Indel marker EH-03-Indel-108 highly closely linked with corncob position and application of Indel marker EH-03-Indel-108

Abstract

The invention relates to the technical field of plant molecular breeding, in particular to an Indel marker EH-03-Internel-108 highly closely linked with a corn ear position and application of the Indel marker EH-03-Internel-108 highly closely linked with the corn ear position, and the marker is located in a specific region of a third chromosome of corn and is a 4bp insertion / deletion polymorphism marker. Through a specific primer pair, PCR (Polymerase Chain Reaction) amplification and agarose gel electrophoresis, the ear position haplotype can be judged according to a 216bp band. The molecular marker is widely applied to corn molecular marker-assisted breeding, and low-ear lodging-resistant varieties can be screened. Compared with the prior art, the method has the advantages that the corn ear height character can be accurately identified, the lodging-resistant variety breeding efficiency is improved, the operation is simple and convenient, the cost is low, the corn genetic improvement is promoted, the breeding material selectivity is enhanced, and the method has important theoretical and practical significance on the molecular mechanism research and genetic breeding improvement process of the corn ear height character.

Description

Technical Field

[0001] The present invention relates to the technical field of plant molecular breeding, in particular to an Indel marker EH-03-Indel-108 tightly linked to corn ear height and an application thereof. Background Art

[0002] Corn ear height is an important agronomic trait that affects plant lodging resistance, photosynthetic efficiency, and mechanized harvesting. Its genetic regulation involves multiple gene interactions and environmental factors and has long been a key goal of corn breeding. Currently, related research focuses on major gene cloning and gene editing technologies, but the following deficiencies remain:

[0003] 1. Limitations of Existing Gene Editing Technologies

[0004] Existing technologies, such as Chinese patent CN110862994B, disclose a method for reducing maize plant and ear height by mutating the ZKM76 gene using CRISPR / Cas9 technology. However, this method relies on complex processes such as gene editing vector construction, genetic transformation, and mutant screening, posing risks to transgenic biosafety and a long breeding cycle. Furthermore, this study only validated the function of a single gene. Ear height, as a typical quantitative trait, is controlled by multiple genes and small-effect QTLs. Relying solely on single-gene editing makes it difficult to fully capture genetic diversity, limiting its universal application in breeding.

[0005] 2. Technological gaps in molecular marker-assisted breeding

[0006] At present, there is a relative lack of research on molecular markers for corn ear height, especially there are few efficient molecular markers that are closely linked to ear height and can be used for early screening. Although Chinese patent CN110862994B has located the QTL interval related to plant height and ear height through GWAS, no targeted molecular markers have been developed, and most existing markers are based on SNPs (single nucleotide polymorphisms), which have the problems of high detection cost and low throughput. On the other hand, CN119144648A focuses on the corn yield-related gene ZmGG2 and does not involve the ear height trait, reflecting that there is still a gap in the research on specific molecular markers for ear height.

[0007] 3. Actual needs and technical bottlenecks of lodging resistance breeding

[0008] Ear height is directly related to lodging resistance, and reducing ear height is a key approach to improving lodging resistance in corn. However, traditional breeding relies on phenotypic screening, which is significantly affected by the environment and inefficient. Existing gene editing technologies, while precise, are limited by transgenic regulation, while molecular marker-assisted breeding (MAS) is limited in its application due to a lack of efficient markers. For example, existing indel (insertion / deletion) markers are often located in non-coding regions or are not tightly linked to the target trait, making accurate identification and early selection of ear height difficult. Summary of the Invention

[0009] The object of the present invention is to provide an Indel marker EH-03-Indel-108 tightly linked to corn ear height and its application, so as to solve the problems raised in the above background technology.

[0010] To achieve the above objectives, the present invention provides an Indel marker EH-03-Indel-108 that is tightly linked to corn ear height. The Indel marker is located in the Chr3:163961992-163963992 region of corn chromosome 3 and is a 4bp insertion / deletion polymorphism marker. The low-ear-position corn inbred line has a 4bp nucleotide sequence CCTG insertion at this site, while the high-ear-position corn inbred line has no insertion at this site.

[0011] Preferably, the primer pair for detecting the Indel marker polymorphism comprises:

[0012] Forward primer: 5'-CACCGAGGTGGGACTAAAAAG-3',

[0013] Reverse primer: 5′-TAGGAGAAGAGCAGGCAGGAG-3′;

[0014] The primer pair can specifically amplify a DNA fragment containing the Indel site, and the length of the amplified product is 216 bp (when the insertion sequence is included) or there is no corresponding band due to the lack of the insertion sequence.

[0015] Preferably, detecting the Indel marker PH-03-Indel-108 specifically comprises the following steps:

[0016] S1: Extract genomic DNA of maize inbred lines;

[0017] S2: Using the DNA from step S1 as a template, perform PCR amplification using the primer pair described above;

[0018] S3: Analyze the PCR product by agarose gel electrophoresis: if a 216 bp band appears and CCTG insertion is present, it is determined to be a low-ear position haplotype; if no 216 bp band exists and CCTG insertion is present, it is determined to be a high-ear position haplotype.

[0019] Preferably, the PCR amplification system is 20 μL and comprises:

[0020] DNA template 1 μL, 2×PCR Mix 10 μL, 10 μM forward primer 0.5 μL, 10 μM reverse primer 0.5 μL, ddH2O 8 μL;

[0021] The amplification program was as follows: pre-denaturation at 94°C for 30 s, followed by 34 cycles of denaturation at 98°C for 10 s → annealing at 62°C for 15 s → extension at 72°C for 10 s, and finally extension at 72°C for 5 min, followed by storage at 4°C.

[0022] On the other hand, the present invention also provides the use of the Indel marker PH-03-Indel-108 in maize molecular marker-assisted breeding, which is used to screen low-ear variety and lodging-resistant maize inbred lines.

[0023] Preferably, the genomic DNA of the maize inbred line to be tested is tested by the above-mentioned detection method. If a 216 bp band is detected, it is determined to carry a low-ear position haplotype and can be used as a target material for lodging resistance breeding.

[0024] Preferably, the breeding of low-ear corn varieties includes the following steps:

[0025] (1) using a maize inbred line carrying the low-ear haplotype of the Indel marker and containing CCTG insertion as a donor parent and hybridizing it with the target parent to obtain the F1 generation;

[0026] (2) Self-pollination or backcrossing of the F1 generation to construct a segregating population;

[0027] (3) using the above-mentioned detection method to screen individuals carrying the low-ear haplotype in the segregating population;

[0028] (4) Combine phenotypic identification and agronomic trait analysis to breed new corn varieties with low ear position and resistance to lodging.

[0029] Preferably, the reagents for detecting the corn ear height trait include a primer pair for detecting the Indel marker polymorphism, a DNA extraction reagent, a PCR reaction reagent and an agarose gel electrophoresis reagent.

[0030] Preferably, the DNA extraction reagent includes 1.5×CTAB buffer containing 0.2% mercaptoethanol, 24:1 chloroform / isoamyl alcohol, anhydrous ethanol, 75% ethanol and TE buffer; the PCR reaction reagent includes DNA polymerase, dNTPs and Mg2+ buffer system.

[0031] Preferably, the Indel marker PH-03-Indel-108 detects a 4bp insertion / deletion polymorphism in the Chr3:163961992-163963992 region of maize chromosome 3, thereby achieving early molecular identification of the maize ear height trait and significantly improving the breeding efficiency of lodging-resistant varieties.

[0032] Compared with the prior art, the present invention has the following beneficial effects:

[0033] 1. Accurately identify the ear height trait in maize: The indel marker EH-03-Indel-108 provided by this invention effectively distinguishes the ear height haplotypes of maize inbred lines. Through PCR amplification and agarose gel electrophoresis analysis, it is possible to quickly determine whether a maize inbred line carries a low ear height haplotype (containing a 4bp CCTG insertion) or a high ear height haplotype (without the insertion). This precise identification method provides important technical support for maize breeding.

[0034] 2. Improve the efficiency of breeding lodging-resistant varieties: Low-ear maize inbred lines have stronger lodging resistance and are more suitable for mechanized harvesting and high-density planting. Through molecular marker-assisted breeding, this invention can screen maize materials carrying low-ear haplotypes at an early stage, significantly shortening the breeding cycle and improving the efficiency of breeding lodging-resistant varieties.

[0035] 3. Easy operation and low cost: The detection method provided by the present invention has simple steps, requires conventional reagents and equipment, and is suitable for large-scale application. The identification of the ear height trait can be completed through conventional DNA extraction, PCR amplification and electrophoresis analysis, reducing breeding costs.

[0036] 4. Promoting corn genetic improvement: This invention not only provides important insights into the molecular mechanisms of corn ear height but also offers a reference for the development of molecular markers for other agronomic traits. By combining conventional breeding with molecular breeding techniques, the genetic improvement of corn can be further optimized.

[0037] 5. Enhanced selectivity of breeding materials: By using the Indel markers of the present invention, breeders can screen maize inbred lines with ideal ear height at an early stage, avoiding the limitations of traditional breeding that requires reliance on phenotypic selection and improving the accuracy and efficiency of selection.

[0038] In summary, the present invention can perform good typing of corn cob height and detect differences in Indel polymorphisms; the corn cob height trait Indel marker provided by the present invention can be used for molecular marker-assisted breeding of corn cob height traits, and has important theoretical and practical guiding significance for accelerating the genetic selection and improvement process of corn varieties; the purpose of the present invention is to locate the functional sites of corn cob height-related genes and develop Indel-specific markers for identifying corn cob height based on site sequence information; corn cob height can be predicted by the molecular marker, providing molecular-assisted technical support for the early identification and screening breeding of corn cob height traits. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] The accompanying drawings are used to provide a further understanding of the present invention and constitute a part of the specification. Together with the embodiments of the present invention, they provide further detailed explanation, but do not constitute a limitation of the present invention.

[0040] Figure 1 is the normal distribution diagram of ear height trait;

[0041] Figure 2 Chromosome distribution map of SNP markers;

[0042] Figure 3 QQ plot and Manhattan plot for genome-wide association analysis of maize ear height;

[0043] Figure 4 To analyze the allelic variation effect of important SNP sites related to ear height;

[0044] Figure 5 Partial results of Sanger sequencing alignment of 249 maize candidate genes;

[0045] Figure 6 The electrophoresis diagram of PCR products of 200 maize inbred lines with internal reference primers;

[0046] Figure 7 This is the electrophoresis gel image of PCR products of ear height primers of 200 maize inbred lines;

[0047] Figure 8 This is the statistical table of the electrophoresis results of PCR products of maize endogenous gene IVR primers and ear height Indel molecular markers;

[0048] Figure 9 This is a statistical table of the results of spike-site polymer marker electrophoresis verification. DETAILED DESCRIPTION

[0049] The following will provide a clear and complete description of the technical solutions in the embodiments of the present invention in conjunction with the embodiments of the present invention and the accompanying drawings. Obviously, the embodiments described are only some embodiments of the present invention, not all embodiments. All other embodiments obtained by ordinary technicians in this field based on the embodiments of the present invention without making any creative efforts shall fall within the scope of protection of the present invention.

[0050] The Indel marker EH-03-Indel-108, which is tightly linked to the ear height of corn, is located in the Chr3:163961992-163963992 region of chromosome 3 of corn. It is a 4bp insertion / deletion polymorphism marker. The low-ear-position corn inbred line has a 4bp nucleotide sequence CCTG insertion at this site, while the high-ear-position corn inbred line has no insertion at this site.

[0051] The present invention provides 1149 phenotypically diverse and representative DH lines selected from 5572 corn DH lines, which were planted in the experimental field of Guangxing Village, Yangshu Street, Acheng District, Harbin City, Heilongjiang Province (126°53′8.73″E, 45°29′39.88″N) in 2023 and 2024, respectively. Each material was planted in 2 rows with a row length of 2.5 m. The main 21 agronomic traits and yield traits were investigated according to the standards, and the data of traits such as ear height were recorded and sorted. After the simplified genome resequencing of each material was completed, the reference genome was aligned and spliced to obtain SNP polymorphism markers. According to the association analysis of the ear height trait data, the associated main effect SNP was obtained, and the haplotype analysis of the main effect SNP was performed. Based on field phenotypes, 150 varieties of each of two types of maize inbred line materials, high ear height (greater than 86.6CM) and low ear height (less than 67.9CM), were selected. Sanger sequencing was used to verify the major effect SNP polymorphism and obtain Indel markers in the sequence. PCR primers were designed based on Indel markers, and PCR and agarose gel electrophoresis bands were used to distinguish the high ear height haplotypes of maize inbred lines.

[0052] Example 1: Investigation of ear height traits and phenotypic data analysis of maize inbred lines

[0053] 1,149 high-quality maize inbred lines, selected over the past 15 years and provided by the Shenzhen Genomics Center of the Chinese Academy of Agricultural Sciences, were grown under field conditions in the Acheng district of Harbin, Heilongjiang Province, in 2023 and 2024. A randomized block design was used, with two rows of each variety planted, each 3 m long, with a row spacing of 0.65 m and a plant spacing of 0.2 m. Fertilization and watering were the same as for conventional field management. Ear height was measured at maturity, excluding the first plant in each row. Five representative plants of each variety were selected to measure the distance from the ground to the cob. Data on traits such as ear height were recorded and compiled. Phenotypic data from the two environments were statistically analyzed using Microsoft Excel 2022 and IBM SPSS Statistics V27.0. Normal distribution was assessed based on the coefficient of variation, skewness, and kurtosis. Finally, frequency distribution histograms were plotted using Origin 2021 software to test for normal distribution of the phenotypic data. Statistical analysis of corn ear height showed that the mean values under the two environments ranged from 82.93 to 86.36 cm, the phenotypic variation ranged from 21.00 to 174.00 cm, and the coefficient of variation was 17.86% to 24.58%. The coefficient of variation in each environment exceeded 15%, indicating that the corn inbred line population had a relatively rich phenotypic variation in ear height. The absolute values of the skewness and kurtosis of the ear height trait were both less than 1, and the data distribution curve conformed to the normal distribution, indicating that the ear height data conformed to the quantitative trait characteristics (such as Figure 1 The R language lme4 package was used to analyze the phenotypic data of maize ear height trait and estimate the broad-sense heritability of each influencing factor. The heritability of ear height was 85%, indicating that it was mainly affected by genetic factors.

[0054] Example 2: Extraction of maize genomic DNA and library construction and sequencing

[0055] For the maize inbred line materials in Example 1, the specific library construction method is as follows:

[0056] (1) Weigh 1.0 g of fresh leaves, chop them into small pieces, place them in a mortar, grind them with liquid nitrogen, add 3 mL of 1.5× CTAB, grind them into a homogenous slurry, and transfer them to a 15 mL centrifuge tube. Then, add 1 mL of 1.5× CTAB to the mortar to rinse and transfer them to the centrifuge tube. After mixing, place them in a 65°C water bath for 30 min, shaking them gently occasionally.

[0057] The formula of 1.5×CTAB is as follows (1L):

[0058] CTAB 15g 1 mol / L Tris.Cl (EH is 8.0) 75mL 0.5 mol / L EDTA 30mL NaCl 61.4g

[0059] Deionized water was added to make up to 1 L, and mercaptoethanol was added to a final concentration of 0.2% (2 ml) before use.

[0060] (2) After cooling to room temperature, add an equal volume of chloroform / isoamyl alcohol (24:1) and mix gently until the lower layer turns dark green.

[0061] (3) Centrifuge at 4200 rpm for 10 min. Transfer the upper aqueous phase to a new 15 mL centrifuge tube, add 2 volumes of pre-cooled anhydrous ethanol, mix and let stand for 5 min. Place at -20°C for 30 min to precipitate DNA.

[0062] (4) Centrifuge at 4200 rpm for 10 min, discard the supernatant, add 1 mL of 75% ethanol to wash the precipitate once, invert the centrifuge tube to dry the DNA, and add 50 μL of TE to dissolve the DNA.

[0063] (5) Detect the DNA concentration and adjust it to 20 ng / ul with water.

[0064] (6) FBI-seq method for library construction (Zhao et al, 2023)

[0065] Example 3: GWAS analysis of corn ear height to obtain significant SNPs and candidate genes

[0066] All offline sequencing data were processed and analyzed using high-performance computer servers. Raw data processing: The raw PE (Pair-end) sequencing data were quality assessed using FastQC and then quality controlled using BWA. The sequencing reads were aligned to the reference genome (B73v4), and SNP detection was performed using GATK. After quality control filtering at the sample level and variation level, 57,849 high-quality SNP markers (minimum allele frequency > 0.05, missing data < 20%) were screened out to ensure the accuracy and reliability of the analysis results. In order to better understand the population structure and genetic background, an evolutionary tree was constructed using iqTree software, principal component analysis (PCA) was performed on the whole-genome SNP data using Plaink software, and population structure analysis was performed using Faststructure software to clarify the genetic structure within the population. The high-quality SNPs screened in the early stage were used to perform genome-wide association analysis on the ear height trait and its BLUP value. The association analysis between SNP markers and various traits was performed using a mixed linear model of genotype + phenotype + population structure + kinship matrix in GEMMA. All SNPs that met p < 1.7286e-4 were extracted from the GWAS result file using awk and converted into a BED format file (Chr, Start, End). Based on the two-year GWAS analysis of the ear height trait data, two major effect SNPs related to it were obtained, located in Chr3: 163961992-163963992. The bedtools intersect tool was used to compare the significant SNPs and their upstream and downstream 100kb regions with the B73 RefGen_v4 GFF gene annotation file to screen candidate genes. The results are shown in Figure 2 and Figure 3 .

[0067] Example 4: Association analysis of candidate genes for maize ear height and indel marker mining

[0068] Based on field phenotypes, 150 varieties of each of two maize inbred lines (high-ear height (greater than 86.6 cm) and low-ear height (less than 67.9 cm)) and maize cultivar B73 were selected. Leaf genomic DNA was extracted using the CTAB method. Full-length sequences of candidate genes (including the 5' UTR, 3' UTR, and exon sequences) were amplified and subsequently sequenced by Sanger sequencing for haplotype analysis. DNA sequences were amplified using a segmented amplification method. Primers were designed using the free online primer design tool NCBI and synthesized by Shenzhen Sangon Biotechnology Co., Ltd. The amplification and sequencing primers are as follows:

[0069] Primer name Forward primer (5' to 3') Reverse primer (5' to 3') 1 GTGCTATACCCAAGCCGCG ATCAAGGTCGCCCACGAGAAC 2 AGGGATTTGGTGTGCTGGAAC CTGCTTGTGCTTGAGCTGGAA

[0070] The sequences obtained were submitted to Snapgene software for multiple sequence alignment. SNP sites with missing values greater than 20% and minor allele frequency (MAF) ≤ 5% were removed to verify the authenticity of the SNP variant site. At the same time, an indel marker was mined. Single gene association analysis was then performed using Tassel software. Haploview software was used to output the haplotype typing results in nex format containing only polymorphic sites (including indels) and to draw LDblock diagrams. Excel software was used to calculate the distribution of each haplotype in different subpopulations and Origin software was used for data visualization. The results are shown in the figure. Figure 4 and Figure 5 .

[0071] Example 5: Development and validation of high-level Indel markers in maize ears

[0072] Based on candidate gene association analysis results, we screened for indel variants that could differentiate ear height traits in different maize inbred lines. We then developed molecular markers for these sites that could rapidly identify the two haplotypes.

[0073] The details are as follows:

[0074] (1) DNA from 249 maize inbred lines sequenced by Sanger sequencing was extracted using the CTAB method;

[0075] (2) Primer design and selection of internal reference primers:

[0076] Design of Indel primers for ear height: Select a 17-25bp sequence in the conserved region upstream of the Indel site as the upstream primer, and design a downstream primer at the Indel site. The Indel site is completely linked to the ear height trait, so the presence or absence of the PCR product can be preliminarily judged based on whether the primer is linked to the corn ear height trait, and then the accuracy of the molecular marker can be judged based on the actual results. The ear height primer design includes Indel, so corn inbred lines that contain Indel can produce PCR products, and corn inbred lines that do not contain Indel will not produce PCR products. Indel primers EH-03-Indel-108F: 5'-CACCGAGGTGGGACTAAAAAG-3', EH-03-Indel-108R: 5'--3'; the corn universal primer IVR was selected as the internal reference, and the product length is 226bp;

[0077] IVR primer IVR-F: 5′-TAGGAGAAGAGCAGGCAGGAG-3′;

[0078] IVR-R: 5'-GGAGCCCGTGTAGAGCATGACGATC-3'; as shown in the following table:

[0079]

[0080] (3) Perform PCR amplification using the designed primers. The PCR system is as follows:

[0081] Components Volume (20ul) Mix 10 DNA template 1 Primer-F 0.5 Primer-R 0.5 ddH2O 8

[0082] The PCR reaction program was as follows: pre-denaturation at 94°C for 30 seconds, 34 cycles of denaturation at 98°C for 10 seconds, annealing at 62°C for 15 seconds, extension at 72°C for 10 seconds, extension at 72°C for 5 minutes, and storage at 4°C.

[0083] (4) 1.5% agarose gel electrophoresis was used to detect the presence of amplification products of each material. The results are shown in Figure 6 .and Figure 7 ..

[0084] (5) Record the presence or absence of the product based on the gel image, and then judge the accuracy of the marking. The results are shown in Figure 9 .

[0085] Primers EH-03-Indel-108 designed based on the InDel mutation site were used to amplify 200 maize inbred lines. The PCR products with bands were recorded as C, those without bands were recorded as D, and the internal reference primer band was recorded as B ( Figure 6 and Figure 7 ). The PCR product results were analyzed and it was found that for the internal reference primer IVR, all 200 maize inbred line materials had bands, indicating that the extracted maize DNA met the PCR requirements ( Figure 6 ); For the EH-03-Indel-108 primer, 47 of the 49 Hap2 samples from the 200 maize inbred lines showed a 216 bp band in the molecular marker electrophoresis results, 2 showed no 216 bp band in the molecular marker electrophoresis results, and 151 Hap1 samples showed no 216 bp band in the molecular marker electrophoresis results, with a marker accuracy rate of 95.92% ( Figure 7 and Figure 9 ).

[0086] The Indel marker EH-03-Indel-108 tightly linked to corn ear height of the present invention and its beneficial effects are as follows:

[0087] 1. Accurately identify the ear height trait in maize: The indel marker EH-03-Indel-108 provided by this invention effectively distinguishes the ear height haplotypes of maize inbred lines. Through PCR amplification and agarose gel electrophoresis analysis, it is possible to quickly determine whether a maize inbred line carries a low ear height haplotype (containing a 4bp CCTG insertion) or a high ear height haplotype (without the insertion). This precise identification method provides important technical support for maize breeding.

[0088] 2. Improve the efficiency of breeding lodging-resistant varieties: Low-ear maize inbred lines have stronger lodging resistance and are more suitable for mechanized harvesting and high-density planting. Through molecular marker-assisted breeding, this invention can screen maize materials carrying low-ear haplotypes at an early stage, significantly shortening the breeding cycle and improving the efficiency of breeding lodging-resistant varieties.

[0089] 3. Easy operation and low cost: The detection method provided by the present invention has simple steps, requires conventional reagents and equipment, and is suitable for large-scale application. The identification of the ear height trait can be completed through conventional DNA extraction, PCR amplification and electrophoresis analysis, reducing breeding costs.

[0090] 4. Promoting corn genetic improvement: This invention not only provides important insights into the molecular mechanisms of corn ear height but also offers a reference for the development of molecular markers for other agronomic traits. By combining conventional breeding with molecular breeding techniques, the genetic improvement of corn can be further optimized.

[0091] 5. Enhanced selectivity of breeding materials: By using the Indel markers of the present invention, breeders can screen maize inbred lines with ideal ear height at an early stage, avoiding the limitations of traditional breeding that requires reliance on phenotypic selection and improving the accuracy and efficiency of selection.

[0092] The present invention relates to specific primers that can effectively genotype corn ear height and detect differences in indel polymorphisms. The corn ear height trait indel markers provided by the present invention can be used in molecular marker-assisted breeding for corn ear height, and have important theoretical and practical guiding significance for accelerating the genetic selection and improvement of corn varieties.

[0093] The purpose of this invention is to locate the functional loci of genes associated with maize ear height and, based on the sequence information at these loci, develop indel-specific markers for identifying maize ear height. This molecular marker can be used to predict maize ear height, providing molecular-assisted technology support for early identification and screening breeding of maize ear height traits.

[0094] The basic principles, main features, and advantages of the present invention are shown and described above. It should be understood by those skilled in the art that the present invention is not limited to the above-described embodiments. The above-described embodiments and descriptions are merely preferred examples of the present invention and are not intended to limit the present invention. Various changes and modifications may be made to the present invention without departing from the spirit and scope of the present invention, and such changes and modifications fall within the scope of the invention claimed.

Claims

1. An Indel marker EH-03-Indel-108 tightly linked to corn ear height, characterized in that The Indel marker is located in the Chr3:163961992-163963992 region of corn chromosome 3 and is a 4bp insertion / deletion polymorphism marker. The low-ear position corn inbred line has a 4bp nucleotide sequence CCTG insertion at this site, while the high-ear position corn inbred line has no insertion at this site.

2. The Indel marker EH-03-Indel-108 tightly linked to corn ear height according to claim 1, characterized in that The primer pair for detecting the Indel marker polymorphism comprises: Forward primer: 5'-CACCGAGGTGGGACTAAAAAG-3', Reverse primer: 5′-TAGGAGAAGAGCAGGCAGGAG-3′; The primer pair can specifically amplify a DNA fragment containing the Indel site, and the length of the amplified product is 216 bp (when the insertion sequence is included) or there is no corresponding band due to the lack of the insertion sequence.

3. The Indel marker EH-03-Indel-108 tightly linked to corn ear height according to claim 1, characterized in that Detection of the Indel marker PH-03-Indel-108 specifically includes the following steps: S1: Extract genomic DNA of maize inbred lines; S2: Using the DNA from step S1 as a template, perform PCR amplification using the primer pair described above; S3: Analyze the PCR product by agarose gel electrophoresis: if a 216 bp band appears and CCTG insertion is present, it is determined to be a low-ear position haplotype; if no 216 bp band exists and CCTG insertion is present, it is determined to be a high-ear position haplotype.

4. The Indel marker EH-03-Indel-108 tightly linked to corn ear height according to claim 1, characterized in that The PCR amplification system is 20 μL and contains: DNA template 1 μL, 2×PCR Mix 10 μL, 10 μM forward primer 0.5 μL, 10 μM reverse primer 0.5 μL, ddH2O 8 μL; The amplification program was as follows: pre-denaturation at 94°C for 30 s, followed by 34 cycles of denaturation at 98°C for 10 s → annealing at 62°C for 15 s → extension at 72°C for 10 s, and finally extension at 72°C for 5 min, followed by storage at 4°C.

5. Use of the indel marker PH-03-Indel-108 according to any one of claims 1 to 4 in maize molecular marker-assisted breeding for screening low-ear position varieties and lodging-resistant maize inbred lines.

6. The use of the Indel marker EH-03-Indel-108 tightly linked to corn ear height according to claim 5, characterized in that The genomic DNA of the maize inbred line to be tested is tested by the detection method according to claim 3. If a 216 bp band is detected, it is determined to carry a low ear position haplotype and can be used as a target material for lodging resistance breeding.

7. The use of the Indel marker EH-03-Indel-108 tightly linked to corn ear height according to claim 5, characterized in that The breeding of low-ear corn varieties includes the following steps: (1) using a maize inbred line carrying the low-ear haplotype of the Indel marker and containing CCTG insertion as a donor parent and hybridizing it with the target parent to obtain the F1 generation; (2) Self-pollination or backcrossing of the F1 generation to construct a segregating population; (3) screening individuals carrying the low-ear haplotype in the segregating population using the detection method of claim 3; (4) Combine phenotypic identification and agronomic trait analysis to breed new corn varieties with low ear position and resistance to lodging.

8. The use of the Indel marker EH-03-Indel-108 tightly linked to corn ear height according to claim 5, characterized in that The reagents for detecting the corn ear height trait include a primer pair for detecting the Indel marker polymorphism, a DNA extraction reagent, a PCR reaction reagent and an agarose gel electrophoresis reagent.

9. The use of the Indel marker EH-03-Indel-108 tightly linked to corn ear height according to claim 8, characterized in that The DNA extraction reagent includes 1.5×CTAB buffer containing 0.2% mercaptoethanol, 24:1 chloroform / isoamyl alcohol, anhydrous ethanol, 75% ethanol and TE buffer; the PCR reaction reagent includes DNA polymerase, dNTPs and Mg 2+ Buffer system.

10. The use of the Indel marker EH-03-Indel-108 tightly linked to corn ear height according to claim 5, characterized in that: The Indel marker PH-03-Indel-108 detects a 4 bp insertion / deletion polymorphism in the Chr3:163961992-163963992 region of corn chromosome 3, thereby achieving early molecular identification of the corn ear height trait and significantly improving the breeding efficiency of lodging-resistant varieties.

Images