DNA of the pig to be tested;

[0008] (2) Using the above-mentioned pig genomic DNA as a template, the following primer pair was used for amplification to obtain a genomic fragment containing the HNF4A gene mutation site (NC_010459.5: 20 bp insertion or deletion);

[0009] HNF4A-1F: CCGATTAACCATTAACCC;

[0010] HNF4A-1R:AAGTCCCAAAGACACCCT.

[0011] Furthermore, the genomic fragment sequence of the HNF4A gene is shown in SEQ ID NO.2

[0012] CCGATTAACCATTAACCCCCACCCTCCCCGCAGAGCCTCCACCCCTTCGGAGGCTAGGCCAGGACTCCCGGCAGATCCTCCCAGAGGACGGTTGAAACCCAGGAAGGCAGAGGGGGCACCTGGGAGGAGGCAGTGGGAGGGCGGAGGGCGGGGGCCGGGGCTCGGCCCAGAGCCTTC GGGGTGGACATCCTGGGCAGGGCAAGTGGCCGACGTGTGGAGAGGGGAGGATGCGCCTCTCCAAAACCCTGGTCGACATGGACATGGCCGACTACAGTGCTGCGCTGGACCCAGCCTACACCACCCTGGAATTCGAGAATGTGCAGGTGTTGACCATGGGCAATGGTAGGTGGGGGCGGCC GTGTCCAGGGCGCGCCCGCTGGGGGCAGGTCTGCCCAGGGACGGGAGCGAGTCTGTGGCGCTCAGTTTGGGGCTGGGAGGAGAATGACAGACGAGCCCGGTGGTCCCATAGCTGAGCCCAGGTGTTGCCAGGAAAAGCAAATATGCCCAGGTAGGGTGACCCTGTTACCAAAGCTCTTCCCG CTCAGCCTGTGGGGGCGGGAAAGTGATGGTGAGCTTCCTCTTGGCGTCCTGCTCCAGGCATTGGCCCAACCTGGCCCCTTCCTGAACCCCTTAGGCCCAGGTGCTGAGAAATGGCAAGGTATGTCCTGTCCCCAGAGACGGTGGATGGAGCACAACTGTGTTTCAGGGTGTCTTTGGGACTT

[0013] (3) The amplified PCR product was sent to Shanghai Biotechnology Co., Ltd. for sequencing.

[0014] Furthermore, the 20 bp In / Del site is located at NC_010459.5. The "NC_010459.5" refers to the number of the genome sequence on chromosome 17 where the HNF4A gene is located.

[0015] The invention discloses an application of an In / Del molecular marker related to the weight and daily weight gain of piglets in early breeding of piglets.

[0016] Furthermore, the piglet breeds are Landrace, Duroc, Min pig and Jinhua pig.

[0017] The In / Del molecular marker associated with the weight and daily weight gain of piglets of the present invention is characterized in that the nucleotide sequence of the molecular marker is as shown in SEQ ID NO: 1, and a 20 bp deletion mutation exists between the 522nd and 523rd positions of the amplified sequence.

[0018] A primer pair for detecting molecular markers of the present invention, the sequence of the primer pair is as follows:

[0019] HNF4A-20bp insertion-F:GAATGACAGACGAGCCCG;

[0020] HNF4A-20bp insertion-R: CAGGACGCCAAGAGGAAG.

[0021] The application of the molecular marker of the present invention is the application of the molecular marker in pig breeding.

[0022] The pig breeding is the selection of pig growth traits.

[0023] Furthermore, the molecular marker is used in pig breeding to gradually reduce the BB individuals and increase the A allele frequency in the Min pig population; and further eliminate the AB and BB heterozygous individuals in the Landrace pig population and retain the AA genotype individuals.

[0024] Furthermore, the piglets are Landrace piglets and Minzhu piglets.

[0025] Further, the following steps are included:

[0026] (1) Obtaining genomic DNA of the pig to be tested;

[0027] (2) Using the above-mentioned porcine genomic DNA as a template, the following primer pair was used for amplification to obtain a fragment of the HNF4A gene containing a 20 bp In / Del marker;

[0028] HNF4A-20bp insertion-F:GAATGACAGACGAGCCCG;

[0029] HNF4A-20bp insertion-R: CAGGACGCCAAGAGGAAG.

[0030] (3) The PCR product obtained by amplification was tested for genotype by 2% agarose gel electrophoresis. Three genotypes appeared in total. The PCR product was 152 bp, which was recorded as AA genotype; the PCR product was 172 bp, which was recorded as BB genotype; and the PCR product with two bands was recorded as AB genotype (152 bp, 172 bp).

[0031] (4) The selected target piglets, namely, the molecular marker-assisted selection of fast-growing and fast-developing improved piglets based on the HNF4A gene is completed.

[0032] The present invention provides a molecular marker related to piglet growth traits and its application in breeding of Min pigs and Landrace pigs. The molecular marker is developed based on the In / Del mutation of 20bp of HNF4A gene. The method is achieved by detecting the genotype of the In / Del mutation (NC_010459.5: 20bp insertion) in the first intron region of the HNF4A gene in the pig genome. That is, in the process of individual genetic assessment, the genotype individuals with the 20bp insertion mutation (NC_010459.5: 20bp insertion) are selected, and the molecular marker-assisted selection for improving the growth and development ability of piglets is completed.

[0033] The present invention carries out population genetic parameter analysis on the polymorphism of 20bp In / Del marker (NC_010459.5: 20bp insertion), and finds that the frequency of A allele is significantly higher than that of B allele in the fast-growing Landrace and Duroc pig populations; while in the relatively slow-growing local breeds, Min pig and Jinhua pig populations, the frequency of B gene is significantly higher than that of A allele; indicating that the In / Del marker is related to the growth rate of Landrace, Duroc, Min pig and Jinhua pig.

[0034] The present invention conducts trait association analysis on the polymorphism of 20bp In / Del marker (NC_010459.5: 20bp insertion) in Landrace pig and Min pig populations, and explores the correlation between molecular markers and piglet weight and daily weight gain. Statistical analysis shows that in the Min pig population, the 14-day-old weight, 21-day-old weight, 28-day-old weight and 35-day-old weight of AB-type individuals are significantly higher than those of BB-type individuals (P<0.05); the average daily weight gain of AB-type individuals is extremely significantly higher than that of BB-type individuals (P<0.01). In the Landrace pig population, the 21-day-old weight and 28-day-old weight of AA-type individuals are significantly higher than those of AB-type individuals (P<0.05). In addition, the daily weight gain of AA-type individuals is higher than that of AB-type individuals (P=0.09). Therefore, in the Min pig population, the growth rate of the population can be increased by moderately increasing the frequency of the A allele; in the Landrace pig population, the BB-type individuals can be eliminated to further increase the growth rate of the Landrace pig.

[0035] The beneficial effects of the present invention include:

[0036] The present invention can perform genotyping and identification of the insertion / deletion polymorphic site of the pig HNF4A gene (between Chr17:46,821,377-46,821,378) through PCR amplification and agarose gel electrophoresis, and based on the results of the association analysis between the site and the growth traits of piglets, it is found for the first time that the pig HNF4A gene is significantly correlated with the growth traits of piglets, and provides a molecular marker for detecting and improving the growth rate of piglets and a detection method thereof. The detection method of the present invention is simple, rapid, and low-cost, and can be used for early and accurate screening of individuals with fast growth rates, thereby accelerating the genetic improvement of growth traits. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1 This is the electrophoresis diagram of the genomic fragment of the porcine HNF4A gene amplified by PCR; in the figure, lane M is the DL1000 marker, and lanes 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10 are the target bands;

[0038] Figure 2 The sequencing results of the 20 bp insertion marker in the first intron of the pig HNF4A gene; Figure A is an AA type individual, and Figure B is a BB type individual;

[0039] Figure 3 The figure is the result of agarose gel electrophoresis typing; among them, the M lane is DNA Marker DL500; to the left of the M lane, from right to left are different genotypes. DETAILED DESCRIPTION

[0040] In order to make the objectives, technical solutions and advantages of the embodiments of the present invention more clearly understood, the spirit of the contents disclosed by the present invention will be described in detail below. After understanding the embodiments of the contents of the present invention, any technician in the relevant technical field can change and modify them according to the techniques taught by the contents of the present invention without departing from the spirit and scope of the contents of the present invention.

[0041] The exemplary embodiments of the present invention and the description thereof are used to explain the present invention but are not intended to limit the present invention.

[0042] The beneficial effects of the present invention are verified by the following examples:

[0043] Example 1 PCR amplification combined with direct sequencing to analyze the genetic variation of pig HNF4A gene

[0044] 1. Genome extraction: Take pig ear tissue and extract genomic DNA using the conventional phenol-chloroform method.

[0045] 2. Primer design: The pig HNF4A gene information (NM_001044571.1) was queried through the NCBI database, and the first base of the first exon was taken as +1. The nucleotide sequences of 1000bp upstream and 1000bp downstream of the first exon were downloaded to design primers. The primer sequences are as follows:

[0046]

[0047] 3. PCR amplification: This implementation case uses conventional PCR to amplify the -65bp to 660bp fragment of the porcine HNF4A gene. The amplification system is: 100ng genomic DNA, 2×Taq Master Mix (Dye Plus) 25μL, 10pmol of upstream and downstream primers, and ddH2O to make up to 50μL. The amplification program is: 94℃ pre-denaturation for 5min; 94℃ denaturation for 30s, 57℃ annealing for 30s, 72℃ extension for 30s, 32 cycles; 72℃ final extension for 10min; 4℃ storage.

[0048] 4. Identification of genetic variation: Five individuals were selected from the Minzhu and Landrace piglets, and their genomic DNA was used as a template. PCR amplification was performed using primers HNF4A-1-F / R. 2ul of PCR product was subjected to agarose gel electrophoresis. After confirming that the band was single and bright, it was sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. DNAMAN software was used to perform multiple sequence alignment analysis on the sequencing results, and six SNPS and a 20bp insertion / deletion (In / Del) variation were detected in this region.

[0049] Example 2 PCR amplification polymorphism technology to detect the genetic structure of different pig breeds

[0050] 1. Establishment of genotyping technology:

[0051] A 20bp In / Del mutation was found in the first intron of the HNF4A gene. Primers HNF4A-2F / R were designed for this mutation. After agarose gel electrophoresis, the PCR product showed three band types. The PCR product was 152bp, recorded as AA genotype, the PCR product was 172bp, recorded as BB genotype, and the PCR product with two bands was recorded as AB genotype (152bp, 172bp).

[0052] 2 Primer design

[0053] Based on the above analysis, HNF4A genotyping primers containing InDel (NC_010459.5: 20 bp insertion) marker were designed, and the primer sequences are as follows:

[0054]

[0055] Note: HNF4A-2F is also known as HNF4A-20bp insertion-F, and HNF4A-2R is also known as HNF4A-20bp insertion-R.

[0056] 3 PCR amplification

[0057] The genomic DNA of Min pig and Changbai pig was used as templates, and PCR amplification was performed using primers HNF4A-2F / R. The total PCR amplification system was 10 μL, including 5 μL of 2×Taq Master Mix (Dye Plus), 0.4 μL of upstream and downstream primers, 0.5 μL of template DNA, and deionized water was added to 10 μL. The PCR amplification program was: 94℃ pre-denaturation for 5 min, 94℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 20 s, a total of 32 cycles, and finally 72℃ extension for 5 min.

[0058] 4 PCR polymorphism detection

[0059] Take the above PCR product and use 2% agarose gel electrophoresis to detect the genotype. Figure 3 As shown, there are three genotypes in total, among which the PCR product is 152bp, recorded as AA genotype; the PCR product is 172bp, recorded as BB genotype; and the PCR product with two bands is recorded as AB genotype (152bp, 172bp).

[0060] 5. Genotype and allele frequency analysis

[0061] In the Landrace, Duroc, Min and Jinhua pig populations, the gene frequency and genotype frequency of the 20bp In / Del marker were detected by PCR amplification and agarose gel electrophoresis. As shown in Table 1, in the Landrace pig population, there were 149 individuals with the AA genotype, with a genotype frequency of 0.931, 10 individuals with the AB genotype, with a genotype frequency of 0.062, and 1 individual with the BB genotype, with a genotype frequency of 0.006, an A allele frequency of 0.962, and a B allele frequency of 0.038; in the Duroc pig population, there were 225 individuals with the AA genotype, with a genotype frequency of 0.753, 67 individuals with the AB genotype, with a genotype frequency of 0.224, and 7 individuals with the BB genotype, with a genotype frequency of 0.023, and an A allele frequency of 0.86. 5, the B allele frequency is 0.135; in the Min pig population, there is 1 individual with AA genotype and genotype frequency of 0.006, 19 individuals with AB genotype and genotype frequency of 0.122, 136 individuals with BB genotype and genotype frequency of 0.872, A allele frequency of 0.067, B allele frequency of 0.933; in the Jinhua pig population, there are 10 individuals with AB genotype and genotype frequency of 0.115, 77 individuals with BB genotype and genotype frequency of 0.885, A allele frequency of 0.057, B allele frequency of 0.943. After long-term artificial breeding, the growth rate of Landrace pigs and Duroc pigs is significantly higher than that of local breeds Min pigs and Jinhua pigs. In Landrace pigs and Duroc pigs, A allele is the dominant allele; while Min pigs and Jinhua pigs are dominated by B allele.

[0062] Table 1 Genotype frequency and allele frequency of 20 bp insertion / deletion marker of porcine HNF4A gene in Landrace, Min pig, Duroc pig and Jinhua pig populations

[0063]

[0064] Example 3

[0065] Application of the molecular markers of the present invention in the growth and development association analysis of Min pigs and Landrace suckling piglets

[0066] The test population used in this example was from a breeding pig farm in Lanxi County, Heilongjiang Province. Landrace pigs and Min pigs born in the same period were used as research subjects, and the birth weight, 7-day weight, 14-day weight, 28-day weight, and 35-day weight of the piglets were recorded. The average daily weight gain during lactation was calculated using the following formula: average daily weight gain = (35-day weight - birth weight) / 35.

[0067] The PCR electrophoresis technique established in Example 2 was used to detect the genetic variation of the HNF4A gene in the Min pig and Landrace pig populations, and the correlation between the variation site and the weight and daily weight gain of suckling piglets was analyzed. The variance analysis was performed using the GLM program of SAS statistical software (SAS Institute Inc, Version 8.0), and the model used was:

[0068] Y ijk =μ+G i +M k+ e ijk

[0069] where Y ijk is the phenotypic value of the piglet trait; μ is the population mean; G i is the genotype; M k is the maternal effect, e ijk is the random residual.

[0070] Statistical analysis showed that in the Min pig population, the AB type individuals had significantly higher body weights at 14 days, 21 days, 28 days, and 35 days than the BB type individuals (P<0.05); the average daily weight gain of the AB type individuals was significantly higher than that of the BB type individuals (P<0.01) (Table 2). In the Landrace pig population, the AA type individuals had significantly higher body weights at 21 days and 28 days than the AB type individuals (P<0.05). The daily weight gain of the AA type individuals was higher than that of the AB type individuals (P=0.09) (Table 3). Therefore, in the Min pig population, the growth rate of the population can be increased by moderately increasing the frequency of the A allele; in the Landrace pig population, the growth rate of the Landrace pig can be further increased by reducing the frequency of the B allele.

[0071] Table 2 Association analysis between different genotypes of HNF4A gene and growth traits of Min pigs

[0072]

[0073] Note: Capital letters indicate extremely significant differences (P<0.01), and lowercase letters indicate significant differences (P<0.05).

[0074] Table 3 Association analysis between different genotypes of HNF4A gene and growth traits of Landrace pigs

[0075]

[0076]

[0077] Note: Capital letters indicate extremely significant differences (P<0.01), lowercase letters indicate significant differences (P<0.05). # P<0.1.

Claims

1. Application of a molecular marker related to piglet growth traits in pig breeding, characterized in that The molecular marker corresponds to the international pig reference genome Sscrofa11.1 version sequence Chr17: There is a 20bp In / Del site between 46,821,377-46,821,378bp, and the molecular marker nucleotide sequence is shown in SEQ ID NO.1 AGAGGCATCAGGGGGTGTCC.

2. The use according to claim 1, characterized in that The auxiliary breeding of fine pigs is achieved by detecting the In / Del marker in the first intron of the pig HNF4A gene through molecular markers.

3. The use according to claim 1, characterized in that The molecular markers related to the growth traits of piglets are related to the weight and daily weight gain of piglets.

4. The use according to claim 1, 2 or 3, characterized in that The pig breeds are Min pig, Landrace pig and Duroc pig.

5. The use according to claim 1, characterized in that The In / Del site is used to insert the A allele.

6. The use according to claim 1 or 2, characterized in that The auxiliary breeding of fine pigs is carried out in the following manner: Step 1: obtain the genomic fragment of the HNF4A gene containing the InDel site of the pig to be tested, perform PCR detection on the molecular markers related to the growth traits of the piglets in the region, and record the 152bp PCR product obtained by the detection as the AA genotype, that is, the A individual; the 172bp PCR product obtained is recorded as the BB genotype, that is, the B individual; and the 152bp and 172bp PCR products obtained at the same time are recorded as the AB genotype, that is, the heterozygous individual; Step 2: If the pigs to be tested are from a civilian pig population, eliminate the individuals of B and retain the individuals of A and heterozygous individuals; If the pigs to be tested are Landrace pigs, the heterozygous individuals and individuals of B are eliminated, and individuals of A are retained; Among them, the primer sequences required for PCR detection of molecular markers related to piglet growth traits in this region are as follows: HNF4A-20bp insertion-F:GAATGACAGACGAGCCCG; HNF4A-20bp insertion-R: CAGGACGCCAAGAGGAAG.

7. The use according to claim 6, characterized in that The genomic fragment of the HNF4A gene containing the InDel site of the pig to be tested is obtained by amplifying the genomic DNA of the pig to be tested using the following primer pair as a template; HNF4A-1F: CCGATTAACCATTAACCC; HNF4A-1R:AAGTCCCAAAGACACCCT.

8. The use according to claim 1, characterized in that The molecular marker is located between the 522nd and 523rd positions of the genome fragment of the HNF4A gene containing the InDel site.

9. A primer for detecting molecular markers related to piglet growth traits, characterized in that The primers are HNF4A-20bp insert-F: GAATGACAGACGAGCCCG; HNF4A-20bp insertion-R: CAGGACGCCAAGAGGAAG.

10. A kit comprising the primer according to claim 9.

Images