Methods of treating retinal degenerative diseases using AIMP2-DX2 and optionally miR-142 target sequences and compositions thereof

Abstract

Disclosed herein are methods of treating a retinal degenerative disease comprising administering to an individual in need thereof a vector comprising AIMP2-DX2 and optionally a miR-142 target sequence.

Description

References to electronically submitted sequence listings

[0001] The contents of the electronically submitted sequence listing in the ST26 file submitted with this application (Name: 2493-0006WO01.xml_Sequence Listing_ST25.txt; Size: 36KB; Creation Date: May 8, 2023) are incorporated herein by reference in their entirety. Technical Field

[0002] Disclosed herein are methods of treating retinal degenerative diseases comprising administering to an individual in need thereof a vector comprising AIMP2-DX2 and optionally a miR-142 target sequence. Background of the Invention

[0003] Retinal degenerative diseases are characterized by the degeneration of one or two retinal cell types, such as loss of retinal pigment epithelium (RPE) and / or photoreceptor cells in age-related macular disease (AMD) and retinitis pigmentosa (RP), and death of retinal ganglion cells (RGCs) in glaucoma. Often, visual impairment caused by degenerating retinal cells is irreversible because retinal cells lack the ability to repair themselves.

[0004] Abnormal RPE cells can be observed in AMD patients by optical coherence tomography (OCT). In patients with retinitis pigmentosa (RP), morphological and functional abnormalities of the RPE and photoreceptor layers are caused by genetic abnormalities. Stargardt disease or juvenile macular degeneration is characterized by the loss of RPE and photoreceptors in the macular area, leading to early central vision loss. Loss of retinal ganglion cells (RGCs) can be observed in patients with glaucoma. Once retinal cell degeneration is initiated, no treatment can reverse it.

[0005] In the retina, light signals are converted into electrical signals. This critical process in the retina requires a variety of interconnected cell types, such as photoreceptors, bipolar cells, horizontal cells, amacrine cells, and retinal ganglion cells (RGCs). Each cell type plays an integral role in the visual signaling process. Visual signaling begins with photoreceptors, which express light-sensitive proteins primarily in their outer segments. Jin ZB et al. (2019).

[0006] In the human retina, two types of photoreceptor cells, rods and cones, are responsible for dim and daylight vision (including color), respectively. Rods are primarily located in the peripheral retina, while cones are concentrated in a small part of the retina, the macula, which provides high-resolution central vision. Bipolar cells receive visual signals from photoreceptors and transmit these signals to RGCs coordinated by horizontal and amacrine cells. Ultimately, all signals are gathered in the optic nerve and transmitted to the brain. Both cell degeneration and synaptic disruption can lead to permanent visual impairment or even blindness. See, Jin 2019.

[0007] Age-related macular disease (AMD) is the leading cause of vision loss in Europe, the United States, and Australia. Almost two-thirds of the population over 80 years of age will develop signs of wet or exudative AMD, characterized by the presence of drusen and CNV (subfoveal choroidal neovascularization). AMD is a chronic, progressive disease characterized by damage to the central retinal zone. Changes in the choriocapillary layer, the retinal pigment epithelium (RPE), and Bruch's membrane, typical features of aging, underlie the pathogenesis of AMD; however, the mechanisms that trigger the transfer of typical age-related changes in the pathological process are unclear. Photoreceptor death and irreversible vision loss are the result of pathological changes in the RPE and choroid. Recent studies have shown that not only apoptosis, but also autophagy and necroptosis signaling cascades are involved in the cell death of retinal cells (Telegina 2017).

[0008] The disease can be divided into two types, "dry" and "wet". Approximately 90% of cases are "dry" atrophic AMD; there is currently no treatment. In "dry" AMD, drusen develop in the macular area, pigment redistribution, defects in the pigment epithelium and choroidal vascular layer, and photoreceptor death against a background of RPE cell atrophy. ~10% of patients with AMD develop the "wet" (exudative) type, which is characterized by the growth of new blood vessels through defects in Bruch's membrane under the retinal pigment epithelium or neuroepithelium. The increased permeability of the new vessels leads to retinal edema, exudates, and vitreous and retinal hemorrhages (ultimately a cause of vision loss).

[0009] Currently, the laser-induced photocoagulation model of Bruch's membrane is the most widely accepted and commonly used experimental mouse CNV model. The model described here involves rupture of Bruch's membrane by laser shock, resulting in the growth of new vessels from the choroid into the subretinal space, mimicking the main features of the exudative form of human AMD and providing the opportunity to explore the molecular mechanisms of CNV by using a large population of transgenic mice. This model has been shown to be suitable for testing the efficacy of new drugs by systemic or local (intraocular) administration and has shown predictive value for drug effects in AMD patients, for example, using vascular endothelial growth factor receptor (VEGFR) traps or anecortave acetate (Telegina 2017).

[0010] There are three major drugs that provide indirect antiangiogenic effects by blocking vascular endothelial growth factor (VEGF) in the retina. Ranibizumab (Lucentis, Genentech Inc., South San Francisco, CA; commercialized worldwide by Novartis) was approved by the U.S. Food and Drug Administration (FDA) in 2006 for the treatment of neovascular AMD (Hernández-Zimbrón 2018). It is a recombinant humanized immunoglobulin (Ig) G1κ isotype monoclonal antigen-binding fragment (Fab) that targets and binds VEGF-A with high affinity. Aflibercept (Regeneron, Tarrytown, NY; commercialized worldwide by Bayer AG) was approved by the FDA in 2011. It is a fusion protein that combines the two key binding domains of human VEGF receptors 1 and 2 and the fragment crystallizable (Fc) region of human IgG1. Finally, bevacizumab (Genentech Inc., South San Francisco, CA; commercialized worldwide by Roche) is a full-length humanized antibody that binds to and blocks all VEGF isoforms.

[0011] Oxidative stress can trigger apoptosis, which activates and recruits macrophages and induces inflammation. Apoptosis may be one of the causes of choroidal inflammation, leading to angiogenesis in the CNV model (Du 2013).

[0012] The most common recessive form of RP is X-linked RP, caused by mutations in the retinitis pigmentosa GTPase regulator (RPGR) gene. Talib M et al. (2018). X-linked RP is characterized by the degeneration of rod and cone photoreceptors during childhood, leading to visual field constriction and early severe vision loss. Despite promising results in animal models (Bennett J (2017); Boye SE et al. (2013); Sahel JA et al. (2014); Vandenberghe LH (2015)), gene therapy for photoreceptor degeneration in human RPGR-related RP has not been fully developed to date. Gene therapy using adeno-associated viral vectors is considered the most promising approach to treat this condition (Megaw RD et al. (2015)), although the inherent instability of the RPGR coding sequence poses challenges to translating this therapy into human trials.

[0013] The approval of gene therapy for RPE65-related retinal degeneration is a major breakthrough in the clinical application of gene therapy and has the potential to treat a variety of genetic diseases. Russell S et al. (2017). However, the inherent instability of the RPGR coding sequence, which contains repeated purine-rich regions and undergoes alternative splicing, poses a challenge to the translation of this therapy into human trials. Deng WT et al. (2015); Pawlyk BS et al. (20016); Sun X et al. (2016); Wu Z et al. (2015).

[0014] Neurodegenerative diseases (NDDs) are a heterogeneous group of disorders characterized by progressive structural and functional degeneration of the central and peripheral nervous systems. The eye provides a unique window into the brain due to its special connection to the brain and its ease of measurement, thus allowing for non-invasive access to a large number of potential biomarkers that may aid in early diagnosis and clinical care of NDDs.

[0015] In addition to traditional age- and genetic-related vision diseases such as macular degeneration, central nervous system disorders such as Parkinson's disease and Alzheimer's disease can also affect a patient's vision. These diseases can lead to direct or reverse degeneration of the optic nerve, retinal cells, and peripheral visual structures. Although these conditions are usually not obvious, they can affect coordination, mobility, and visual perception, increasing the risk of falls and related injuries.

[0016] AIMP2-DX2 is an alternative antagonistic splice variant of AIMP2, a multifactorial apoptotic gene. AIMP2-DX2 is known to inhibit apoptosis by hindering the function of AIMP2. AIMP2-DX2, as a competitive inhibitor of AIMP2, inhibits TNF-α-mediated apoptosis by inhibiting the ubiquitination / degradation of TRAF2. In addition, AIMP2-DX2 has been reported to be an existing lung cancer inducer, and in existing studies, AIMP2-DX2, which is widely expressed in cancer cells, has been shown to induce cancer by interfering with the cancer suppressor function of AIMP2. In addition, it has been found that the expression of AIMP2-DX2 in normal cells promotes cell carcinogenesis, while inhibiting the expression of AIMP2-DX2 inhibits cancer growth, thereby showing a therapeutic effect.

[0017] Studies have also identified AIMP2-DX2 as a potential treatment for neuronal diseases (KR10-2015-0140723 (2017) and US2019 / 0298858 (2019). Summary of the invention

[0018] The present invention discloses a method for treating a retinal degenerative disease in an individual in need thereof, comprising administering to the individual a pharmaceutically effective amount of a nucleic acid molecule comprising an AIMP2 variant with a deletion of exon 2 (AIMP2-DX2 or DX2). In some embodiments, the nucleic acid molecule is a viral vector or a non-viral vector, such as a recombinant vector.

[0019] Also disclosed herein is the use of a pharmaceutically effective amount of a nucleic acid molecule comprising an AIMP2 variant with a deletion of exon 2 (AIMP2-DX2 or DX2) in treating a retinal degenerative disease in an individual in need thereof. Also disclosed herein is the use of a pharmaceutically effective amount of a nucleic acid molecule comprising AIMP2-DX2 in treating a retinal degenerative disease in an individual in need thereof. Also disclosed herein is the use of a pharmaceutically effective amount of a nucleic acid molecule comprising AIMP2-DX2 in the manufacture of a medicament for treating a retinal degenerative disease in an individual in need thereof.

[0020] Disclosed herein is a method for treating a retinal degenerative disease in an individual in need thereof, comprising administering to the individual a pharmaceutically effective amount of a recombinant vector comprising an AIMP2 variant with exon 2 deletion (AIMP2-DX2 or DX2) gene.

[0021] Also disclosed herein is the use of a pharmaceutically effective amount of a recombinant vector comprising an AIMP2 variant with a deletion of exon 2 (AIMP2-DX2 or DX2) in treating a retinal degenerative disease in an individual in need thereof. Also disclosed herein is the use of a pharmaceutically effective amount of a recombinant vector comprising AIMP2-DX2 in treating a retinal degenerative disease in an individual in need thereof. Also disclosed herein is the use of a pharmaceutically effective amount of a recombinant vector comprising AIMP2-DX2 in the manufacture of a medicament for treating a retinal degenerative disease in an individual in need thereof.

[0022] In some embodiments, the nucleic acid molecules are administered by chemical conjugation to Galnac, cell penetrating peptides, nucleic acid or glycopeptide-mediated delivery, synthetic compound carriers; lipid-mediated delivery, such as lipid nanoparticle encapsulation; inorganic carrier-mediated delivery, such as inorganic carriers; biological delivery, such as exosome-mediated delivery; or physical delivery, such as by micro / nano needles, pressure perfusion, microparticles, electrical energy / electroporation / iontophoresis, sonoporation, magnetoporation, or photoporation / photodynamic energy.

[0023] In some embodiments, the retinal degenerative disease is retinitis pigmentosa, Leber congenital amaurosis, cone-rod dystrophy, glaucoma or diabetic retinopathy. In some embodiments, the retinal degenerative disease occurs before or with Parkinson's disease, Alzheimer's disease or amyotrophic lateral sclerosis. In some embodiments, the retinal degenerative disease is not age-related macular disease. In some embodiments, the method for treating retinal degenerative disease does not include treatment of age-related macular disease (AMD). In some embodiments, AMD is wet AMD. In some embodiments, AMD is dry AMD.

[0024] The recombinant vector may further comprise a miR-142 target sequence.

[0025] The vector may also include a promoter operably linked to AIMP2-DX2. In some embodiments, the promoter is a retrovirus (LTR) promoter, a cytomegalovirus (CMV) promoter, a Rous sarcoma virus (RSV) promoter, a MT promoter, an EF-1α promoter, an UB6 promoter, a chicken β-actin promoter, a CAG promoter, an RPE65 promoter, or an opsin promoter.

[0026] The miR-142 target sequence may be located at the 3' end of the AIMP2-DX2 gene.

[0027] In some embodiments, the AIMP2-DX2 gene comprises a nucleotide sequence encoding an amino acid sequence that is at least 90% identical to SEQ ID NO: 2, 13, 14, 15, 16, 17, 18, 19, or 20.

[0028] In some embodiments, the AIMP2-DX2 gene comprises a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 2, 13, 14, 15, 16, 17, 18, 19 or 20.

[0029] In some embodiments, the AIMP2-DX2 gene does not have an exon comprising a nucleotide sequence encoding an amino acid sequence that is at least 90% identical to SEQ ID NO: 10 or 11.

[0030] In some embodiments, the AIMP2-DX2 gene does not have an exon comprising a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 10 or 11.

[0031] The miR-142 target sequence may comprise a nucleotide sequence comprising ACACTA. In some embodiments, the miR-142 target sequence comprises ACACTA and 1-17 additional consecutive nucleotides of SEQ ID NO:5. In some embodiments, the miR-142 target sequence comprises a nucleotide sequence that is at least 50% identical to the nucleotide sequence of SEQ ID NO:5 (TCCATAAAGTAGGAAACACTACA; miR-142-3p target sequence). In some embodiments, the miR-142 target sequence may comprise the nucleotide sequence of SEQ ID NO:5.

[0032] In some embodiments, the miR-142 target sequence comprises ACTTTA. In some embodiments, the miR-142 target sequence comprises ACTTTA and 1-15 additional consecutive nucleotides of SEQ ID NO:7. In some embodiments, the miR-142 target sequence comprises a nucleotide sequence that is at least 50% identical to the nucleotide sequence of SEQ ID NO:7 (AGTAGTGCTTTCTACTTTATG; miR-142-5p target sequence). In some embodiments, the miR-142 target sequence comprises the nucleotide sequence of SEQ ID NO:7.

[0033] The miR-142 target sequence can be repeated 2-10 times in the vectors disclosed herein.

[0034] The vector can be a viral vector. The viral vector can be an adenovirus, an adeno-associated virus, a lentivirus, a retrovirus, a human immunodeficiency virus (HIV), a murine leukemia virus (MLV), an avian sarcoma / leukemia (ASLV), a spleen necrosis virus (SNV), a Rous sarcoma virus (RSV), a mouse mammary tumor virus (MMTV), a herpes simplex virus or a vaccinia virus vector.

[0035] In some embodiments, the recombinant vector is administered to the individual topically by intravitreal injection, subconjunctival injection, or into the subretinal space.

[0036] The methods disclosed herein may further comprise administering to the individual an additional therapeutic agent. In some embodiments, the additional therapeutic agent is ranibizumab, aflibercept, or bevacizumab. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1 .Examples of recombinant vectors.

[0038] Figure 2 .Neuron cell-specific expression of recombinant vectors in vitro.

[0039] Figure 3 . miR142-3pT (target) sequence (SEQ ID NO: 6) with 4 repeats of miR142-3pT (underlined).

[0040] Figure 4A . Schematic diagram of miR142-3pT and mutants with 1×, 2×, and 3× repeats. Figure 4B Suppression of DX2 expression by miR142-3p with 1×, 2×, and 3× repeats of miR-142-3pT is shown.

[0041] Figure 5 .The core binding sequence is important in DX2 inhibition. A vector with Tseq×3 repeats showed significant inhibition of DX2 ( Figure 4B ), and the DX2 construct served as a control. Treatment with 100 pmol miR-142-3p significantly inhibited the Tseq×3 vector, but not DX2 and mutant sequences.

[0042] Figures 6A-6C Comparison of amino acid sequences of AIMP2-DX2 and variants ( Figure 6B and 6C yes Fig. 6A Continuation of

[0043] Figures 7A-7I DX2 physically binds to AIMP2 to reduce PARP-1 activation. Fig. 7AThe expression of AIMP2 and DX2 was induced by transfecting each plasmid in SH-SY5Y cells, and then analyzed by PARP-1 pull-down assay. DX2 has a higher affinity for PARP-1 than AIMP2. Figure 7B SH-SY5Y cells were transfected with vehicle (Con) or DX2 expression (DX2) plasmid, incubated for 24 hours and lysed. Total cell lysates were incubated with protein agarose beads to immunoprecipitate PARP-1-bound AIMP2 and analyzed by immunoblot analysis. Figure 7C DX2 siRNA (DX2) and control siRNA (Con) were transfected into SH-SY5Y and incubated for 48 hours. Total cell lysates were incubated with protein agarose beads to immunoprecipitate PARP-1-bound AIMP2 and analyzed by immunoblot analysis. Fig.7D and 7E GFP- or Myc-tagged AIMP2 and / or DX2 expression plasmids were transfected into HEK 293 cells and stained with myc antibody ( Fig.7D ) and GFP antibody ( Fig. 7E ) Immunoprecipitation (IP) was used to measure binding affinity. Figure 7F and 7G SH-SY5Y cells were transfected with EV (empty vector), AIMP2, and DX2 expression plasmids. After 24 hours, the transfected cells were incubated for 4 hours in the presence or absence of 10 400 μM H2O2. Figure 7F ) and PARlyation( Figure 7G ) were detected by immunoblotting analysis. Under conditions of oxidative stress-induced cell damage, DX2 attenuated the cleavage of PARP-1, which is associated with cell death ( Figure 7F ) and PARylation( Figure 7G ). Figure 7H Pulse-chase assay using cycloheximide treatment was used to evaluate the stability of AIMP2 and DX2 proteins. Samples were collected from 0 to 4 hours in a time-dependent manner and examined using immunoblot analysis. Fig.7I .Schematic representation of AIMP2-induced PARP-1 activation. In the absence of DX2, AIMP2 dimers induce PARP-1 activation and neuronal death. However, in the presence of DX2, DX2 interacts with AIMP2 and inhibits PARP-1 activation.

[0044] Figures 8A-8C DX2 reduces neurotoxin-induced neuronal cell death. Fig. 8A N2A cells were transfected with EV, AIMP2 and DX2 expression plasmids, and the transfected cells were incubated in the presence or absence of H2O2 for 4 h, and then the cell viability was determined by MTT. Figure 8B and 8C SH-SY5Y cells were co-transfected with EV, AIMP2, and DX2 expression plasmids, incubated with H2O2 for 4 h, and cell viability was determined by MTT assay. Numbers indicate the amount of transfected DNA.

[0045] Figures 9A-9C DX2 impairs the pro-apoptotic activity of AIMP2 by competitively inhibiting the binding of AIMP2 to TRAF2. Fig.9A HEK293 cells were transfected with the indicated amounts of Myc-DX2 and Myc-AIMP2. Expression of Endo- and Exo-AIMP2 and -DX2 was confirmed by Western blotting of whole cell lysates (WCL) with anti-AIMP2 antibody (lower panel). TRAF2 was immunoprecipitated with its specific antibody, and AIMP2 or DX2 bound to TRAF2 was detected with anti-Myc antibody (upper panel). Choi JW et al. (2012). Fig. 9B DX2 increased NF-kB activity, whereas AIMP2 produced the opposite effect. Fig. 9C DX2 overexpression abolished TNF-α-induced cell death.

[0046] Figures 10A-10B .Overexpression of DX2 reduces TNFα-induced neuronal cell death. Fig.11A N2A cells were transfected with EV and DX2 and treated with TNF-α and CHX for 6 h, and cell viability was evaluated by MTT assay. #P<0.05. Fig. 10B Primary neuronal cells from WT mice were transfected with EV (empty vector) and DX2, and MTT assay was performed to evaluate their viability. #P<0.0.

[0047] Figures 11A-11B .AAV2-GFP transduction efficiency test. Fig.11A .AAV-GFP transduction efficiency test. SK-SY5Y cells were infected with scAAV-GFP or ssAAV-GFP, and 48 hours later ( Fig. 11B ) GFP expression was observed under a fluorescence microscope.

[0048] Figures 12A-12G .AAV2-DX2 has anti-apoptotic effects and alters cell signaling. Fig. 12A .Cytotoxic effects in primary neurons (neurons), MEFs (mouse embryonic fibroblasts), hepatocytes and MSCs (mesenchymal stem cells). After H2O2 treatment, reduced cytotoxic effects were observed in DX2-transduced cells (AAV2-DX2) when compared to control-transduced cells (c). Fig. 12BDX2 is not required for normal cell growth in SH-SY5Y (left) and primary neuronal cells (right). Under oxidative stress conditions, AAV2-DX2 infected cells showed reduced levels of cell death when compared to their control counterparts (AAV-GFP, GFP). Fig. 12C .Enrichment plots of SK-N-SH and N2A in AAV-GFP or AAV2-DX2 infected neuroblastoma cells by RNAseq. Fig.12D and 12E .Graph representing gene counts of cell death and inflammation related pathways that were downregulated. Fig.12F and 12G Figure . P-values ​​of signaling pathways altered by DX2 overexpression. ns; non-significant; *, P < 0.05; **, P < 0.01; ****, P < 0.0001, t-test.

[0049] Fig.13 DX2 increases the viability of retinal photoreceptor neuronal cells. 661W cells were seeded in 96-well plates at 5×10^4 cells / well and then infected with AAV-DX2 virus at 5000 MOI. After 48 hours, cells were treated with different concentrations of H2O2. Cell viability was evaluated by MTT assay after 24 hours.

[0050] Fig.14 DX2 reduces BAX levels induced by H2O2. 661W cells were infected with AAV-GFP or AAV-DX2 at an MOI of 5,000 each. After 72 hours, cells were treated with 2 mM H2O2 for 6 hours and then the RNA level of BAX was assessed.

[0051] Figures 15A-15B Overexpression of DX2 resulted in increased 67LR levels in 661W cells. Fig.15A Empty vector (EV) and Strep-DX2 (DX2) were transfected into 661W cells using Lipofectamine 3000 reagent. DX2 transfection resulted in increased 67LR levels. Fig. 15B .In with Fig.15A Immunofluorescence staining of 661W cells was performed under the same conditions as in the experiment.

[0052] Fig.16 DX2 binds to KRS, similar to AIMP2. Cells transfected with 2 μg of Flag-Tag-AIMP2 and Flag-Tag-DX2 were lysed with NP-40 lysis buffer. Subsequently, 15 μl of a mixture of agarose A / G plus beads and KRS antibody were used for pull-down assay.

[0053] Figures 17A-17BDX2 modulates the levels of the membrane form of KRS under ROS conditions, leading to increased levels of 67LR. Fig.17A 661W cells were infected with AAV-GFP and AAV-DX2 at a multiplicity of infection (MOI) of 5,000 and then treated with 2 mM H2O2 for 6 hours at 72 hours post-infection. Subsequently, cells were lysed and Western blot analysis was used to observe changes in KRS and 67LR levels. Fig. 17B .Follow and Fig.17A The cells were fractionated into cytosolic and membrane fractions and subjected to Western blot analysis under the same experimental conditions as in . After H2O2 treatment, a decrease in the membrane form of KRS was observed, while treatment with AAV-DX2 resulted in an increase in both the membrane forms of 67LR and KRS.

[0054] Fig.18A . Cross-sectional histology of retina (H&E staining). Fig.18B .Retinal thickness. Fig. 18C . RPE (retinal pigment epithelium) thickness. Fig.18D .ONL (outer nuclear layer of photoreceptors) thickness. Fig.18E . Thickness of the outer layer. Fig.18F .OPL (outer plexiform layer) thickness. All samples were obtained from 10 μm thick slices containing the optic nerve. Figure 18G .RPE (retinal pigment epithelium) integrity and proliferation. Fig.18H .PR (photoreceptor) recovery. Fig.18I .RPE and PR cell proliferation. Figures 18J-18O .Retinal function recovery. Normal ERG graphic format electroretinogram ( Figures 18J-18K ). A wave amplitude ( Figure 18L ) and a-wave delay ( Figure 18M ), b-wave amplitude ( Fig.18N ) and b-wave delay ( Fig.18O ).

[0055] Fig.19A . Fluorescein angiography and indocyanine green angiography images of the laser photocoagulation site after treatment with scAAV2-GFP or scAAV2-DX2. Figures 19B-19D .Comparison of choroidal neovascularization area. Ratio of leakage area to CNV area when treated with GFP control and DX2. Leakage area was estimated by measuring the total high fluorescence area using FA, and CNV area was calculated using ICGA. Changes in CNV area after treatment with DX2. CNV volume was calculated based on the total measured isolectin B4 volume. For each group, n=12, *P<(0.05). Fig.19E. VEGF expression in laser-induced choroidal neovascularization (CNV) mouse model. Western blot results of VEGF expression and VEGF fold difference in CNV mouse model. VEGF fold difference was measured by ImageJ. For each group, n=6, *P<(0.05).

[0056] Figures 20A-20B .Fundus photography of areas of retinal pigment epithelial (RPE) degeneration. Figures 20C-20F DX2 expression levels in the test article (AAV2-DX2)-treated group. Figures 20G-20J .Immunohistochemistry. Figure 20K-20L .Electroretinogram.

[0057] Figures 21A-21B .a wave( Fig.21A ) and b waves ( Fig.21B ) electroretinogram measurement.

[0058] Figures 22A-22B .AAV2-DX2AAV2-DX2 prevents angiogenesis in a laser-induced choroidal neovascularization (CNV) rabbit model. Fig.22A Fluorescein intensity. Fig. 22B Isolectin B4 staining.

[0059] Figures 23A-23M .Biodistribution studies to evaluate the expression of DX2 in systemic organs. Fig.23A .qPCR analysis was performed to confirm the expression of DX2 in the injected tissue area. Figures 23B-23M DX2 expression in thymus, liver, testis, brain, spleen, kidney, heart, stomach, mesenteric lymph node, spinal cord, pancreas, and lung was analyzed using qPCR. DETAILED DESCRIPTION

[0060] Neurodegenerative diseases (NDDs) are a heterogeneous group of disorders characterized by progressive structural and functional degeneration of the central and peripheral nervous systems. The eye provides a unique window into the brain due to its unique connection to the brain and ease of measurement, allowing for non-invasive access to a large number of potential biomarkers that may aid in early diagnosis and clinical care of NDDs.

[0061] Inherited retinal diseases, especially RP or Leber congenital Amurosis, are a collective concept that refers to heterogeneous eye diseases caused by dozens of mutations in multiple genes, and their presence and frequency vary by race and region. Recently, gene therapy that replaces mutant genes with normal WT genes has become a promising treatment method. However, most gene therapy drugs currently undergoing clinical stage research are treatments that replace mutant genes by introducing a single normal WT gene, which is a limitation and can only be expected to be effective in a very limited number of patients. In addition, the clinical research results of single mutant gene replacement gene therapy (such as Luxturna) so far are still far from restoring normal vision. Only the efficacy of enhancing light detection ability to enable patients to live independently in daily life has been reported. This suggests that in addition to single mutant gene replacement, there are more complex cellular level mechanisms in the restoration of normal vision.

[0062] In addition to traditional age- and genetic-related vision disorders, such as macular degeneration, central nervous system disorders, including Parkinson's disease and Alzheimer's disease, can also affect a patient's vision. These diseases can lead to direct or reverse degeneration of the optic nerve, retinal cells, and surrounding visual structures. While these conditions are often not obvious, they can affect coordination, mobility, and visual perception, increasing the risk of falls and related injuries.

[0063] Parkinson's disease is a progressive neurodegenerative disorder. The destruction of dopaminergic neurons in the substantia nigra, with the subsequent reduction in the action of dopamine in the striatum (the part of the basal ganglia system involved in motor control), is thought to be the pathophysiological mechanism of Parkinson's disease. Although the main characteristics of Parkinson's disease are tremor, rigidity, and postural instability, ambiguous visual symptoms (such as blurred and double vision, uncontrolled eye movements, light sensitivity, eyestrain, and reading difficulties) are also common. Up to 75% of patients with idiopathic Parkinson's disease experience subtle eye movement abnormalities, but they are usually untreated. However, because these symptoms can further reduce patients' already impaired quality of life and function, they require specialized treatment.

[0064] Amyotrophic lateral sclerosis (ALS) is a fatal neurodegenerative disease that causes a progressive loss of motor neuron function. Although ocular complaints are not currently considered typical symptoms of ALS, retinal changes such as thinning, axonal degeneration, and inclusions have been found in many patients. Retinal abnormalities observed in postmortem human tissue and animal models resemble spinal cord changes in ALS. These findings are not unexpected, as the retina has an ontogenetic relationship with the brain and many genes have been implicated in both neurodegenerative and retinal diseases. See Soldatov 2021.

[0065] Alzheimer's disease, the most common form of dementia, is characterized by the breakdown and damage of connections between nerve cells. These lesions occur due to the abnormal accumulation of beta-amyloid protein (Abeta) in the form of amyloid plaques and / or neurofibrillary tangles composed of aggregated tau protein. Eye degeneration in Alzheimer's disease occurs due to the thinning of the retinal nerve fiber layer. Neurons responsible for visual processing tend to be more damaged than primary visual neurons, leading to symptoms of blurred vision early in the disease. Deficits in recognizing objects, seeing colors, and processing visual motion can occur at any stage, increasing the risk of accidents such as falls, cuts, and burns.

[0066] DX2 is an exon 2-deficient antagonistic splice variant of AIMP2 that effectively inhibits AIMP2-induced neuronal death. AIMP2 is one of the three accessory proteins that form the multi-tRNA synthetase complex. In addition to supporting tRNA ligation during translation, AIMP2 has been reported to be a multifunctional and potent inducer of cell death.

[0067] AIMP2 overactivates apoptosis signaling pathways such as PARP-1 or p53 or inhibits cell survival signaling pathways such as TRAF signaling or LR expression.

[0068] As a splice variant of AIMP2, DX2 acts as an antagonistic competitor against AIMP2, thus directly and indirectly inhibiting AIMP2-induced cell death.

[0069] DX2 inhibits PARP-1 and p53-induced neuronal death in a Parkinson's disease model. Overexpression of DX2 in the substantia nigra using AAV rescues locomotor activity and neuronal cell death in a mouse model of PD.

[0070] In ALS, DX2 inhibits TRAF2-dependent and 67LR-mediated neuronal death in ALS disease. In an ALS mouse model, overexpression of DX2 improves locomotor activity and survival and reduces neuronal cell death.

[0071] Without being bound by any theory, given the anatomical and developmental interconnections between the eye and brain and the clinical evidence of retinal damage in NDD, common pathophysiological pathways may exist in the destruction of neuronal cell systems in the CNS and the degeneration of the optic nerve, retinal cells, and peripheral visual structures.

[0072] Gene therapy is a promising therapeutic approach for treating irreversible retinal cell death in various diseases, such as age-related macular degeneration (AMD), Stargardt disease, retinitis pigmentosa (RP), and glaucoma. Adeno-associated virus (AAV) has become the preferred vector for targeting gene expression to the retina. AAV injected subretinally or intravitreally can effectively transduce the retinal pigment epithelium and inner retinal layers. AAV is also considered a suitable gene delivery method due to its relative safety (due to lack of pathogenicity) (20). Utilization of the survival gene DX2 may be a potential option for treating retinal degenerative diseases.

[0073] AIMP2-DX2 is an alternative antagonistic splice variant of AIMP2 (aminoacyl-tRNA synthetase complex-interacting multifunctional protein 2), which is a multifactorial apoptosis gene. AIMP2-DX2 is known to inhibit apoptosis by hindering the function of AIMP2.

[0074] AIMP2-DX2, as a competitive inhibitor of AIMP2, inhibits TNF-α-mediated apoptosis by inhibiting the ubiquitination / degradation of TRAF2.

[0075] It has also been determined that AIMP2-DX2 can treat neuronal diseases (US2019 / 0298858A1).

[0076] It has also been determined that AIMP2-DX2 is effective in inhibiting choroidal neovascularization when it is inserted into an adeno-associated virus and the resultant is introduced into the subretinal space.

[0077] Disclosed herein are methods for treating retinal degenerative diseases in individuals in need thereof, comprising administering to the individual a pharmaceutically effective amount of a nucleic acid molecule comprising an AIMP2 variant with a deletion of exon 2 (AIMP2-DX2 or DX2). In some embodiments, the nucleic acid molecule is a viral vector or a non-viral vector, such as a recombinant vector.

[0078] Disclosed herein is a method of treating a retinal degenerative disease in an individual in need thereof, comprising administering to the individual a pharmaceutically effective amount of a recombinant vector comprising an AIMP2 variant with exon 2 deletion (AIMP2-DX2 or DX2).

[0079] In some embodiments, the retinal degenerative disease is retinitis pigmentosa, Leber congenital amaurosis, cone-rod dystrophy, glaucoma or diabetic retinopathy. In some embodiments, the retinal degenerative disease occurs before or with Parkinson's disease, Alzheimer's disease or amyotrophic lateral sclerosis. In some embodiments, the retinal degenerative disease is not age-related macular disease. In some embodiments, the method for treating retinal degenerative disease does not include treatment of age-related macular disease. In some embodiments, AMD is wet AMD. In some embodiments, AMD is dry AMD.

[0080] Disclosed herein are methods for reducing vascular leakage in the eye or surrounding area of ​​the eye of an individual suffering from a retinal degenerative disease, reducing the area of ​​choroidal neovascularization, reducing choroidal neovascularization formation, or reducing VEGF expression, comprising administering to the individual a pharmaceutically effective amount of a recombinant vector comprising an AIMP2 variant (AIMP2-DX2) gene with exon 2 deletion.

[0081] The recombinant vector disclosed herein may also include a miR-142 target sequence. The vector may also include a promoter operably linked to AIMP2-DX2. In some embodiments, the promoter is a retrovirus (LTR) promoter, a cytomegalovirus (CMV) promoter, a Rous sarcoma virus (RSV) promoter, a MT promoter, an EF-1α promoter, an UB6 promoter, a chicken β-actin promoter, a CAG promoter, an RPE65 promoter, a synaptic protein promoter, a MeCP2 promoter, a CaMKII promoter, an Hb9 promoter, or an opsin promoter.

[0082] In the methods disclosed herein, in some embodiments, the recombinant vector may comprise an AIMP2 variant (AIMP2-DX2) gene with exon 2 deletion and a miR-142 target sequence. The miR-142 target sequence may be located at the 3' end of the AIMP2-DX2 gene. The vector described herein may express AIMP2-DX2 in neuronal cells, but not in hematopoietic cells such as leukocytes and lymphocytes.

[0083] The AIMP2-DX2 polypeptide (SEQ ID NO:2) is a splice variant of AIMP2 (e.g., aa sequence of SEQ ID NO:12; e.g., nt sequence of SEQ ID NO:3) in which the second exon of AIMP2 is omitted (SEQ ID NO:10; nt sequence of SEQ ID NO:4). In some embodiments, the AIMP2-DX2 gene has the nucleotide sequence shown in SEQ ID NO:1, and the AIMP2-DX2 polypeptide has the amino acid sequence shown in SEQ ID NO:2. Variants or isoforms of AIMP2-DX2 polypeptides are also known and can be determined by those skilled in the art (see, e.g., SEQ ID NOs:13-19, e.g., Figures 6A-6C A comparison of AIMP2 (SEQ ID NO: 2) with the consensus or core sequence of variants SEQ ID NOs: 13-19 and AIMP2 or AIMP2-DX2 (SEQ ID NO: 20) is shown.

[0084] In some embodiments, the AIMP2-DX2 gene may comprise a nucleotide sequence encoding an amino acid sequence that is at least 90% identical, at least 93% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, at least 99% identical, or any range of % identity therein to SEQ ID NO: 2, 13, 14, 15, 16, 17, 18, 19, or 20. The AIMP2-DX2 gene may comprise a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 2, 13, 14, 15, 16, 17, 18, 19, or 20.

[0085] The AIMP2-DX2 gene may comprise a nucleotide sequence that is at least 90% identical, at least 93% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, at least 99% identical, or any range of % identity therein to the nucleotide sequence of SEQ ID NO: 1. The AIMP2-DX2 gene may comprise the nucleotide sequence of SEQ ID NO: 1.

[0086] In some embodiments, the AIMP2-DX2 gene does not have an exon comprising a nucleotide sequence encoding an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 10 or 11. In some embodiments, the AIMP2-DX2 gene does not have an exon comprising a nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 10 or 11. In some embodiments, the AIMP2-DX2 gene does not have an exon comprising a nucleotide sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 4.

[0087] In some embodiments, the nucleic acid molecule comprising AIMP2-DX2 may optionally include a miR-142 target sequence. The miR-142 target sequence (miR-142T) may include a nucleotide sequence containing ACACTA. The miR-142 target sequence may include a nucleotide sequence containing 1-17 additional continuous nucleotides of ACACTA and SEQ ID NO:5. For example, the miR-142 target sequence may include such a nucleotide sequence, the nucleotide sequence includes ACACTA and a total of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 or 17 additional nucleotides, the additional nucleotides are continuous at 5' or 3' of ACACTA, as shown in SEQ ID NO:5.

[0088] The miR-142 target sequence may comprise a nucleotide sequence that is at least 50% identical, at least 60% identical, at least 70% identical, at least 80% identical, at least 90% identical, at least 90% identical, at least 93% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, at least 99% identical, or 100% identical to the nucleotide sequence of SEQ ID NO:5 (TCCATAAAGTAGGAAACACTACA; miR-142-3pT). The miR-142 target sequence may comprise the nucleotide sequence of SEQ ID NO:5.

[0089] The miR-142 target sequence may comprise a nucleotide sequence comprising ACTTTA. The miR-142 target sequence may comprise a nucleotide sequence comprising ACTTTA and 1-15 additional consecutive nucleotides of SEQ ID NO:7. For example, the miR-142 target sequence may comprise a nucleotide sequence comprising ACTTTA and a total of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15 additional nucleotides, the additional nucleotides being consecutive at 5' or 3 of ACTTTA, as shown in SEQ ID NO:7

[0090] The miR-142 target sequence may comprise a nucleotide sequence that is at least 50% identical, at least 60% identical, at least 70% identical, at least 80% identical, at least 90% identical, at least 90% identical, at least 93% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, at least 99% identical, or 100% identical to the nucleotide sequence of SEQ ID NO: 7 (AGTAGTGCTTTCTACTTTATG; miR-142-5pT). The miR-142 target sequence may comprise the nucleotide sequence of SEQ ID NO: 7.

[0091] An example of a miR142-3pT mutant sequence is: ccgctgcagtgtgacagtgccagccaatgtgcagaggtggatgaggtcttgtgaaaacctggctccttttaacacggcc ctcaagctccttaagtgaccagaagcttgctagctccataaagtaggaCCACTGCAatcactccataaagtagga CCACTGCAagatatctccataaagtaggaCCACTGCAatcactccataaagtaggaCCACTGCAaaagcttgtagggatccgcc (SEQ ID NO: 25).

[0092] The mutant sequence refers to one or more regions of the miR142 3pT core sequence, for example, four regions are substituted as follows: (5'-AACACTAC-3'→5'-CCACTGCA-3'). Inhibition of DX2 expression by the miR142-3p×1 repeat (100 pmol) miR142-3p target sequence was observed in HEK293 cells transfected with the vector, and as the number of core binding sequences in the miR142-3p target sequence increased, the inhibition of DX2 expression by miR142-3p also increased. The vector containing the Tseq×3 core sequence showed significant inhibition, while no inhibition was observed for the mutated 3x sequence.

[0093] MicroRNA (miRNA) is a non-coding RNA molecule that plays a role in controlling gene expression. MiRNA plays a role by base pairing with the complementary sequence (i.e. miRNA target sequence) in the mRNA molecule. MiRNA can be attached to the target messenger RNA (mRNA) transcript of protein-coding genes, and negatively regulate their translation or cause mRNA degradation. At present, more than 2000 kinds of human miRNAs have been identified, and the miRbase database is publicly available. Many miRNAs are expressed in a tissue-specific manner, and play an important role in maintaining tissue-specific functions and differentiation.

[0094] MiRNA works at the post-transcriptional stage of genes, and in the case of mammals, it is known that about 60% of gene expression is controlled by miRNA. MiRNA plays an important role in a variety of processes in the organism, and has been disclosed to be relevant to cancer, heart disease and neurological disorders. For example, miR-142-3p and miR-142-5p are present in miR-142, and any of their target sequences can be used. Therefore, "miR-142" or "miRNA-142" refers to, for example, miR-142-3p and / or miR-142-5p, and can be combined with miR-142 target sequences, for example, miR-142-3pT or miR-142-5pT.

[0095] The miR-142 target sequence can be located 5' or 3' to the AIMP2-DX2 gene.

[0096] For example, "miR-142-3p" can be present in the region where its gene translocation occurs in aggressive B-cell leukemia, and is known to be expressed in hematopoietic tissues (bone marrow, spleen, thymus, etc.). In addition, miR-142-3p is known to be involved in the differentiation of the hematopoietic system and has been confirmed to be expressed in the liver of fetal mice (hematopoietic tissue of mice).

[0097] In some embodiments, the miR-142-3p and / or miR-142-5p target sequence is repeated at least 2-10 times, at least 2-8 times, at least 2-6 times, at least 4 times, or any range or number thereof.

[0098] As an example, miR-142-3p, for example, having a nucleotide sequence of SEQ ID NO: 23, can have a corresponding target sequence, for example, a miR-142-3p target sequence (miR-142-3pT) having a nucleotide sequence of SEQ ID NO: 5, but is not limited thereto. miR-142-5p, for example, having a nucleotide sequence of SEQ ID NO: 24, can have a corresponding target sequence, for example, a miR-142-5p target sequence (miR-142-5pT) having a nucleotide sequence of SEQ ID NO: 7, but is not limited thereto.

[0099] In some embodiments, miR-142-3p may have a nucleotide sequence of SEQ ID NO:23, and miR-142-5p may have a nucleotide sequence of SEQ ID NO:24.

[0100] Disclosed herein is a recombinant vector that can control the side effects of overexpression of AIMP2-DX2 variants by inserting a miR-142-3p target sequence and / or a miR-142-5p target sequence (respectively miR-142-3pT and / or miR-142-5pT) into the end of AIMP2-DX2 and controlling the suppression of AIMP2-DX2 expression in CD45-derived cells, particularly in the lymphatic system and leukocytes. Thus, the expression of AIMP2-DX2 variants can be limited to injected neuronal cells and tissues, but not in the main population of non-neuronal hematopoietic cells in the injected tissue area. MiR142-3p is expressed only in hematopoietic cells.

[0101] Disclosed herein are recombinant vectors containing target sequences of miR-142-3p and / or miR-142-5p.Disclosed herein are recombinant vectors comprising an AIMP2 variant (AIMP2-DX2) gene with exon 2 deletion disclosed herein and a miR-142-3p and / or miR-142-5p target sequence.

[0102] The term "recombinant vector" refers to a vector that can encode a target protein or RNA in a suitable host cell, or a gene construct that contains necessary operably linked control factors to enable the proper expression of the inserted gene.

[0103] The term "operably linked" refers to a functional connection between a nucleic acid expression control sequence and a nucleic acid sequence encoding a target protein and RNA to perform a general function. For example, it can affect the expression of a nucleic acid sequence encoding a promoter and a protein or RNA linked for the operability of the nucleic acid sequence. The operable connection with a recombinant vector can be made by using genetic recombination technology, which is well known in the corresponding technical field, and using commonly known enzymes for region-specific DNA cutting and connection in the corresponding technical field.

[0104] The recombinant vector may also include a promoter operably linked to the AIMP2-DX2 disclosed herein. In some embodiments, the promoter is a retrovirus (LTR) promoter, a cytomegalovirus (CMV) promoter, a Rous sarcoma virus (RSV) promoter, a MT promoter, an EF-1α promoter, an UB6 promoter, a chicken β-actin promoter, a CAG promoter, an RPE65 promoter, a synaptic protein promoter, a MeCP2 promoter, a CaMKII promoter, a Hb9 promoter, or an opsin promoter.

[0105] The recombinant vector may additionally contain a heterologous promoter and a heterologous gene operably linked to the promoter.

[0106] As used herein, "heterologous gene" can include an encrypted sequence having a biologically appropriate activated protein or polypeptide, as well as a target product (eg, an immunogenic or antigenic protein or polypeptide, or a therapeutically activated protein or polypeptide).

[0107] Polypeptides can complement the underexpression or lack of endogenous proteins in host cells. Gene sequences can be induced from different sources, including DNA, cDNA, synthetic DNA, RNA or a combination thereof. Gene sequences can include genomic DNA containing or not containing natural introns. In addition, genomic DNA can be obtained together with a promoter sequence or a polyadenylation sequence. Genomic DNA or cDNA can be obtained in a variety of ways. Genomic DNA can be extracted and purified from suitable cells by methods disclosed in the corresponding fields. Alternatively, mRNA can be separated from cells by reverse transcription or other methods and used to produce cDNA. Alternatively, the polynucleotide sequence can contain a sequence complementary to the RNA sequence, such as an antisense RNA sequence, and the antisense RNA can be applied to an individual to inhibit the expression of complementary polynucleotides in individual cells.

[0108] For example, the heterologous gene is an AIMP-2 splice variant having a deletion of exon 2, and the miR-142-3p target sequence can be linked to the 3'UTR of the heterologous gene. The sequence of AIMP2 protein (312aa version: AAC50391.1 or GI: 1215669; 320aa version: AAH13630.1, GI: 15489023, BC013630.1) has been described in the literature (312aa version: Nicolaides, NC, Kinzler, KW and Vogelstein, B. Analysis of the 5' region of PMS2 reveals heterogeneous transcripts and a novel overlapping gene, Genomics 29(2), 329-334(1995) / 320aa version: Generation and initial analysis of more than 15,000 full-length human and mouse cDNA combinations, Proc. Natl. Acad. Sci. USA 99(26), 16899-16903(2002)).

[0109] The term "AIMP2 splice variant" refers to a variant resulting from a partial or complete deletion of exon 2 in exons 1 to 4. Therefore, this variant interferes with the normal function of AIMP2 by forming AIMP2 proteins and heterodimers. The injected AIMP2-DX2 gene is rarely expressed in tissues other than the injected tissue. However, as an additional safety measure, the miR142 target sequence can be inserted to completely block the possibility of AIMP2-DX2 expression in hematopoietic cells, the main population of non-neuronal cells in the injected tissue area.

[0110] The recombinant vector may include SEQ ID NOs: 1 and 5.

[0111] The terms "percent sequence homology", "percent identity" or "percent identical" to a nucleotide or amino acid sequence can be determined, for example, by comparing two optimally aligned sequences to a comparison region, and some nucleotide sequences in the comparison region may include additions or deletions (i.e., gaps) compared to the reference sequence on the optimal alignment of the two sequences (excluding additions or deletions).

[0112] The proteins disclosed herein include not only those having their native type amino acid sequences but also those having variant amino acid sequences.

[0113] A protein variant refers to a protein having a different sequence due to the deletion, insertion, non-conservative or conservative substitution, or a combination thereof of the natural amino acid sequence and one or more amino acid residues. It has been shown in the relevant field that amino acid exchanges in proteins and peptides do not change the activity of the entire molecule (H. Neurath, RL Hill, The Proteins, Academic Press, New York, 1979).

[0114] The protein or its variant can be produced by natural extraction, synthesis (Merrifield, J. Amer. Chem. Soc. 85: 2149-2156, 1963) or gene recombination based on DNA sequence (Sambrook et al., Molecular Cloning, Cold Spring Harbour Laboratory Press, New York, USA, 2nd edition, 1989).

[0115] Amino acid mutations can occur based on the relative similarity of amino acid side chain substituents, such as hydrophilicity, hydrophobicity, charge, and size. Based on the analysis of the size, shape, and type of amino acid side chain substituents, it can be seen that arginine, lysine, and histidine are positively charged residues; alanine, glycine, and serine have similar sizes; and phenylalanine, tryptophan, and tyrosine have similar shapes. Therefore, based on these considerations, arginine, lysine, and histidine; alanine, glycine, and serine; phenylalanine, tryptophan, and tyrosine can be considered biologically functional equivalents.

[0116] When introducing one or more mutations, the hydrophobicity index of the amino acids can be considered. A hydrophobicity index is assigned to each amino acid based on hydrophobicity and charge: isoleucine (+4.5); valine (+4.2); leucine (+3.8); phenylalanine (+2.8); cysteine ​​(+2.5); methionine (+1.9); alanine (+1.8); glycine (-0.4); threonine (-0.7); serine (-0.8); tryptophan (-0.9); tyrosine (-1.3); proline (-1.6); histidine (-3.2); glutamic acid (-3.5); glutamine (-3.5); aspartic acid (-3.5); asparagine (-3.5); lysine (-3.9); and arginine (-4.5)

[0117] The hydrophobic amino acid index is very important in conferring interactive biological functions to proteins. Only when amino acids with similar hydrophobicity indexes are substituted, similar biological activities are possible. In the case of introducing mutations by reference to the hydrophobicity index, substitutions occur between amino acids whose hydrophobicity index differences are within ±2, ±1, or ±0.5.

[0118] At the same time, it is also known that substitutions between amino acids with similar hydrophilicity values ​​can induce proteins with equivalent biological activities. As shown in U.S. Pat. No. 4,554,101, the following hydrophilicity values ​​are assigned to each amino acid residue: arginine (+3.0); lysine (+3.0); aspartic acid (+3.0±1); glutamic acid (+3.0±1); serine (+0.3); asparagine (+0.2); glutamine (+0.2); glycine (0); threonine (-0.4); proline (-0.5±1); alanine (-0.5); histidine (-0.5); cysteine ​​(-1.0); methionine (-1.3); valine (-1.5); leucine (-1.8); isoleucine (-1.8); tyrosine (-2.3); phenylalanine (-2.5); tryptophan (-3.4).

[0119] When introducing one or more mutations by reference to the hydropathic value, substitutions can be made between amino acids whose hydropathic values ​​differ by ±2, ±1, or ±0.5, but are not limited thereto.

[0120] Amino acid exchanges in proteins do not change the activity of the entire molecule, as has been published in the relevant field (H. Neurath, RL Hill, The Proteins, Academic Press, New York, 1979). The most common exchanges are those between amino acid residues, including Ala / Ser, Val / Ile, Asp / Glu, Thr / Ser, Ala / Gly, Ala / Thr, Ser / Asn, Ala / Val, Ser / Gly, Thy / Phe, Ala / Pro, Lys / Arg, Asp / Asn, Leu / Ile, Leu / Val, Ala / Glu and Asp / Gly. Vector systems can be constructed by various methods published in the relevant industry. Specific methods are described in Sambrook et al. (2001), Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press.

[0121] The vector disclosed herein can be constructed as a typical vector for cloning or expression. In addition, the vector can be constructed with prokaryotic or eukaryotic cells as a host. If the vector is an expression vector and uses a prokaryotic cell as a host, it generally includes a strong promoter (e.g., tac promoter, lac promoter, lacUV5 promoter, 1pp promoter, pL X promoter, pRX promoter, rac5 promoter, amp promoter, recA promoter, SP6 promoter, trp promoter and T7 promoter, etc.) for performing transcription, a ribosome binding site for starting decoding, and a transcription / decoding termination sequence. When Escherichia coli (e.g., HB101, BL21, DH5a, etc.) is used as a host cell, the promoter and operator site of the Escherichia coli tryptophan biosynthetic pathway (Yanofsky, C. (1984), J. Bacteriol., 158: 1018-1024) and the left-hand promoter of phage X (pLX promoter, Herskowitz, I. and Hagen, D. (1980), Ann. Rev. Genet., 14: 399-445) can be used as control sites.

[0122] Also, the vector that can be used may be of more than one type, such as a viral vector, linear DNA, or plasmid DNA.

[0123] "Viral vector" refers to a viral vector capable of delivering genes or genetic material to desired cells, tissues and / or organs.

[0124] Although the viral vector may include one or more of adenovirus, adeno-associated virus, lentivirus, retrovirus, HIV (human immunodeficiency virus), MLV (murine leukemia virus), ASLV (avian sarcoma / leukemia), SNV (spleen necrosis virus), RSV (Rous sarcoma virus), MMTV (mouse mammary tumor virus) and herpes simplex virus, it is not limited thereto. In some embodiments, the viral vector may be an adeno-associated virus (AAV), adenovirus, lentivirus, retrovirus, vaccinia virus or herpes simplex virus vector.

[0125] Although retroviruses have the function of integrating into the host cell genome and are harmless to the human body, they may have the characteristics of inhibiting the function of normal cells when integrated, the ability to infect cells of different ranges, easy proliferation, accommodating foreign genes of about 1-7kb and producing replication-defective viruses. However, retroviruses also have disadvantages, including the difficulty of infecting cells after mitosis, gene delivery under in vivo conditions, and the need to proliferate somatic cells under in vitro conditions. In addition, retroviruses have the risk of spontaneous mutations because they can be integrated into proto-oncogenes, which may cause cell necrosis.

[0126] At the same time, adenovirus has various advantages as a cloning vector, including replication even in the nucleus of cells of medium size, clinically non-toxic, stable even if external genes are inserted, no gene rearrangement or loss, transformation of eukaryotic organisms, and stable high-level expression even when integrated into host cell chromosomes. Good host cells for adenovirus are cells that cause human hematopoiesis, lymphoma and myeloma. However, since it is linear DNA, proliferation is difficult, and the virus infection rate is low, and it is not easy to recover the infected virus. In addition, the expression of the delivered gene is most extensive during 1-2 weeks, and only in some cells, expression continues for more than 3-4 weeks. Another problem is that it has high immunogenicity.

[0127] Adeno-associated virus (AAV) has gained popularity in recent years because it can overcome the above problems and has many advantages as a gene therapy agent. It is also called adenosatellite virus. Adeno-associated virus particles have a diameter of 20nm and are known to be almost harmless to the human body. Therefore, it has been approved for sale as a gene therapy agent in Europe.

[0128] AAV is a single-stranded provirus that requires a helper virus for replication. The AAV genome has 4,680bp and can be inserted into a specific region of chromosome 19 of the infected cell. The transgene is inserted into the plasma DNA by connecting two inverted terminal repeat (ITR) sequence segments of 145bp each and a signal sequence segment. Transfection is performed together with other plasmid DNA expressing AAV rep and cap segments, and adenovirus is added as a helper virus. AAV has the advantages of a wide range of host cells for delivering genes, low immune side effects when repeatedly administered, and a long gene expression cycle. Moreover, even if the AAV genome is integrated into the chromosome of the host cell, it will not change or rearrange the host's gene expression, which is also safe.

[0129] A total of four serotypes of adeno-associated viruses are known. Of the many adeno-associated virus serotypes that can be used to deliver target genes, the most widely studied vector is adeno-associated virus serotype 2, and is currently used to deliver clinical genes for cystic fibrosis, hemophilia, and Canavan's disease. In addition, recently, recombinant adeno-associated virus (rAAV) has shown increasing potential in the field of cancer gene therapy (Du 2013). In some embodiments, adeno-associated virus serotype 2 can be used. Although suitable viral vectors can be selected and applied, they are not limited thereto.

[0130] In addition, if the vector is an expression vector and a eukaryotic cell is used as a host, a promoter derived from a mammalian cell genome (e.g., a metallothionein promoter) or a promoter derived from a mammalian virus (e.g., a post-adenovirus promoter, a vaccinia virus 7.5K promoter, an SV40 promoter, a cytomegalovirus promoter, and an HSV TK promoter) can be used. Specifically, although it may include one or more selected from a retrovirus LTR, a cytomegalovirus (CMV) promoter, a Rous sarcoma virus (RSV) promoter, an MT promoter, an EF-1α promoter, an UB6 promoter, a chicken β-actin promoter, a CAG promoter, an RPE65 promoter, and an opsin promoter, it is not limited thereto. In addition, it generally has a polyadenylation sequence as a transcription termination sequence.

[0131] The carrier disclosed herein can be fused with other sequences as needed to make the purification of protein easier. Although fusion sequences such as glutathione S-transferase (Pharmacia, USA), maltose binding protein (NEB, USA), FLAG (IBI, USA) and 6xHis (six histidine; Qiagen, USA) etc. can be used, it is not limited to these. In addition, the expression vector can include a tolerance gene to an antibiotic, which is usually used as a selective marker in the corresponding industry, for example, including ampicillin, gentamicin, carbenicillin, chloramphenicol, streptomycin, kanamycin, geneticin, neomycin and tetracycline.

[0132] Furthermore, disclosed herein is a gene vector including a recombinant vector comprising a target sequence (miR-142-3pT and / or miR-142-5pT) of miR-142 (eg, miR-142-3p and / or miR-142-5p).

[0133] The term "gene transfer" generally includes the delivery of genetic material to cells for transcription and expression. This method is well suited for protein expression and therapeutic purposes. A variety of delivery methods have been published, such as DNA transfection and viral transduction. It refers to virus-mediated gene transfer because it is possible to target specific receptors and / or cell types through high delivery efficiency and high levels of expression of the delivered gene and, if necessary, natural friendly or pseudotypes.

[0134] The gene carrier can be a transformation entity, which has been transformed into a recombinant vector, and the transformation includes all methods of introducing nucleic acids into organic entities, cells, tissues or organs, and as published in the corresponding field, suitable standard techniques can be selected and performed according to the host cell. Although these methods include electroporation, protoplast fusion, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, mixing with silicon carbide fibers, Agrobacterium-mediated transformation, PEG, dextran sulfate and lipofectamin, etc., they are not limited to these.

[0135] The gene vector is intended to express heterologous genes in neurons. Therefore, it inhibits the expression of heterologous genes in CD45-derived cells and can increase the expression of heterologous genes in brain tissue. The majority of CD45 is a transmembrane protein tyrosine phosphatase located in hematopoietic cells. Cells can be defined based on the molecules located on the cell surface, and CD45 is a cell marker for all leukocyte populations and B lymphocytes. This gene vector is not expressed in CD45-derived cells, especially in cells in the lymphocyte and leukocyte range.

[0136] The gene vector may further include a carrier, excipient or diluent that allows pharmacological use.

[0137] Furthermore, disclosed herein is a method for delivering and expressing heterologous genes in neurons, which comprises the stage of introducing a recombinant vector into the corresponding entity.

[0138] The delivery methods disclosed herein can increase heterologous gene expression in brain tissue and control heterologous gene expression in other tissues.

[0139] In addition, disclosed herein is a vector comprising: 1) a promoter; 2) a nucleotide sequence encoding a target protein, which is linked to the promoter to enable operation; and 3) an expression cassette, which includes a nucleotide sequence targeting miR-142-3p inserted into the 3'UTR of the nucleotide sequence. In some embodiments, the vector may include 1) a promoter; 2) a nucleotide sequence encoding a target protein, which is linked to the promoter to enable operation; and 3) an expression cassette, which includes a nucleotide sequence targeting miR-142-5p inserted into the 3'UTR of the nucleotide sequence.

[0140] The term "expression cassette" refers to a unit box that is operably connected to the downstream of a signal peptide and can be expressed to produce and secrete a target protein, which includes a gene encoding the target protein and a nucleotide sequence encoding a promoter and a signal peptide. The secretory expression cassette can be used in combination with a secretion system. Such an expression cassette may include various factors inside or outside that can help effectively produce the target protein.

[0141] Furthermore, disclosed herein is a preventive or therapeutic agent for retinal degenerative diseases, comprising a nucleotide sequence encoding an AIMP-2 splice variant having an exon 2 deletion and a nucleotide sequence targeting miR-142-3p linked to the 3'UTR of the nucleotide sequence.

[0142] Therefore, also disclosed herein is a method for treating a retinal degenerative disease in an individual in need thereof, comprising administering any carrier disclosed herein. In some embodiments, the retinal degenerative disease does not include AMD. AMD can be wet AMD. In some embodiments, AMD is dry AMD.

[0143] The vectors disclosed herein may affect, but are not limited to, apoptosis inhibition, movement disorder improvement, and / or oxidative stress inhibition, and thus prevent or treat retinal degenerative diseases.

[0144] The term "treatment" includes not only complete treatment of retinal degenerative diseases, but also partial treatment, improvement and / or alleviation of overall symptoms of AMD as a result of use of the medicament disclosed herein.

[0145] The term "prevention" means preventing the occurrence of overall symptoms of retinal degenerative diseases by applying the agents disclosed herein to entities suffering from degenerative brain disorders to inhibit or block symptoms or phenomena such as cognitive impairment, behavioral disorders, and brain nerve damage.

[0146] In addition to the agents disclosed herein, adjuvants other than active ingredients may be contained. Although any adjuvant may be used without limitation as long as it is known in the corresponding technical field, immunity may also be increased by including, for example, Freund's complete and incomplete adjuvants.

[0147] Medicament disclosed herein can be prepared in the form of active ingredient mixed with pharmacologically allowed carrier. In this article, pharmacologically allowed carrier includes commonly used carrier, excipient and diluent in the field of pharmacology. The pharmacologically allowed carrier that can be used for medicament disclosed herein includes lactose, glucose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum arabic, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methylcellulose, polyvinylpyrrolidone, water, methyl hydroxybenzoate, propyl hydroxybenzoate, talcum powder, magnesium stearate and mineral oil, but is not limited to these.

[0148] The medicaments disclosed herein can be manufactured and used in various forms according to their respective general manufacturing methods, including oral administration types such as powders, granules, pills, capsules, suspension solutions, emulsions, syrups and aerosols, as well as external preparations, suppositories or sterile injections, etc.

[0149] When making preparations, commonly used diluents or excipients such as fillers, extenders, adhesives, humectants, disintegrants and surfactants can be used for manufacturing. Oral administration solid preparations include pills, tablets, powders, granules and capsules, and this solid preparation can be prepared by mixing more than one excipient such as starch, calcium carbonate, sucrose, lactose and gelatin with active ingredients. In addition, in addition to simple excipients, lubricants such as magnesium stearate and talcum can also be used. Oral administration liquid preparations include suspensions, oral solutions, oils and syrups, etc., which contain various excipients such as humectants, sweeteners, flavorings and preservatives in addition to commonly used diluents water and liquid paraffin. Non-oral administration preparations include sterile aqueous solutions, non-aqueous solvents, suspending agents, oils, lyophilized agents and suppositories. Vegetable oils such as propylene glycol, polyethylene glycol and olive oil, and injectable esters such as glycolic acid esters can be used as non-aqueous solvents and suspensions. Agents for suppositories may include Witepsol, Tween 61, cocoa butter, laurel oil, and glycerinated gelatin, among others.

[0150] The agents disclosed herein can be administered to entities via a variety of routes. All administration forms can be used, such as oral administration and intravenous, intramuscular, subcutaneous and intraperitoneal injections.

[0151] In some embodiments, the recombinant vector is administered to the individual topically by intravitreal injection, subconjunctival injection, or into the subretinal space.

[0152] The methods disclosed herein may further comprise administering to the individual an additional therapeutic agent. In some embodiments, the additional therapeutic agent is ranibizumab, aflibercept and / or bevacizumab.

[0153] The desired administration dose of the therapeutic agent disclosed herein varies depending on various factors including the preparation production method, administration form, age, weight and sex of the patient, degree of symptoms of the disease, food, administration period, administration route, discharge rate and reaction sensitivity, etc. However, it can be appropriately selected by the corresponding manufacturer.

[0154] In addition, for the therapeutic effect, a skilled physician can specifically determine and prescribe an effective dose for treatment. For example, the treatment route may include, but is not limited to, subretinal, intravitreal, intravenous, subcutaneous, and intramuscular injections, as well as direct injection into the eye, cerebral ventricle, or spinal cord using a microneedle. In some embodiments, the dose per eye may be 1×10 8 vg (viral genome) to 1×10 11 vg, 1×10 8 vg to 1×10 10 vg, 1×10 8 vg to 1×10 9 vg and any specific dose or dose range therein, e.g., 2×108 vg to 5×10 8 vg, 2×10 9 vg to 4×10 10 vg, 4×10 8 vg to 6×10 10 vg, 5×10 8 vg to 4×10 10 vg, 5×10 8 vg to 1×10 11 vg, 1×10 9 vg to 5×10 10 vg, 2×10 9 vg to 1×10 10 vg, 5×10 9 vg to 1×10 10 vg or 5×10 9 vg to 8×10 10 Multiple injections and repeated administrations per day are possible, for example, the effective dose may be, for example, 0.05 to 15 mg / kg in the case of a vector and 5 × 10 11 to 3.3×10 14 Virus particles (2.5×10 12 to 1.5×10 16 IU) / kg, and 5×10 2 Up to 5×10 7 Ideally, the dose is 0.1 to 10 mg / kg in the case of vectors and 5 × 10 cells / kg in the case of recombinant viruses. 12 to 3.3×10 13 Particles (2.5×10 13 to 1.5×10 15 IU) / kg, and in the case of cells the dose was 5×10 3 Up to 5×10 6 cells / kg, administered 2 to 3 times a week. The dose is not strictly limited. Instead, it can be adjusted according to the patient's condition and the degree of neurological disorder. Other effective doses for subcutaneous fat and intramuscular injection directly into the affected area are 9×10 10 to 3.3×10 14 recombinant virus particles, 10 cm apart, 2 to 3 times a week. The dosage is not strictly limited. Instead, it can be adjusted according to the patient's condition and the degree of neurological disorder. More specifically, the drug disclosed herein may include 1×10 10 Up to 1×10 12 vg (viral genome) / mL of recombinant adeno-associated virus, and it is usually recommended to inject 1×10 every 2 days for 2 weeks.12 vg. The dose may be administered once daily or divided into several doses throughout the day. In some embodiments, the carrier may be administered at 0.1×10 8 vg to 500×10 8 vg, 1×10 8 vg to 100×10 8 vg, 1×10 8 vg to 10×10 8 vg, for example, 5×10 8 vg or any specific amount or range of dosages derived therefrom. For IV injection, for example, vg can be converted to a dose for humans based on body weight for IV injection. For local tissue injection, for example, vg can also be converted to a dose for humans based on the number of target cells and the effective MOI (multiplicity of infection).

[0155] In some embodiments, the vectors disclosed herein can be injected into the individual, for example, subretinal, intravitreal, or subchoroidally. The injection can be in the form of a liquid. In other embodiments, the vectors disclosed herein can be administered to the individual in the form of eye drops or ointments.

[0156] Nucleic acid molecules comprising AIMP2-DX2, such as vectors, can be delivered by methods well known in the art. Nucleic acid molecules comprising AIMP2-DX2 can also be optionally combined with other gene or nucleic acid delivery tools or materials. Delivery methods may include, but are not limited to: viral vectors and non-viral vectors; chemical conjugation with N-acetylgalactosamine (Galnac), cell penetrating peptides, nucleic acid or glycopeptide-mediated tools or synthetic compound carriers; lipid-mediated delivery, such as lipid nanoparticle encapsulation; inorganic carrier-mediated delivery, such as inorganic carriers; biological delivery, such as exosome-mediated delivery; physical delivery, such as by micro / nano needles, pressure perfusion, microparticles, electrical energy / electroporation / iontophoresis, sonoporation, magneto-poration or photo-poration / photodynamic energy.

[0157] The pharmaceutical preparation can be prepared into various oral and non-oral administration forms. In some embodiments, the carrier disclosed herein can be administered to the brain or spinal cord. In some embodiments, the carrier disclosed herein can be administered to the brain by stereotaxic injection.

[0158] Orally administered preparations include pills, tablets, hard and soft capsules, liquids, suspensions, oils, syrups and granules, etc. In addition to active ingredients, these agents may include diluents (e.g., lactose, glucose, sucrose, mannitol, sorbitol, cellulose and / or glycine) and glidants (e.g., silicon dioxide, talcum powder and stearic acid and its magnesium salt or calcium salt, and / or polyethylene glycol). In addition, pills may contain adhesives such as magnesium aluminum silicate, starch paste, gelatin, tragacanth, methylcellulose, sodium carboxymethylcellulose and / or polyvinylpyrrolidone, and may contain disintegrants such as starch, agar, alginic acid or its sodium salt or similar mixtures and / or absorbents, colorants, flavorings and sweeteners, depending on the circumstances. These agents may be manufactured by general mixing, granulation or coating methods.

[0159] In addition, injection is a representative form of non-oral administration preparations. The solvent used for this injection includes water, Ringer's solution, isotonic saline and suspension. The sterilized fixed oil of injection can be used as solvent or suspension medium, and any non-irritating fixed oil includes glycerol monooleate and diglyceride and can be used for this purpose. In addition, injection can use fatty acid, such as oleic acid.

[0160] The present invention is explained in more detail by using the following examples. However, the following examples are only for illustrating the content of the present invention, and the application of the present invention is not limited to these examples. Example Example 1. Preparation of recombinant vector

[0161] The major part of CD45 is the transmembrane protein tyrosine phosphatase of hematopoietic cells, which can be used to define cells according to the molecules on the cell surface.CD45 is a marker for all leukocyte populations and B lymphocytes.Recombinant vectors that are specifically expressed only in neurons and not expressed in CD45 derived cells (particularly lymphoid and leukocytes) have been prepared.The recombinant vector contains a splice variant in which exon 2 of aminoacyl-tRNA synthetase complex interaction multifunctional protein 2 (AIMP2) has been deleted and a miRNA that can control the expression of AIMP2 splice variants.

[0162] The recombinant vector was generated as a distribution safety measure to induce expression of the AIMP2 splice variant specifically in the injected neuronal tissue. This was also done to completely block any possibility of AIMP2-DX2 expression in hematopoietic cells, which are the major population of non-neuronal cells in the injected tissue area. Example 1-1. Generation of AIMP2 variants

[0163] AIMP2 is one of the proteins involved in the formation of aminoacyl-tRNA synthetase (ARS) and acts as a multifactorial apoptotic protein. In order to construct a plasmid expressing a variant in which exon 2 of AIMP2 has been deleted, the cDNA of the AIMP2 splice variant was cloned into pcDNA3.1-myc. After the AIMP2 splice variant was amplified by using a primer with EcoR1 and Xho1 joints connected to the H322 cDNA, the subclone in pcDNA3.1-myc was carried out by using EcoR1 and Xho1.

[0164] An AIMP2 variant having the nucleotide sequence of SEQ ID NO: 1 and the amino acid sequence of SEQ ID NO: 2 was used. Example 1-2. Isolation of miRNA and selection of its target sequence

[0165] As a distribution safety measure, recombinant vectors were generated as described above to limit the expression of the AIMP2 variant to the injected neuronal cells and completely block the possibility of AIMP2-DX2 expression in hematopoietic cells, the major population of non-neuronal cells in the injected tissue area.

[0166] To this end, miR-142-3p, which is specifically expressed only in hematopoietic cells of proliferative leukocytes and lymphoid-related cells, was selected as a target. To generate sequences targeting only miR-142-3p, microarray data of mouse B cells and sequences derived from miR - Computer programming of genes targeted by 142-3p (mirSVR scoring). miR-142-3p is the nucleotide sequence shown in SEQ ID NO: 5. The miR-142-3p target sequence of SEQ ID NO: 5 binds to miR-142-3p.

[0167] The target sequence of miR-142-3p includes Nhe 1 and Hind III, Bmt 1 site sequence (ccagaagcttgctagc; SEQ ID NO: 21) and Hind H site sequence (aagcttgtag; SEQ ID NO: 22). miR-142-3pT may include the nucleotide sequence of SEQ ID NO: 5 repeated 4 times and a linker (tcac and gatatc) connecting them ( FIG. 4 ; SEQ ID NO: 6). Example 1-3. Production of recombinant vector

[0168] To generate a recombinant vector, the miR-142-3p target sequence (SEQ ID NO: 5) was inserted into the 3'UTR of the AIMP2 variant (SEQ ID NO: 1). The connection between the AIMP2 variant and the miR-142-3p target sequence is represented by base sequence number 6, and, specifically, by cutting and inserting using the Nhe I and Hind III sites. The recombinant vector is shown in FIG. Figure 1 shown. Example 1-4. Confirmation of in vitro neuronal cell-specific expression of recombinant vector

[0169] Since miR142-3p is specifically expressed only in hematopoietic cells, the expression level of AIMP2 variants in specific cells was confirmed by knocking down the AIMP2 variants according to the expression of the miR142-3p target sequence of the recombinant vector.

[0170] Specifically, there are groups with untreated recombinant vectors (SHAM), blank / control vector-treated groups (NC vectors), single AIMP2 variant vector-treated groups (pscAAV_DX2), and groups treated with recombinant vectors (pscAAV-DX2-miR142-3pT). The concentrations of all vectors are in μg / μl, and each group is treated with 2.5 μl (2.5 μg). In each treatment group, THP-1 cell lines (human leukemia mononuclear cells) and SH-SY5Y cell lines (neuroblastoma) were treated to confirm the knockdown of AIMP2 variants. qPCR was performed using the primers in Table 1 below (denaturation for 15 seconds, annealing and extension at 60°C for 30 seconds, and more than 40 cycles). Table 1

[0171] The results confirmed that the AIMP2 variant was not expressed in the SHAM and NC vector groups. In addition, it was confirmed that the AIMP2 variant was expressed in both the THP-1 cell line and the SH-SY5Y cell line in the group treated with a single AIMP2 variant vector (pscAAV-DX2), confirming that the neural cell-specific expression was not induced. On the other hand, it was confirmed that the AIMP2 variant was specifically expressed only in the SH-SY5Y cell line in the group treated with the recombinant vector ( Figure 2 ). Examples 1-5. Materials and Methods Example 1-5-1. qRT-PCR

[0172] Total RNA was isolated from the spinal cord using TRIzol (Invitrogen, Waltham, MA, USA) according to the manufacturer's protocol. The extracted RNA was quantified using a spectrophotometer (ASP-2680, ACTgene, USA). To prepare cDNA, reverse transcription was performed using SuperScript III First-Strand (Invitrogen) according to the manufacturer's protocol. The resulting cDNA was used for real-time PCR using SYBR green PCR master mix (ThermoFisher Scientific, USA). The expression data of the replicate results were used for 2-ΔΔCt statistical analysis and normalized with GADPH expression. Example 1-5-2. miR142-3p inhibition experiment

[0173] The inhibition of DX2 expression by miR-142-3p can be observed from the ×1 miR-142-3p target sequence. HEK293 cells were transiently transfected with ×1, ×2, and ×3 repeat miR-142-3p target sequence vectors and 100 pmol miR-142-3p using lipofectamine 2000 (Invitrogen, USA) and then incubated for 48 hours. The amount of DX2 mRNA was analyzed by PCR. From the Tseq ×1 repeat miR142 3p target sequence ( Figure 4B ) The inhibition of DX2 expression by miR142-3p was observed. Example 1-6. Three (3) types of vectors generated to inhibit the action of core binding sequences

[0174] Tseq×1 contains 1 core binding sequence, Tseq×2 contains 2 core binding sequences, and Tseq×3 contains 3 core binding sequences ( Figure 4A ).

[0175] Inhibition of DX2 expression by miR142-3p (100 pmol) was observed starting from ×1 repeat of the miR142-3p target sequence. HEK293 cells were transiently transfected with ×1, ×2, and ×3 repeats of miR-142-3p T Seq vector and 100 pmol of miR-142-3p using lipofectamine 2000 (Invitrogen, USA), and then incubated for 48 hours. The amount of DX2 mRNA was analyzed by PCR. When the number of core binding sequences in the miR142-3p target sequence increased, the inhibition of DX2 expression by miR142-3p also increased. The vector containing the Tseq×3 core sequence showed a significant inhibitory effect ( Figure 4B ) Example 1-7. Core sequence mutation

[0176] The core sequence was predicted using mouse B cell microarray data and the mirSVR scores of miR-142-3p target genes. The following substitutions were made in the four regions of the core sequence: (5'-AACACTAC-3'→5'-CCACTGCA-3') (see Figure 3 The original sequence and Figure 4A Schematic diagram). Example 1-8. The core binding sequence is important for DX2 inhibition

[0177] Four core sequences were replaced ( Figure 4A HEK293 cells were transiently transfected with DX2-miR-142-3p T Seq × 3 repeat vector (Tsq3×) or core sequence mutant vector (mut) and 100 pmol miR-142-3p by using lipofectamin 2000 (Invitrogen, USA), and then incubated for 48 hours. The expression of DX2 mRNA was analyzed by PCR. The Tseq × 3 repeat vector ( Figure 4B ) and DX2 constructs were used as controls. Treatment with 100 pmol miR142-3p had a significant inhibitory effect on the Tseq×3 vector, but had no inhibitory effect on the DX2 and mut sequences ( Figure 5 ). Example 2. Treatment of RP (Retinitis Pigmentosa)

[0178] To explore the possibility of safe and specific targets for the treatment of RP (retinitis pigmentosa), AIMP2 was considered as a target for inhibiting cell death. AIMP2 accumulation leads to poly (ADP-ribose) polymerase-1 (PARP-1) activation and subsequent neuronal degeneration: DX2 impairs the pro-apoptotic activity of AIMP2 by competitively inhibiting the binding of AIMP2 to PARP-1.

[0179] Poly(ADP-ribose) polymerase-1 (PARP-1) is the most studied member of the PARP family (also known as ADPRT, PARS, ART), which includes 17 members responsible for the synthesis of poly(ADP-ribose) (PAR). Kim JH et al. (2014). PARP enzymes are involved in DNA repair, where they are activated by single and double DNA strand breaks. Their involvement in DNA repair appears to require the addition of PAR chains to the PARP enzyme itself or to other proteins involved in the repair process (herein referred to as polyribosylation). Kim JH et al. (2014). In addition, abnormal activation of PARP-1 has been associated with pathological processes such as stroke, trauma, diabetes and Parkinson's disease (Ko HS et al. (2005); Corti O. et al. (2003); Ko HS et al. (2010)), and in this or similar cases, excessive accumulation of PAR may lead to a different type of cell death - dependent cell death (parthanatos). Narne P et al. (2017); and Mao K et al. (2022). In this case, excessive PARylation can relocate apoptosis-inducing factor (AIF) from mitochondria to the nucleus, further accelerating DNA fragmentation and cell death. Hone SJ et al. (2004); Narne P et al. (2017); Mao K et al. (2022); Szabo C et al. (1996); Virag L et al. (1988). Excessive PARP activity also appears in photoreceptor cell death in several RP rat and mouse models, which increases PARylation levels in degenerating photoreceptors. Sahaboglu A et al. (2017).

[0180] Therefore, the efficacy of DX2 in inhibiting the function of AIMP2 in PARP-1 hyperactivation was tested. First, to investigate whether DX2 is a competitive inhibitor of AIMP2 and regulates neuronal cell death, SH-SY5Y cells were co-transfected with PARP-1, AIMP2, and DX2 expression plasmids, and PARP-1 was immunoprecipitated. Fig. 7A As shown, DX2 binds to PARP-1 more strongly than AIMP2.

[0181] To determine whether intracellular DX2 protein levels affect the binding of PARP-1 and AIMP2, DX2 overexpression plasmid ( Figure 7B ) or DX2 siRNA( Figure 7C) was transfected into neuroblastoma SH-SY5Y cells. In this assay, SH-SY5Y cells were transfected with vehicle (Con) or DX2 expression (DX2) plasmids, incubated for 24 hours and lysed. Cell lysates were incubated with protein agarose beads to immunoprecipitate PARP-1-bound AIMP2 and analyzed by immunoblot analysis ( Figure 7B ). Similarly, DX2 siRNA (DX2) and control siRNA (Con) were transfected into SH-SY5Y cells and incubated for 48 hours, followed by immunoprecipitation and immunoblotting analysis ( Figure 7C ).

[0182] The binding amount of AIMP2 to PARP-1 was reduced in cells overexpressing DX2 ( Figure 7B ), but in DX2 knockdown cells, the binding of AIMP2 to PARP-1 increased ( Figure 7C ), indicating that DX2 expression plays a key role in the interaction between PARP1 and AIMP2.

[0183] To elucidate the mechanism by which DX2 regulates PARP-1 cleavage (e.g., PARP-1 activation) under oxidative stress conditions, the binding affinity of AIMP2 and DX2 was assessed. AIMP2 and / or DX2 expression vectors were introduced into HEK 293 cells. The cells were incubated for 24 hours, lysed, and immunoprecipitated.

[0184] When AIMP2 was expressed alone, the formation of AIMP2 homodimers was observed. However, the amount of DX2 homodimers was significantly lower compared to AIMP2-AIMP2 homodimers or AIMP2-DX2 heterodimers ( Figure 7D-7E , the third lane in the upper left panel). Taken together, these observations suggest that DX2 prefers to bind to AIMP2 and inhibits AIMP2-induced cell death.

[0185] PARylation is a post-translational process that regulates biological events such as DNA damage response and apoptosis. Szabo C et al. (1996) and Virag l et al. (1998). PARP-1 is an enzyme that recognizes damaged DNA in the nucleus, forms PAR chains, and induces degradation of damaged proteins and cell death through polyribosylation (PARylation). To evaluate how AIMP2 or DX2 affects PARP-1 activation (e.g., PARP-1 cleavage) and polyribosylation (PARylation) under oxidative stress conditions, SH-SY5Y cells were transfected with vectors expressing empty vector (EV), AIMP2, or DX2, and then treated with hydrogen peroxide (H2O2) for 4 hours. The cells were then lysed and activated PARP-1 protein levels were assessed by Western blot analysis ( Figure 7F ) and polyribosylation (PARylation) ( Figure 7G ) amount.

[0186] Under conditions of oxidative stress, AIMP2-transfected cells showed a significant increase in PARP-1 cleavage compared to the expression observed in the other transfected cells. However, no PARP-1 cleavage was observed in DX2-transfected cells ( Figure 7F ). In the presence of H2O2, the PARylation of AIMP2 increased, but the PARylation of DX2 did not change ( Figure 7G ).

[0187] To examine the protein half-life between AIMP2 and DX2, pulse-chase experiments with cycloheximide treatment were performed. DX2 showed similar stability to full-length AIMP2 until 4 h after de novo protein synthesis was stopped ( Figure 7H ).

[0188] Thus, these results suggest that DX2 is a key factor in neuronal cell viability and that DX2 overexpression can reduce neuronal cell death in neurodegenerative diseases.

[0189] It was observed that when DX2 expression is insufficient, AIMP2 forms homodimers, interacts with PARP-1, activates PARP-1, and induces neuronal cell death. However, because the binding affinity of DX2 to PARP-1 is significantly higher than that of AIMP2, the binding affinity between AIMP2 and PARP-1 is reduced in cells expressing DX2, resulting in inhibition of PARP-1 activity and reduction of neuronal cell death. Therefore, DX2 is the main regulatory protein in AIMP2-induced PARP-1 activation and cell death ( Fig.7I ).

[0190] In conclusion, DX2 impairs the pro-apoptotic activity of AIMP2 by competitively inhibiting AIMP2 binding to PARP-1. Example 3. DX2 alleviates H2O2-induced neuronal cell death

[0191] Based on the above results, DX2 is an inhibitory molecule for oxidative stress-induced PARP-1 cleavage, and whether DX2 inhibits cell death of neuronal cells was further investigated. To examine cell viability under conditions of AIMP2 and DX2 overexpression, AIMP2 or DX2 expression plasmids were introduced into N2A cells (Neuro-2a, a mouse neuroblastoma cell line), and the transfected cells were incubated with 400 μM H2O2 for 4 hours. MTT analysis was performed to determine the level of cell death.

[0192] Under normal conditions, overexpression of AIMP2 or DX2 did not affect cell viability; however, under H2O2 treatment, overexpression of AIMP2 significantly increased cell death, while overexpression of DX2 reduced cell death ( Fig. 8A ).

[0193] To test whether DX2 or AIMP2 controls cell viability under injury-induced cell death conditions, SH-SY5Y cells were co-transfected with EV, AIMP2, and DX2 expression plasmids and treated with 400 μM H2O2 for 4 h. MTT assays were performed to determine cell death. Even when the expression of AIMP2 was increased (1 μg to 2 μg), 1 μg DX2 transfection suppressed AIMP2 / H2O2-induced cell death to a level similar to that of 2 μg DX2 ( Figure 8B In contrast, under DX2-expressing cell conditions (1 μg to 2 μg), AIMP2 expression levels failed to significantly affect neuronal cell death ( Figure 8B ), and cell death was significantly reduced in DX2-expressing cells compared with control cells under oxidative stress conditions ( Figure 8C ). In conclusion, the anti-apoptotic effect of DX2 appears to be much stronger than the apoptosis induced by AIMP2 in the presence of both proteins. Example 4. TRAF-dependent pathway: DX2 impairs the TNF-α-dependent pro-apoptotic activity of AIMP2 by competitively inhibiting the binding of AIMP2 to TRAF2

[0194] DX2 impairs the TNF-α-dependent pro-apoptotic activity of AIMP2 by competitively inhibiting the binding of AIMP2 to TRAF2.

[0195] Ocular inflammation is a common cause of visual impairment. Olivares-Gonzalez L et al. (2021). It is considered a chronic inflammatory condition with persistent activation of glial cells (microglia, astrocytes) and recruitment of other immune cells into neural tissues (brain, spinal cord or retina). Streit WJ (2004). Microglia, innate immune cells resident in the retina and other neural tissues, are potential cellular regulators of inflammation. Karlstetter M et al. (2015). Activated microglia and macrophages secrete proinflammatory mediators such as TNF-α and t on retinal cells (e.g. photoreceptor cells). Murakami Y et al. (2019). In the eye, TNF-α appears to be involved in the pathogenesis of inflammatory, edema, angiogenesis and neurodegenerative diseases. Rodrigues EB et al. (2009).

[0196] In TNF-α signaling, TRAF2 plays a key role in cell death. When TNF-α signaling is activated, TRADD (TNF receptor-associated death domain) and TRAF2 bind to the TNF-α receptor TNFR1, and then the activated complex mediates IκB kinase (IKK) activation. When caspase-8 is inactivated, TRAF2 is released from the TRADD complex, and the released TRAF2 is ubiquitinated by the E3 ubiquitin ligase cIAP, promoting cell death. AIMP2 promotes the ubiquitination of TRAF2 by cIAP, stimulating cell death. Choi JW et al. (2009).

[0197] To understand how DX2 impairs the apoptotic activity of TNF-α signaling, we evaluated the ability of DX2 to compete with AIMP2 for interaction with TRAF2 and affect NF-κB-dependent transcriptional activity. For co-immunoprecipitation assays, HEK293 cells were transfected with 0, 1, or 2 μg of Myc-tagged DX2 or AIMP2 expression plasmids ( Fig.9A ). The expression of endogenous (Endo) and exogenous (Exo) AIMP2 and DX2 was confirmed by immunoblotting whole cell lysates (WCL) using anti-AIMP2 antibody. TRAF2 was immunoprecipitated using a TRAF2-specific antibody, and AIMP2 or DX2 bound to TRAF2 was detected using an anti-Myc antibody.

[0198] To test NF-kB-dependent transcriptional activity, HEK293 cells were transfected with NF-kB luciferase vectors and cells were selected for 1 week with G418 (1 mg / ml) to establish stably expressed cells. After selecting surviving cells, cells were transfected with pcDNA 3.1 empty vector (as a control) or pcDNA3.1 expression vectors encoding AIMP2 or DX2. Sixteen hours later, transfected cells were treated with TNF-α (20 ng / ml) for 12 hours. Cells were harvested and cell lysates were prepared for quantification of luciferase using a luciferase assay kit according to the manufacturer's protocol (Promega).

[0199] As DX2 expression increased, the interaction between AIMP2 and TRAF2 decreased. Conversely, the introduction of AIMP2 inhibited the interaction between DX2 and TRAF2 in a dose-dependent manner ( Fig.9A ). Increased NF-kB activity inhibits the pro-apoptotic signaling of TNF-α. As expected, DX2 increased NF-kB activity, while AIMP2 produced the opposite effect ( Fig. 9B DX2 overexpression abolished TNF-α-induced cell death ( Fig. 9C ).

[0200] Next, to evaluate whether DX2 inhibits TNF-α-dependent neuronal cell death, N2A and mouse primary neuronal cells were transfected with EV (empty vector) or DX2 expression plasmid. Transfected cells were cultured in the presence or absence of TNF-α (20 ng / ml) + cycloheximide (CHX, 10 μM) for 6 h, and then cell viability was evaluated using the MTT assay. Fig. 10A and 10B As shown, DX2 overexpression did not affect the cell viability of N2A or mouse primary neuronal cells under normal conditions (con); however, after TNF-α treatment, cell death of DX2-transfected cells (DX2) was significantly reduced compared with that of EV (empty vector)-transfected cells.

[0201] In conclusion, DX2 competes with AIMP2 and interacts more strongly with TRAF2 than AIMP2, thereby inhibiting AIMP2-stimulated neuronal apoptosis under TNF-α-activated conditions. Example 5. Design of AAV2-DX2: DX2 encodes self-complementary AAV2

[0202] Since retinal degenerative diseases (RDD) are often difficult to treat using conventional pharmacological approaches, more effective strategies are being sought. Among these alternatives, gene therapy could be a minimally invasive strategy for treating RDD and diseases such as RP using subretinal microinjections. Christine CW et al. (2009); Eberling JL et al. (2008); Castle MJ et al. (2020).

[0203] AAV vectors are efficient shuttle vectors capable of delivering transgenes to retinal cells, which have the property of efficient transduction into non-dividing retinal cells. AAV is considered a suitable gene delivery method due to its relative safety (due to lack of pathogenicity). Wang D et al. (2019). This paper investigates the potential of the adeno-associated virus serotype 2 (AAV2) delivery system to effectively deliver the therapeutic gene DX2 to patients with RDD.

[0204] To determine which viral system to use between single-stranded AAV (ssAAV) and self-complementary AAV (scAAV), SH-SY5Y cells were incubated with 10, 100, 1000, or 10 4 The cells were infected with ssAAV-GFP (green fluorescent protein) or scAAV-GFP at an MOI (multiplicity of infection). After 48 hours, GFP expression was detected by microscopy. Fig.11A represents the percentage of GFP-positive cells, and Fig. 11B Microscopic images showing GFP-expressing cells. Fig.11A and 11BIn the present study, when both viruses were used to treat SH-SY5Y at different concentrations, scAAV was more efficient in terms of viral infection rate. Example 6. AAV2-DX2 transduction inhibits cell signaling associated with neuronal death

[0205] To investigate whether AAV2-DX2 impairs H2O2-induced cytotoxicity in MEFs (mouse embryonic fibroblasts), hepatocytes, MSCs (mesenchymal stem cells), and primary neurons (neurons), 10 4 The cells were infected with AAV-DX2 (AAV2-DX2) at a MOI of 1:1 for 48 h. Then, the transduced cells were treated with 400 μM H2O2 for 4 h to induce cell death, and cell viability was measured by MTT assay ( Fig. 12A ).

[0206] AAV2-DX2 transduced cells (DX2) generally showed a significant reduction in cell death when compared to AAV-GFP transduced cells (GFP) after H2O2 treatment ( Fig. 12A ), which means that AAV2-DX2 is an effective anti-apoptotic agent. Interestingly, under normal conditions, the presence or absence of AAV2-DX2 did not affect cell viability ( Fig. 12B ). Therefore, DX2 only functions when stressors induce apoptotic conditions.

[0207] To investigate how DX2 overexpression alters cell signaling in neuronal cells, RNA sequencing was performed on neuronal cells after induction of the DX2 gene via an AAV delivery system. SK-N-SH neuroblastoma cells were infected with scAAV2-GFP or AAV2-DX2. Forty-eight hours after infection, cells were harvested, RNA was isolated, and RNA sequencing was performed. DX2 was predicted to be involved in suppressing p53-related cell death pathways and TNF-α or interleukin-related signaling ( Fig. 12C Based on two cell types SK-N-SH ( Fig.12D ) and N2A( Fig.12E ) analyzed gene sets to assess differentially expressed genes (DEGs) classified into signaling pathways or ontology databases. DX2 appears to be expressed in N2A cells ( Fig.12D ) and SK-N-SH cells ( Fig.12E ) showed a significant downregulation of related genes. The statistical significance is visualized in the distribution of p-values ​​for all pathways after DX2 overexpression ( Figures 12F-12G ). Example 7. DX2 increases the viability of 661W cells, a retinal photoreceptor and ganglion precursor-like cell line

[0208] To investigate whether DX2 can rescue retinal photoreceptors and ganglion neurons from ROS-induced cell death, as described in the above paragraphs for other neuronal cells, we performed cell viability tests on AAV-DX2-infected cells and uninfected cells treated with different concentrations of H2O2. The results showed that cells infected with AAV-DX2 showed greater resistance to H2O2 concentrations and remained viable compared to uninfected cells.

[0209] Fig.13 DX2 was shown to increase the viability of retinal photoreceptor neuronal cells. 661W cells were seeded in 96-well plates at 5×10^4 cells / well and then infected with AAV-DX2 virus at 5000 MOI. After 48 hours, the cells were treated with different concentrations of H2O2. Cell viability was assessed by MTT assay after 24 hours.

[0210] To further examine the anti-apoptotic effect of AAV-DX2, 661W cells were infected with AAV-DX2 and then treated with H2O2 to induce cell death. The mRNA level of the pro-apoptotic marker BAX was assessed. The results showed that in cells infected with the control virus AAV-GFP, BAX levels increased more than 2.5-fold after H2O2 treatment compared with untreated cells. However, in cells treated with AAV-DX2, BAX levels were significantly reduced after H2O2 treatment compared with the AAV-GFP treatment group.

[0211] Fig.14 DX2 was shown to reduce BAX levels induced by H2O2. 661W cells were infected with AAV-GFP or AAV-DX2 at an MOI of 5,000 each. After 72 hours, cells were treated with 2 mM H2O2 for 6 hours and then the RNA level of BAX was assessed. Example 8. DX2 increases the expression level of 67LR in retinal neurons

[0212] To further investigate the anti-apoptotic signaling pathway of DX2, we investigated the regulatory role of DX2 in 67LR. DX2 was overexpressed in 661W, retinal photoreceptor, and ganglion precursor-like cell lines, and changes in 67LR expression were examined. After DX2 overexpression, increases in both 67LR and 37LRP expression were observed ( Fig.15A This observation was further supported when we performed immunofluorescence staining of 67LR in 661W cells under the same experimental conditions. Cells overexpressing DX2 showed a fluorescence intensity approximately 2.5 times stronger than that of non-overexpressing cells ( Fig. 15B ).

[0213] Next, AIMP2 and DX2 were overexpressed and then immunoprecipitated with KRS to evaluate the binding affinity of DX2 and KRS. The results showed that both AIMP2 and DX2 exhibited similar binding affinity to KRS.

[0214] Fig.16 DX2 was shown to bind to KRS similarly to AIMP2. 2 μg of Flag-Tag-AIMP2 and Flag-Tag-DX2 transfected cells were lysed with NP-40 lysis buffer. Subsequently, 15 μl of a mixture of agarose A / G plus beads and KRS antibody was used for pull-down assay.

[0215] As previously reported, H2O2-induced ROS stress leads to a decrease in 67LR, which impairs cell survival signaling and triggers cell death. Yan X et al. (2017). In the case of retinal cell death due to ROS, we examined changes in KRS and the effects of DX2 by infecting 661W cells with AAV-DX2. When treated with the control virus AAV-GFP, a decrease in 67LR levels was observed due to H2O2 treatment, and KRS levels were also decreased. However, when treated with AAV-DX2, there was no decrease in 67LR levels due to H2O2, and no changes in KRS levels were observed ( Fig.17A ).

[0216] To determine where the changes in KRS and 67LR produced the most significant effects in the cytosol or membrane, we analyzed cells after fractionation. The results showed that the decrease in KRS levels caused by H2O2 was not in the cytosol but in the membrane, and that the increase in 67LR levels also occurred in the membrane ( Fig. 17B Together, these results suggest that DX2 binds to KRS, leading to an increase in the membrane form of KRS and, consequently, increased 67LR expression, thereby preventing neuronal cell anoikis. Example 9. In vivo study evaluating the effect of AAV2-DX2 on RDD

[0217] In order to understand the potential efficacy for patients with retinal degenerative diseases, the preventive and therapeutic effects of AAV2-DX2 were evaluated in three RDD animal models in mice and rabbits (i.e., laser-induced choroidal neovascularization, Mdm1- / - (CRISPR / Cas9 KO), and sodium iodate-induced retinal degeneration models). Overall, AAV2-DX2 was determined to be effective in both prevention and treatment. These studies are summarized as follows. Example 9-1. AAV2-DX2 shows the preventive effect of DX2 in the mouse Mdm1- / - (CRISPR / Cas9 KO) model

[0218] Mouse double minute 1 (Mdm1) may be involved in centriole function, structure, and degeneration. Son et al. demonstrated that Mdm1 protein is localized in the connecting cilium (CC) of retinal photoreceptor cells. Loss of Mdm1 transcripts may underlie the mechanism leading to progressive retinal degeneration.

[0219] Mdm1- / - mice were generated using CRISPR / Cas9 and exhibited retinal degeneration and abnormal eye electrophysiology 39 Transduction of AAV-DX2 in the retina resulted in restoration of total neural retinal thickness ( Fig.18B DX2 transduction showed a thicker RPE layer ( Fig. 18C ) and photoreceptor outer segment layer ( Fig.18D ), which means that DX2 expression prevents RPE degeneration and photoreceptor ciliary degradation. DX2 transduction also showed a thicker outer nuclear layer of photoreceptors ( Fig.18E ) and the external network layer ( Fig.18F ), indicating that DX2 expression reduces photoreceptor degeneration.

[0220] Figure 18G The integrity and proliferation of RPE (retinal pigment epithelium) are shown. Transduction of the DX2 gene leads to the restoration of RPE integrity by activating the proliferation of RPE. Fig.18H Restoration of PR (photoreceptors) is shown. Transduction of the DX2 gene leads to restoration of the PR population by activating PR proliferation.

[0221] Fig.18I Cell proliferation of RPE and PR is shown. Ki67 expression was measured to analyze proliferation in RPE and photoreceptor layers. Proliferation in RPE (left panel) and photoreceptor outer segment layer (right panel) was significantly higher in AAV2-DX2 transfected samples.

[0222] Figures 18J-18O AAV2-DX2 transduction showed increased a-wave amplitude compared to the RDD model (mdm1- / -) or negative control (mdm1- / +AAV-GFP) ( Figure 18L ) and latency reduction ( Figure 18M ), indicating that DX2 expression reduced the electrophysiological function of photoreceptors and impaired visual sensitivity. Compared with the RDD model (mdm1- / -), AAV2-DX2 transfected samples did not show changes in b-wave amplitude ( Fig.18N ), but with reduced latency ( Fig.18O ), suggesting that DX2 affects only the RPE and photoreceptors but not the bipolar cells (post-photoreceptor neurons).

[0223] Electroretinograms of AAV2-DX2 transduced samples showed an increase in the restoration of the normal ERG pattern format ( Fig.18J and 18K AAV2-DX2 transduced samples showed slightly increased a-wave amplitude compared to dry AMD (mdm1- / -) ( Figure 18L ) and reduced latency ( Figure 18M ), indicating that DX2 expression reduces the impairment of photoreceptor electrophysiological function. Compared with the RDD model (mdm1- / -), the b-wave amplitude of the samples transduced with AAV2-DX2 did not change ( Fig.18N ), but with reduced latency ( Fig.18O ).

[0224] Survival effects of DX2 on retinal degeneration and anti-apoptotic efficacy of DX2 delivered by adeno-associated virus (AAV) into rabbit retina via SR and IV injections. Example 9-2. Materials and Methods

[0225] 1. Animal experiments (knockout mice)

[0226] For retinal degeneration mouse model experiments, Mdm1- / - (CRISPR / Cas9 KO) mice were generated to present progressive photoreceptor and RPE degeneration. Animals were housed in individual cages in an animal facility under specific pathogen-free conditions and constant environmental conditions (21°C-23°C temperature, 50-60% humidity, and 12-hour light / dark cycle). AAV2-DX2 and negative control (AAV2-GFP) were injected into the subretinal space at 3 weeks of age. Histological measurements and functional recovery of the retina were performed at 3 months of age. A 4 μl volume of AAV2-DX2 / AAV2-GFP was injected into the subretinal space of three-week-old Mdm1- / - mice via transscleral injection using a 38G sterile microneedle (INCYTO, KR) to minimize retinal trauma. AAV2-GFP / DX2 was injected into the same animal. AAV2-GFP was injected into OS (left). AAV2-DX2 was injected into OD (right).

[0227] 2. Electrophysiological Function Assessment

[0228] AAV2-DX2 / AAV2-GFP was injected into the subretinal space of three-week-old Mdm1- / - mice using a 38G sterile microneedle in a volume of 4 μl to minimize retinal trauma. Three-month-old mice were used. For final measurements, WT (n=11), mdm1- / - (n=6), mdm1- / - (AAV2+GFP) (n=6), and mdm1- / - (AAV2+DX2) (n=7) were evaluated. For electroretinograms for photoreceptor function evaluation, electroretinograms were used. HMsERG. Mice were anesthetized by inducing Avertin (1%), maintained by inhalation of 3% isoflurane, and placed on a heating pad to maintain physiological conditions. A drop of 2% hydroxypropyl methylcellulose solution was placed on the rodent contact lens with silver-embedded thread electrode to maintain contact with the cornea and keep the cornea moist. The mice were placed under a 76 mm diameter Ganzfeld dome to maintain darkness and illuminate the eyes evenly. Measurements were performed according to the ISCEV-Extended full-field ERG standards protocols. Data were analyzed using ERGVIEW, and the combined standard Rod & Cone response value was selected for analysis, with a flash intensity of 3000 mcd.s / m2 and 0.10 Hz. A wave analysis was performed for photoreceptor cell function. B wave analysis was performed for bipolar cell and horizontal cell function. The amplitude and latency of the a wave and b wave were analyzed.

[0229] 3. Histological Analysis

[0230] All mice were euthanized after ERG and their eyeballs were collected. The eyeballs were fixed in 4% PFA overnight at 4°C. The eyeballs were dehydrated under 30% sucrose and embedded in OCT compound for tissue cryosectioning. All retinal cryosection samples were obtained from 10 μm thick sections containing the optic nerve. Retinal cryosections were analyzed. H&E was used for layer thickness analysis. Layer thickness analysis was performed using the Leica LAS program. Immunofluorescence was used for RPE65 and opsin expression as well as proliferation assessment (Ki67). Immunofluorescence ROI sets and overlap coefficient measurements were measured using Image J.

[0231] 4. Statistical Analysis

[0232] Primary analysis was performed using Student's t test. P values ​​were compared to mdm1- / -(AAV2+DX2). For recovery assessment, P values ​​were compared to WT. For complete data, Levene's test for homogeneity of variance, ANOVA test, and post hoc analysis (Dunnett (T3), Tukey HSD) evaluation were performed using IBM SPSS statistics 23. Example 10. AAV2-DX2 shows the preventive efficacy of DX2 in a laser-induced choroidal neovascularization (CNV) mouse model Example 10-1. AAV2-DX2-treated mice attenuated laser-induced choroidal neovascularization

[0233] The laser-induced choroidal neovascularization (CNV) model is an animal model widely used for retinal degenerative diseases (RDD). In this model, a laser is used to destroy Bruch's membrane, which allows the underlying choroidal blood vessels to penetrate and grow into the space below the pigment epithelium. Five-week-old male C57BL / 6 mice (n=12) were injected subretinaly with scAAV2-GFP (control) or AAV2-DX2 (day 0). Twenty-one days after injection, CNV was produced by laser coagulation (day 21). Fourteen days after laser treatment, fluorescein angiography and ICG angiography were performed (day 35). The next day, the mice were killed, choroidal flat mounts were made, and stained with (FITC)-coupled isolectin B4 ( Fig.19A )(Day 36). Vascular leakage caused by neovascularization was clearly observed at the site of laser-induced photocoagulation by fluorescein angiography. Choroidal vascular imaging was obtained using ICG angiography. Flat slides were evaluated for the presence and area of ​​clearly defined isolectin-positive CNVs. In fluorescein angiography, DX2 injections showed reduced vascular leakage compared to GFP-injected controls ( Fig.19A ). Similarly, in ICG vascular imaging, DX2-injected mice showed reduced CNV area compared with GFP-injected mice ( Fig.19A In addition, choroidal flat mounts stained with isolectin B4 showed a significant reduction in the area of ​​CNV formation in DX2-injected mice ( Fig.19A ).

[0234] The ratio of leakage area to CNV area was estimated by measuring the total hyperfluorescent area using fluorescein angiography (FA) and the CNV area using ICGA ( Fig.19B The mean CNV area at Bruch's membrane using isolectin B4 staining was also significantly smaller in DX2-injected mice compared to GFP controls (n=12). Fig.19C ). Based on this result, DX2 has a preventive effect in the CNV mouse model. Histologically, inflammatory cells, especially (macrophages), were confirmed to be located near / within degenerative lesions, including Bruch's membrane rupture, RPE atrophy, and CNV areas. (Macrophages) have been shown to secrete pro-angiogenic factors such as VEGF and pro-inflammatory cytokines such as TNF in CNV lesions. Fig.19DIn the present study, the number of inflammatory cells in DX2-injected mice was significantly smaller compared with GFP control CNV cells. Excessive vascular endothelial growth factor (VEGF) triggers the growth and leakage of abnormal blood vessels under the macula, leading to irreversible central vision loss. In this context, many efforts have been made to develop anti-angiogenic therapies targeting VEGF for the treatment of retinal degenerative diseases. These drugs have been shown to slow the progression of RDD and, in some cases, improve visual acuity by inhibiting angiogenesis. In this paper, we treated mice with DX2 before laser-induced choroidal neovascularization and compared VEGF expression in GFP-treated mice (n=6) ( Fig.19E ). DX2-treated mice showed less VEGF expression compared to GFP-treated mice. This data also demonstrates the preventive effect of DX2 on CNV model mice. Example 10-2. Materials and Methods

[0235] 1. Animal experiments (mice)

[0236] Animals were housed in individual cages in an animal facility under specific pathogen-free conditions and constant environmental conditions (21°C-23°C temperature, 50-60% humidity and 12-hour light / dark cycle). The left eye (OS, left eye) of mice in each group was treated with AAV-GFP, while the right eye (OD, right eye) was treated with AAV-DX2. (Injection: 5×10 8 vg). One week and 10 weeks after subretinal injection, laser photocoagulation was used to induce laser induction in the RPE layer of the fundus to establish retinal degenerative disease models at 3 weeks and 3 months, respectively. After 2 weeks and 2 months of laser treatment, the mouse eyeballs were isolated.

[0237] 2. Subretinal Injection Protocol

[0238] Anesthetize the rodent. Replace isoflurane inhalation with an intraperitoneal injection of 100 mg / ml ketamine and 10 mg / ml xylazine (20 μl / 10 g body weight). Pinch one of the animal's paws to ensure that the animal is deeply anesthetized. If it flinch, wait a few minutes, try again, and then start the subretinal injection. Place the rodent on its side with the eye to be injected facing the ceiling. Gently stretch the skin under a dissecting microscope to make the eyeball pop out of the socket slightly (temporary exophthalmos), then hold the head with two fingers, slightly above the ear and close to the jaw, and gently stretch the skin parallel to the eyelid to make the eyeball pop out of the socket slightly. With a 38G sterile microneedle (INCYTO, KR), make a hole just below the limbus at an angle to avoid the needle contacting the lens. Retract the single-use sharp needle from the eye while maintaining a clamp on the head. After mounting the preloaded syringe with a blunt needle on the micromanipulator or holding it by hand, insert the tip of the syringe with a blunt needle through the hole, again being careful not to touch the lens, and gently push it into the eye until resistance is felt. Minimize all movements and carefully and slowly inject the virus into the subretinal space. AAV2-GFP injection into the OS (left). AAV2-DX2 injection into the OD (right). Slowly retract the syringe. Apply eye moisturizing solution to keep the eye moist. Continue to monitor the animal until it regains sternal recumbency.

[0239] 3. Mouse Laser-Induced CNV Model Protocol

[0240] Prior to laser induction in mice, position the laser and slit lamp in an easily accessible location. Turn on the laser and set to predetermined parameters. Anesthetize the rodent. Use an intraperitoneal injection of 100 mg / ml ketamine and 10 mg / ml xylazine (20 μl / 10 g body weight) instead of inhaled isoflurane. Place the mouse in lateral recumbency and place one drop (approximately 30 μl) of tetracaine hydrochloride in each eye for local anesthesia. Wait 2 minutes for the solution to take effect. Repeat the previous step with one drop of topical tropicamide for pupil dilation. Alternatively, use phenylephrine hydrochloride (2.5%) for dilation. After the appropriate time has passed, quickly place the mouse on the mouse platform and place the platform on the chin rest of the slit lamp. Turn on the slit lamp to the lowest light level and check the degree of pupil dilation. If the pupil is not fully dilated (approximately 2.5-3 mm), return the mouse to the animal warmer and wait. Alternatively, apply another drop of tropicamide. Once the eye is fully dilated, perform laser surgery. Adjust the placement of the mouse on the mouse stand so that it is in an ideal position for viewing the optic nerve. Place the mouse on the stand so that it is horizontal, perpendicular to the slit lamp beam, with the head on one side and the tail on the other. Slightly turn the mouse so that it is at an angle of approximately 170 degrees to the head of the person approaching the laser operator. Once the mouse is ideally positioned, place a drop of artificial tears on a 25mm x 25mm glass coverslip. Place a drop of artificial tears on the other eye of the mouse - this will ensure that the eye is moist and help delay the formation of cataracts. Hold a corner of the coverslip between the thumb and index finger; squeeze the glass between the fingertips of two fingers. Gently use the remaining three fingers to wrap around the body of the animal to support and stabilize the hand. Position the hand so that the glass coverslip can be easily placed over the mouse's eye. Once a stable position is obtained, carefully press the glass coverslip (with a drop of artificial tears still attached) onto the mouse's eye. Make sure the coverslip is as perpendicular to the laser beam as possible to prevent scattering or reflection of the laser beam. The coverslip acts as a contact lens to flatten the cornea. Observe through the slit lamp and switch the focus with your free hand until the retina can be seen. The retina will appear light yellow / red, depending on the location being observed, with distinct red blood vessels visible. Slowly and carefully manipulate the mouse head and / or coverslip until the optic nerve is visible. The optic nerve will appear yellow with multiple blood vessels radiating from it. Once the operator confirms that the optic nerve can be seen, turn on the laser focus beam. Once the laser beam is turned on, manipulate the laser focus beam to the desired location (approximately 1 disc diameter away from the optic nerve). Focus the laser beam on the RPE at the fundus. Proper focus is achieved by having the sharpest and clearest laser beam. If the aiming beam appears elliptical or out of focus, switch the slit lamp focus or reposition the glass coverslip. Once the aiming beam is focused on the RPE, initiate laser application using the laser's foot trigger. Observe for the appearance of bubbles immediately after laser application. The outline of the laser shot should be clear without any blurriness.Repeat the previous 3 steps for all desired CNV locations (usually at the 3, 6, 9, and 12 o'clock positions around the optic nerve). Record the location and results of each laser shot application and the results of each applied shot for the eye (success, blur, bleeding, etc.) in a notebook. Make sure to put the laser in standby mode when not in use. If necessary, repeat all previous steps for the other eye of the mouse, using the other hand to stabilize and use a new coverslip. After performing all required laser shots, turn off the laser and slit lamp. Discard the coverslip and place the mouse on a warmer to recover from anesthesia. Inspect the eye acroscopically for any damage and apply a drop of artificial tears to keep the eye moist and possibly prevent future cataract development. Once the mouse recovers from anesthesia, place it back in the cage.

[0241] 4. Fluorescein Vascular Imaging

[0242] After removal of the cornea and lens, the eyeballs were fixed in 4% paraformaldehyde (Electron Microscopic Sciences, Hatfield, PA) for 2 hours. The posterior eyecups of RPE / choroid / sclera were dissected and the vitreous was removed. The eyecups were incubated overnight at 4°C with (AlexaFluor 647 or FITC)-coupled isolectin B4 (1:200, Invitrogen, Carlsbad, CA) to mark invading choroidal vessels.

[0243] 5. Detection of angiogenic factor expression by Western blotting

[0244] Cells were collected and lysed with PBS containing 1% Triton X-100. Equal amounts of protein were loaded into the wells of SDS-PAGE gels and transferred to nitrocellulose filters at 100 V for 2 hours. The membrane was blocked with PBST (phosphate buffered saline with Tween 20) containing 1% BSA for 1 hour at room temperature and probed with anti-VEGF and anti-β-actin antibodies for 1 hour at room temperature. The membrane was washed three times with PBST and then incubated with secondary antibodies for 1 hour at room temperature. After washing three times with PBST, immunoreactive bands were detected. Data were quantified using Image J software.

[0245] 6. Statistical Analysis

[0246] Primary analysis was performed using Student's t test. P values ​​were compared to mdm1- / -(AAV2+DX2). For recovery assessment, P values ​​were compared to WT. For complete data, Levene's test for homogeneity of variance, ANOVA test, and post hoc analysis (Dunnett (T3), Tukey HSD) evaluation were performed using IBM SPSS statistics 23. Example 11. AAV2-DX2 improves retinal degeneration in the sodium iodate (SI)-induced rabbit RDD model

[0247] Sodium iodate (SI) is a widely used oxidant that induces photoreceptor cells to 40 41 The RDD model was generated by intravenous injection of sodium iodate solution at a dose of 30 mg / kg. 42 . 21 days after the first retinal neurodegeneration induction, fundus images showed that the RPE degeneration area in the sodium iodate-induced group (G2) was significantly degenerated compared with the normal control group (G1). Compared with G2, the RPE degeneration area (%) level in the test article-treated groups (G5 and G6) was significantly restored ( Figures 20A-20B ).

[0248] In histological examination, the level of retinal pigment epithelium (RPE) degeneration area (%) in the sodium iodate-induced group (G2) was significantly degenerated compared with the normal control group (G1) (p < 0.001). Compared with G2, the level of RPE degeneration area (%) in the test article-treated groups (G5 and G6) was significantly restored (p < 0.01, p < 0.05) ( Fig.20D ). Compared with the normal control group (G1), the level of outer segments of the photoreceptor layer in the sodium-induced group (G2) was significantly decreased (p < 0.001), and the levels in the test article-treated groups (G5 and G6) were restored compared with G2 (p < 0.01) ( Fig.20E ). Compared with G1, the retinal thickness level of the sodium iodate-induced group (G2) was significantly reduced (p < 0.001). Compared with G2, the levels of the test article-treated groups (G5 and G6) were restored (p < 0.05) ( Fig.20F ).

[0249] In immunohistochemical analysis, the level of rhodopsin positive area (%) of G2 was significantly decreased compared with G1 (p < 0.001, p < 0.01). The level of rhodopsin positive area (%) of G5 and G6 was significantly restored compared with G2 (p < 0.01) ( Figures 20G-20J). Compared with G1, the level of ganglion-positive cells (%) in G2 was significantly decreased (p < 0.001). Compared with G2, the level of ganglion-positive cells (%) in G3, G4 and G6 was significantly restored (p < 0.05).

[0250] 21 days after the first induction of retinal neurodegeneration, the amplitude levels of a-wave and b-wave in the sodium iodate-induced group (G2) were significantly reduced compared with the normal control group (G1) (p < 0.001). Compared with G2, the amplitude levels of a-wave and b-wave in the test article-treated groups (G5 and G6) were significantly restored (p < 0.05) ( Figure 20K-20L ).

[0251] Finally, we generated a very severe RDD model to confirm that DX2 exerts its survival role and can rescue retinal function even in the presence of severe retinal damage. A single intravenous injection of sodium iodate solution at a dose of 60 mg / kg was used to generate a very severe RDD model. Koster C et al. (2022).

[0252] Statistically significant improvements in a- and b-wave amplitude levels were observed in both DX2-treated HG groups compared with HG2 (severe RDD group) (i.e., 5×10 10 VG dose of AAV2-DX2) (p<0.05). See Table 2 below. Table 2

[0253] Figures 21A-21B The a wave ( Fig.21A ) and b waves ( Fig.21B ) electroretinogram measurements.

[0254] Materials and methods

[0255] 1. Animal Experiments (Rabbit)

[0256] Fifty-two male chinchilla rabbits (about 13 weeks old, 2.5-3.0 kg, Dream Bio Co., Ltd.) were used for the in vivo experiments. The environmental control was set to maintain the following conditions: temperature range 23±3°C, relative humidity range 55±15%, ventilation 10-20 times / hour, luminous intensity 150-300 lux, 12-hour light / 12-hour dark cycle. Experimental animal feed was purchased from Dream Bio (manufactured by Cargill Agri Purina Inc.), and the animals were free to eat. Water was free to eat through polycarbonate water bottles. At the end of the experiment, all surviving animals were euthanized after anesthesia, and the right eyeballs were removed. The eyeballs of the front half of each group were punctured in the center of the cornea and fixed with 10% neutral buffered formalin solution. The retina (including choroid) samples of the right eyeballs of the back half of each group were taken and placed in microtubes marked with animal identification numbers and stored in a deep freezer at a temperature below -70°C.

[0257] 2. Sodium iodate-induced retinal neurodegeneration rabbit model

[0258] On the 1st induction day (day 0), the animal that intends to induce ocular degenerative diseases is intravenously injected with sodium iodate (Sigma-Aldrich Co.) solution 5mg / kg, and on the 2nd induction day (day 14), according to the setting of the test group, sodium iodate solution 30mg / kg or 60mg / kg is intravenously injected. Usually, retinal degeneration research is carried out with 25-30mg / kg sodium iodate solution. However, retinal degeneration is induced with very high doses of sodium iodate solution (60mg / kg) to test whether DX2 can effectively maintain neuronal survival when the optic nerve is destroyed and complete vision loss occurs. Inject a test article once on the application day (day 5). In the case of intravitreal injection, the animal is anesthetized, and the test article is injected into the right eyeball through the vitreous with a syringe equipped with a 31-gauge needle. In the case of subretinal injection, the animal is anesthetized, and the test article is injected into the right eyeball through the scleral route with a syringe equipped with a 31-gauge needle.

[0259] The setting of the experimental group is shown in Table 3 below. Table 3 G1: normal control. G2: vehicle control. I.Vt: intravitreal injection. SR: subretinal injection. vg: viral genome.

[0260] 3. Fundus photography

[0261] Before the induction of degenerative eye disease and the end of the experiment, after applying eye drops (Mydriacyloph solin, 1%) to both eyeballs, the animals were anesthetized and fundus images were taken with a fundus camera (TRC-50IX, TOPCON, Japan). Image J (NIH, Bethesda, MD) was used to analyze the retinal pigment epithelium (RPE) degeneration area in the fundus images. Degeneration area (%) = degeneration area / total area.

[0262] 4. Electrophysiological Functional Assessment

[0263] Before the end of the experiment, electroretinogram (ERG) was performed on the right eye of all surviving animals. After anesthetizing the animals, they were allowed to adapt in a dark room for 60 minutes, and ERG was measured using an ERG device (HMs-ERG, Oucusrence, USA). ERG was measured in a dark room with a flash light, and the a-wave and b-wave were evaluated by comparing the amplitude with the normal control.

[0264] 5. Histopathological Examination

[0265] After general tissue processing such as cutting, dehydration, paraffin embedding, and dissection, the fixed ocular tissues were prepared for histopathological examination and stained with hematoxylin & eosin. The thickness of the retinal pigment epithelium (RPE), photoreceptor outer segments, outer nuclear layer, outer plexiform layer, and the entire retina were measured using an optical microscope (Olympus BX53, Japan).

[0266] 6. Detection of DX2 expression by RT-PCR

[0267] Total RNA was isolated from rabbit retina (including choroid) using RNA isolation Geneall hybrid-R kit (GeneAll Biotechnology Co., Ltd., South Korea) and reverse transcribed using cDNA synthesis kit (Toyobo, Japan). Then real-time PCR was performed on complementary DNA using qPCRBIO SyGreen Blue Mix (PCR Biosystems Ltd., UK). Amplification, detection and data analysis were performed using CFX96 touch (BioRad, USA).

[0268] 7. Statistical Analysis

[0269] The results of this study were assumed to follow a normal distribution and were analyzed using parametric or nonparametric multiple comparison procedures. When the results of one-way analysis of variance (ANOVA) were significant, Dunnett's multiple comparison procedure was used for post hoc analysis.

[0270] Statistical analysis was performed using Prism 7.04 (GraphPad Software Inc., San Diego, CA, USA), and statistical significance was set at a P value less than 0.05. Example 12. AAV2-DX2 shows the preventive efficacy of DX2 in a laser-induced choroidal neovascularization (CNV) rabbit model

[0271] Fifteen male chinchilla rabbits were used to generate a rabbit model of retinal degenerative disease (RDD) by laser-induced choroidal neovascularization (CNV). Fig.22A As shown, the results of choroidal neovascularization (CNV) area analysis showed that at 14, 21, and 28 days after CNV induction, the fluorescein intensity levels of G3 (SR), G4 (IVT), and the positive control (G5) were significantly reduced compared with G2 (p < 0.001, p < 0.01, or p < 0.05).

[0272] Fig. 22B Analysis of CNV area using isolectin B4 staining showed a trend toward decreased CNV area levels in all test article treatment groups (G3, G4) and the positive control (G5), but did not reach statistical significance. Example 13. AAV2-DX2 does not induce any histopathological abnormalities or tumor patterns in systemic organs

[0273] Systemic histopathological analysis was performed to test any tumorigenic potential toxicity of AAV2-DX2. As summarized in Table 4, animals administered AAV2-DX2 did not show any histopathological abnormalities or tumor patterns in kidney, liver, spleen, brain, lymph nodes, lung, etc. Survival was not affected compared to the control (G1) group. Table 4. Organ histopathological analysis Example 14. Preliminary distribution studies by AAV2-DX2-miR-3PT to confirm neuronal cell-specific DX2 expression in injected tissues

[0274] To observe the biodistribution pattern of DX2 using the miR-3P T VECTOR system, animals were sacrificed and the expression of DX2 in thymus, liver, testis, brain, spleen, kidney, heart, stomach, mesenteric lymph node, spinal cord, pancreas, lung was analyzed using qPCR ( Figures 23B-23M ). qPCR analysis confirmed that DX2 expression was only observed in the injected tissue area ( Fig.23A ).

[0275] Materials and methods

[0276] 1. Animal Experiments (Rabbit)

[0277] Fifteen male chinchilla rabbits (about 13 weeks old, 2.5-3.0 kg, Dream Bio Co., Ltd.) were used for the in vivo experiments. The environmental control was set to maintain the following conditions: temperature range 23±3°C, relative humidity range 55±15%, ventilation 10-20 times / hour, luminous intensity 150-300 lux, 12-hour light / 12-hour dark cycle. Experimental animal feed was purchased from Dream Bio (manufactured by Cargill Agri Purina Inc.), and the animals were free to eat. Water was free to eat through polycarbonate water bottles. At the end of the experiment, all surviving animals were euthanized after anesthesia, and the right eyeballs were removed. The eyeballs of the front half of each group were punctured in the center of the cornea and fixed with 10% neutral buffered formalin solution. The retina (including choroid) samples of the right eyeballs of the back half of each group were taken and placed in microtubes marked with animal identification numbers and stored in a deep freezer at a temperature below -70°C. In the case of intravitreal injections, animals were anesthetized and the test article was injected intravitreally into the right eyeball using a syringe equipped with a 31 gauge needle.

[0278] In the case of subretinal injection, the animals were anesthetized and the test article was injected into the right eyeball via the scleral route using a syringe equipped with a 31-gauge needle. After the rabbits were anesthetized, the G1 rabbits and the rabbits marked with the aforementioned numbers in each group were systemically perfused with sterile saline, and the following organs were removed and stored in a deep freezer below -70°C until analysis.

[0279] Organs removed: brain, testes, kidneys, liver, lungs, spinal cord, spleen, stomach, heart, thymus, pancreas, lymph nodes and retina / choroid of right eye (G1 both eyes).

[0280] At the end of the experiment, after the rabbits were euthanized after anesthesia and marked with subsequent numbers, the right eyes were removed, the center of the cornea was punctured with a needle and fixed with 10% neutral buffered formalin. The following organs were removed and fixed.

[0281] Organs removed: Brain, testicles, kidneys, liver, lungs, spinal cord, spleen, stomach, heart, thymus, pancreas, and lymph nodes.

[0282] The setting of the experimental group is shown in Table 5 below. Table 5 G1: normal control. G2: vehicle control. I.Vt: intravitreal injection. SR: subretinal injection. vg: viral genome.

[0283] Rabbit Laser-Induced CNV Model Protocol

[0284] After instilling eye drops (Mydriacyl oph soln, 1%) in the right eyeball, the animal was anesthetized and the eye was irradiated with a laser (Elite, Lumenis, USA) at 532 nm, 150 mW, and 0.1 sec, producing six spots around the optic nerve at approximately 6 o'clock.

[0285] Fluorescein angiography

[0286] After instillation of eye drops (Mydriacyl oph soln, 1%) in the right eye, the animals were anesthetized on days 0, 7, 14, 21, and 28. 1 mL of fluorescein sodium salt solution (2%) was injected intravenously, and images were captured within 2 minutes using a fundus camera (TRC-50IX, TOPCON, Japan).

[0287] Retinal CNV area and efficacy were evaluated using retinal fluorescent fundus photography. Image analysis was performed using ImageJ software (NIH, Bethesda, MD) to verify the fluorescence intensity of the irradiated site.

[0288] Fluorescein intensity (%) was calculated as follows;

[0289] Fluorescence intensity (%) = (fluorescein intensity value – average background value (G1) 1) ) / G2 fluorescence intensity value average

[0290] Fluorescein intensity of retinas without CNV spots was measured and used as background value.

[0291] Histopathological analysis

[0292] After general tissue processing such as cutting, dehydration, paraffin embedding and dissection of the fixed tissue to produce samples for histopathological examination, hematoxylin & eosin staining was performed and histopathological changes were observed using an optical microscope (Olympus BX53, Japan). The fixed eye tissue was stained with isolectin B4 using the choroidal flat mount method to analyze the CNV area.

[0293] Detection of DX2 expression by RT-PCR

[0294] Total RNA was isolated from rabbit eye tissues and organs using the RNA isolation Geneall hybrid-R kit (GeneAll Biotechnology Co., Ltd., Korea) and reverse transcribed using a cDNA synthesis kit (Toyobo, Japan).

[0295] Then, real-time PCR was performed on the complementary DNA using qPCRBIO SyGreen Blue Mix (PCR Biosystems Ltd., UK). Amplification, detection and data analysis were performed using CFX96 touch (BioRad, USA). RT-PCR analysis of the target gene was performed using the removed organs and eye tissues to confirm the target gene expression compared with GAPDH expression.

[0296] For the results of this study, the data were assumed to be normal and parametric one-way ANOVA was used to verify the significance between the experimental groups. In significant cases, post hoc tests were performed using Dunnett's multiple comparison test. Statistical analysis was performed using Prism 7.04 (GraphPad Software Inc., San Diego, California, USA), and statistical significance was determined when the p value was less than 0.05.

[0297] in conclusion

[0298] In this study, the following have been demonstrated: (1) the survival effect of DX2 on retinal degeneration; (2) the use of DX2 to treat retinal degenerative diseases; the anti-apoptotic efficacy of DX2 delivered to the retina of mice and rabbits via SR and IV injections by adeno-associated virus (AAV). Therefore, the effectiveness of gene therapy using the survival gene DX2 as a potential option for the treatment of retinal degenerative diseases has also been confirmed.

[0299] References 1. Talib M, van Schooneveld MJ, Van Cauwenbergh C, et al. The Spectrum of Structural and Functional Abnormalities in Female Carriers of PathogenicVariants in the RPGR Gene. Invest Ophthalmol Vis Sci. Aug 1 2018;59(10):4123-4133.doi:10.1167 / iovs.17-23453. 2. Bennett J.Taking Stock of Retinal Gene Therapy: Looking Back andMoving Forward.Mol Ther.May 3 2017;25(5):1076-1094.doi:10.1016 / j.ymthe.2017.03.008. 3.Boye SE,Boye SL,Lewin AS,Hauswirth WW.A comprehensive review ofretinal gene therapy.Mol Ther.Mar 2013;21(3):509-19.doi:10.1038 / mt.2012.280. 4.Sahel JA,Marazova K,Audo I.Clinical characteristics and currenttherapies for inherited retinal degenerations.Cold Spring Harb PerspectMed.Oct 162014;5(2):a017111.doi:10.1101 / cshperspect.a017111. 5.Vandenberghe LH.What Is Next for Retinal Gene Therapy?Cold SpringHarb Perspect Med.Apr 15 2015;5(10)doi:10.1101 / cshperspect.a017442. 6.Megaw RD,Soares DC,Wright AF.RPGR:Its role in photoreceptorphysiology,human disease,and future therapies.Exp Eye Res.Sep 2015;138:32-41.doi:10.1016 / j.exer.2015.06.007. 7.Russell S,Bennett J,Wellman JA,et al.Efficacy and safety ofvoretigene neparvovec(AAV2-hRPE65v2)in patients with RPE65-mediated inheritedretinal dystrophy:a randomised,controlled,open-label,phase 3trial.Lancet.Aug262017;390(10097):849-860.doi:10.1016 / S0140-6736(17)31868-8. 8.Deng WT ea.Correction to:Stability and Safety of an AAV Vector forTreating RPGR-ORF15X-Linked Retinitis Pigmentosa by Deng,W.-T.et al.Hum GeneTher 2015;26(9):593-602.DOI:10.1089 / hum.2015.035.Hum Gene Ther.Feb 2021;32(3-4):232-233.doi:10.1089 / hum.2015.035.correx. 9.Pawlyk BS,Bulgakov OV,Sun X,et al.Photoreceptor rescue by anabbreviated human RPGR gene in a murine model of X-linked retinitispigmentosa.Gene Ther.Feb 2016;23(2):196-204.doi:10.1038 / gt.2015.93. 10.Sun X,Park JH,Gumerson J,et al.Loss of RPGR glutamylationunderlies the pathogenic mechanism of retinal dystrophy caused by TTLL5mutations.Proc Natl Acad Sci U S A.May 24 2016;113(21):E2925-34.doi:10.1073 / pnas.1523201113. 11.Wu Z,Hiriyanna S,Qian H,et al.A long-term efficacy study of genereplacement therapy for RPGR-associated retinal degeneration.Hum MolGenet.Jul 15 2015;24(14):3956-70.doi:10.1093 / hmg / ddv134. 12.Jin ZB,Gao ML,Deng WL,et al.Stemming retinal regeneration withpluripotent stem cells.Prog Retin Eye Res.Mar 2019;69:38-56.doi:10.1016 / j.preteyeres.2018.11.003. 13.Soldatov VO,Kukharsky MS,Belykh AE,Sobolev AM,Deykin AV.RetinalDamage in Amyotrophic Lateral Sclerosis:Underlying Mechanisms.Eye Brain.2021;13:131-146.doi:10.2147 / EB.S299423. 14.Kim JH,Han JM,Kim S.Protein-protein interactions and multi-component complexes of aminoacyl-tRNA synthetases.Top Curr Chem.2014;344:119-44.doi:10.1007 / 128_2013_479. 15.Choi JW,Kim DG,Lee AE,et al.Cancer-associated splicing variant oftumor suppressor AIMP2 / p38:pathological implication in tumorigenesis.PLoSGenet.Mar 2011;7(3):e1001351.doi:10.1371 / journal.pgen.1001351. 16.Ko HS,von Coelln R,Sriram SR,et al.Accumulation of the authenticparkin substrate aminoacyl-tRNA synthetase cofactor,p38 / JTV-1,leads tocatecholaminergic cell death.J Neurosci.Aug 31 2005;25(35):7968-78.doi:10.1523 / JNEUROSCI.2172-05.2005. 17.Lee Y,Karuppagounder SS,Shin JH,et al.Parthanatos mediates AIMP2-activated age-dependent dopaminergic neuronal loss.Nat Neurosci.Oct2013;16(10):1392-400.doi:10.1038 / nn.3500. 18.de Murcia JM,Niedergang C,Trucco C,et al.Requirement of poly(ADP-ribose)polymerase in recovery from DNA damage in mice and in cells.Proc NatlAcad Sci U S A.Jul 8 1997;94(14):7303-7.doi:10.1073 / pnas.94.14.7303. 19.Hong SJ,Dawson TM,Dawson VL.Nuclear and mitochondrialconversations in cell death:PARP-1 and AIF signaling.Trends Pharmacol Sci.May2004;25(5):259-64.doi:10.1016 / j.tips.2004.03.005. 20.Choi JW,Kim DG,Park MC,et al.AIMP2 promotes TNFalpha-dependentapoptosis via ubiquitin-mediated degradation of TRAF2.J Cell Sci.Aug 12009;122(Pt 15):2710-5.doi:10.1242 / jcs.049767. 21.Corti O,Hampe C,Koutnikova H,et al.The p38 subunit of theaminoacyl-tRNA synthetase complex is a Parkin substrate:linking proteinbiosynthesis and neurodegeneration.Hum Mol Genet.Jun 15 2003;12(12):1427-37.doi:10.1093 / hmg / ddg159. 22.Ko HS,Lee Y,Shin JH,et al.Phosphorylation by the c-Abl proteintyrosine kinase inhibits parkin's ubiquitination and protective function.ProcNatl Acad Sci U S A.Sep 21 2010;107(38):16691-6.doi:10.1073 / pnas.1006083107. 23.Narne P,Pandey V,Simhadri PK,Phanithi PB.Poly(ADP-ribose)polymerase-1 hyperactivation in neurodegenerative diseases:The death knelltolls for neurons.Semin Cell Dev Biol.Mar 2017;63:154-166.doi:10.1016 / j.semcdb.2016.11.007. 24.Mao K,Zhang G.The role of PARP1 in neurodegenerative diseases andaging.FEBS J.Apr 2022;289(8):2013-2024.doi:10.1111 / febs.15716. 25.Szabo C,Zingarelli B,O'Connor M,Salzman AL.DNA strand breakage,activation of poly(ADP-ribose)synthetase,and cellular energy depletion areinvolved in the cytotoxicity of macrophages and smooth muscle cells exposedto peroxynitrite.Proc Natl Acad Sci U S A.Mar 5 1996;93(5):1753-8.doi:10.1073 / pnas.93.5.1753. 26.Virag L,Salzman AL,Szabo C.Poly(ADP-ribose)synthetase activationmediates mitochondrial injury during oxidant-induced cell death.J Immunol.Oct11998;161(7):3753-9. 27.Sahaboglu A,Sharif A,Feng L,Secer E,Zrenner E,Paquet-DurandF.Temporal progression of PARP activity in the Prph2 mutant rd2 mouse:Neuroprotective effects of the PARP inhibitor PJ34.PLoS One.2017;12(7):e0181374.doi:10.1371 / journal.pone.0181374. 28.Olivares-Gonzalez L,Velasco S,Campillo I,Rodrigo R.RetinalInflammation,Cell Death and Inherited Retinal Dystrophies.Int J Mol Sci.Feb202021;22(4)doi:10.3390 / ijms22042096 29.Streit WJ,Mrak RE,Griffin WS.Microglia and neuroinflammation:apathological perspective.J Neuroinflammation.Jul 30 2004;1(1):14.doi:10.1186 / 1742-2094-1-14. 30.Karlstetter M,Scholz R,Rutar M,Wong WT,Provis JM,LangmannT.Retinal microglia:just bystander or target for therapy?Prog Retin EyeRes.Mar2015;45:30-57.doi:10.1016 / j.preteyeres.2014.11.004. 31.Murakami Y,Ishikawa K,Nakao S,Sonoda KH.Innate immune response inretinal homeostasis and inflammatory disorders.Prog Retin Eye Res.Jan2020;74:100778.doi:10.1016 / j.preteyeres.2019.100778. 32.Rodrigues EB,Farah ME,Maia M,et al.Therapeutic monoclonalantibodies in ophthalmology.Prog Retin Eye Res.Mar 2009;28(2):117-44.doi:10.1016 / j.preteyeres.2008.11.005. 33.Choi JW,Lee JW,Kim JK,et al.Splicing variant of AIMP2 as aneffective target against chemoresistant ovarian cancer.J Mol Cell Biol.Jun2012;4(3):164-73.doi:10.1093 / jmcb / mjs018. 34.Christine CW,Starr PA,Larson PS,et al.Safety and tolerability ofputaminal AADC gene therapy for Parkinson disease.Neurology.Nov 172009;73(20):1662-9.doi:10.1212 / WNL.0b013e3181c29356. 35.Eberling JL,Jagust WJ,Christine CW,et al.Results from a phase Isafety trial of hAADC gene therapy for Parkinson disease.Neurology.May202008;70(21):1980-3.doi:10.1212 / 01.wnl.0000312381.29287.ff. 36.Castle MJ,Baltanas FC,Kovacs I,Nagahara AH,Barba D,TuszynskiMH.Postmortem Analysis in a Clinical Trial of AAV2-NGF Gene Therapy forAlzheimer's Disease Identifies a Need for Improved Vector Delivery.Hum GeneTher.Apr 2020;31(7-8):415-422.doi:10.1089 / hum.2019.367. 37.Wang D,Tai PWL,Gao G.Adeno-associated virus vector as a platformfor gene therapy delivery.Nat Rev Drug Discov.May 2019;18(5):358-378.doi:10.1038 / s41573-019-0012-9. 38.Yan X,Li Y,Yu H,et al.Epigallocatechin-3-gallate inhibits H(2)O(2)-induced apoptosis in Mouse Vascular Smooth Muscle Cells via 67kD LamininReceptor.Sci Rep.Aug 10 2017;7(1):7774.doi:10.1038 / s41598-017-08301-6. 39.Chang B,Mandal MN,Chavali VR,et al.Age-related retinaldegeneration(arrd2)in a novel mouse model due to a nonsense mutation in theMdm1 gene.Hum Mol Genet.Dec 15 2008;17(24):3929-41.doi:10.1093 / hmg / ddn295. 40.Zhou;R.Sodium iodate-induced retina and choroid damage model inrabbits to test efficacy of RPE auto-transplants.Vol.57,2253.. https: / / iovs.arvojournals.org / article.aspx?articleid=2560738&resultClick=1. 41.Ahn SM,Ahn J,Cha S,et al.The effects of intravitreal sodium iodateinjection on retinal degeneration following vitrectomy in rabbits.Sci Rep.Oct302019;9(1):15696.doi:10.1038 / s41598-019-52172-y. 42.Koster C,van den Hurk KT,Ten Brink JB,et al.Sodium-IodateInjection Can Replicate Retinal Degenerative Disease Stages in Pigmented Miceand Rats:Non-Invasive Follow-Up Using OCT and ERG.Int J Mol Sci.Mar 82022;23(6)doi:10.3390 / ijms23062918. 43.Telegina,D.V.,O.S.Kozhevnikova,and N.G.Kolosova."Molecularmechanisms of cell death in retina during development of age-related maculardegeneration."Advances in Gerontology 7.1(2017):17-24. 44.Hernández-Zimbrón,Luis Fernando,et al."Age-related maculardegeneration:new paradigms for treatment and management of AMD."Oxidativemedicine and cellular longevity 2018(2018). 45.Du,Hongjun,et al."JNK inhibition reduces apoptosis andneovascularization in a murine model of age-related macular degeneration."Proceedings of the National Academy of Sciences 110.6(2013):2377-2382. 46.Brown et al., Endogenous microRNA regulation suppresses transgeneexpression in hematopoietic lineages and enables stable gene transfer, NatureMed. 12:585-591 (2006). 47.Brown et al., Endogenous microRNA can broadly exploited to regulate transggene expression acording to tissue, lineage and diffferentiation state, Nature Biotech. 25:12457-1467(2007). 48.KR 10-1067816(2011). 49. US2019 / 0298858A1.

[0300] The description of the above specific embodiments will fully reveal the general characteristics of the present invention, and others can easily modify and / or adapt to various applications by applying knowledge within the technical scope of the art without departing from the general concept of the present invention. Therefore, based on the teachings and guidance provided herein, such adaptations and modifications are intended to belong to the meaning and scope of the equivalents of the disclosed embodiments. It should be understood that the wording or terminology herein is for the purpose of description rather than limitation, and therefore, those skilled in the art should interpret the terms or wording of this specification in accordance with the teachings and guidance.

[0301] The breadth and scope of the present invention should not be limited by any of the above-described exemplary embodiments, but should be defined only in accordance with the following claims and their equivalents.

[0302] All of the various aspects, embodiments and options described herein may be combined in any and all variations.

[0303] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference.

Claims

1. A method for treating a retinal degenerative disease in an individual in need thereof, comprising administering to the individual a pharmaceutically effective amount of a recombinant vector comprising an AIMP2 variant (AIMP2-DX2) gene with exon 2 deletion.

2. The method of claim 1, wherein the retinal degenerative disease is retinitis pigmentosa, Leber congenital amaurosis, cone-rod dystrophy, glaucoma or diabetic retinopathy.

3. The method of claim 1 or 2, wherein the retinal degenerative disease precedes or occurs concurrently with Parkinson's disease, Alzheimer's disease or amyotrophic lateral sclerosis.

4. The method according to any one of claims 1-3, wherein the retinal degenerative disease is not age-related macular disease.

5. The method according to any one of claims 1-4, wherein the vector further comprises a miR-142 target sequence.

6. The method according to any one of claims 1 to 5, wherein the vector further comprises a promoter operably linked to AIMP2-DX2.

7. The method of claim 6, wherein the promoter is a retrovirus (LTR) promoter, a cytomegalovirus (CMV) promoter, a Rous sarcoma virus (RSV) promoter, a MT promoter, an EF-1α promoter, an UB6 promoter, a chicken β-actin promoter, a CAG promoter, an RPE65 promoter, a synapsin promoter, a MeCP2 promoter, a CaMKII promoter, an Hb9 promoter, or an opsin promoter.

8. The method according to any one of claims 5-7, wherein the miR-142 target sequence is located 3' of the AIMP2-DX2 gene.

9. The method of any one of claims 1-8, wherein the AIMP2-DX2 gene comprises a nucleotide sequence encoding an amino acid sequence that is at least 90% identical to SEQ ID NO: 2, 13, 14, 15, 16, 17, 18, 19 or 20.

10. The method according to claim 9, wherein the AIMP2-DX2 gene comprises a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 2, 13, 14, 15, 16, 17, 18, 19 or 20.

11. The method according to any one of claims 1 to 10, wherein the AIMP2-DX2 gene does not have an exon comprising a nucleotide sequence encoding an amino acid sequence that is at least 90% identical to SEQ ID NO: 10 or 11. 12 . The method according to claim 1 , wherein the AIMP2-DX2 gene does not have an exon comprising a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 10 or 11.

13. The method of any one of claims 5-12, wherein the miR-142 target sequence comprises ACACTA.

14. The method of claims 5-12, wherein the miR-142 target sequence comprises ACACTA and 1-17 additional consecutive nucleotides of SEQ ID NO:

5.

15. The method of any one of claims 5-12, wherein the miR-142 target sequence comprises a nucleotide sequence that is at least 50% identical to the nucleotide sequence of SEQ ID NO: 5 (TCCATAAAGTAGGAAACACTACA).

16. The method of claim 15, wherein the miR-142 target sequence comprises the nucleotide sequence of SEQ ID NO:

5.

17. The method of any one of claims 5-12, wherein the miR-142 target sequence comprises ACTTTA.

18. The method of claims 5-12, wherein the miR-142 target sequence comprises ACTTTA and 1-15 additional consecutive nucleotides of SEQ ID NO:

7.

19. The method of any one of claims 5-12, wherein the miR-142 target sequence comprises a nucleotide sequence that is at least 50% identical to the nucleotide sequence of SEQ ID NO: 7 (AGTAGTGCTTTCTACTTTATG).

20. The method of claim 19, wherein the miR-142 target sequence comprises the nucleotide sequence of SEQ ID NO:

7.

21. The method of any one of claims 5-20, wherein the miR-142 target sequence is repeated 2-10 times.

22. The method according to any one of claims 1-21, wherein the vector is a viral vector.

23. The method of claim 22, wherein the viral vector is an adenovirus, an adeno-associated virus, a lentivirus, a retrovirus, a human immunodeficiency virus (HIV), a murine leukemia virus (MLV), an avian sarcoma / leukemia (ASLV), a spleen necrosis virus (SNV), a Rous sarcoma virus (RSV), a mouse mammary tumor virus (MMTV), a vaccinia virus, or a herpes simplex virus vector.

24. The method of any one of claims 1-23, wherein the recombinant vector is administered to the individual topically by intravitreal injection, subconjunctival injection, or subretinal space.

25. The method of any one of claims 1-24, further comprising administering to the individual an additional therapeutic agent.

26. The method of claim 25, wherein the additional therapeutic agent is ranibizumab, aflibercept, or bevacizumab.

Images