Nitrogen-containing heterocyclic compound having phenyl group and use thereof

Abstract

The invention relates to a nitrogen-containing heterocyclic compound with phenyl and application of the nitrogen-containing heterocyclic compound. The compound of the present invention can exert a therapeutic effect on various neurological disorders such as neurodegenerative diseases, neurodegenerative diseases, neuropsychiatric disorders, memory loss, cognitive dysfunction / impairment, and learning regression disorders by effectively enhancing synaptic plasticity without side effects.

Description

Technical Field

[0001] The present invention relates to a nitrogen-containing heterocyclic compound having a phenyl group and its use. More specifically, the present invention relates to a compound, composition or method for preventing or treating neurotic disorders or neurodegenerative disorders. Background Art

[0002] Synaptic plasticity and the critical period

[0003] Neural nets are networks composed of neurons. Synapses are nodes in a neural net where neurons exchange information with each other. In a neural net, synapses are "plastic" in that their number and strength change throughout life as synaptic inputs are added, removed, or elaborated in response to ongoing neural activity. Synaptic plasticity refers to this neural activity-dependent modification of synapses caused by changes in the strength and / or efficiency of synaptic delivery.

[0004] Higher-order functions such as learning, cognition, synthesis, judgment, art, and creativity depend on the ability to form neural networks (called cortical neural networks) in the cerebral cortex. The synaptic plasticity of the cortical neural network reaches its peak in the early postnatal period, which is called the critical period. After the critical period, the synaptic plasticity of the cortex gradually decreases with age, and eventually becomes a state where experience no longer causes active changes in the cerebral cortex. However, interestingly, recent studies have shown that under certain conditions, synaptic plasticity can be restored to a high level even after the critical period ends: in animal models, peripheral nerve injury reactivated synaptic plasticity in the somatosensory thalamocortical circuit that delivers peripheral sensory signals to the cerebral cortex (reference [Yu et al., 2012, Neuron.74:731-42]; reference [Pet rus et al., 2014, Neuron.81:664-73]; reference [Gao et al., J Neurosci.34:10770-9]).

[0005] Reduced synaptic plasticity is also associated with adult brain degeneration. In particular, synaptic plasticity in thalamocortical circuits is significantly limited with age. As mentioned above, if the critical period can be restarted, reactivating or enhancing cortical synaptic plasticity through therapeutic means may be used to treat diseases caused by reduced synaptic plasticity.

[0006] Histone deacetylase inhibitors

[0007] Most of the cell's DNA exists in a denser, more compressed form called chromatin. Compression occurs by wrapping the DNA around a group of proteins called histones. The degree of chromatin compression depends on the acetylation level of the histones. Typically, histone acetyltransferases (HATs) perform acetylation that allows access to DNA, and histone deacetylases (HDACs) perform deacetylation that blocks access to DNA. Since transcription only occurs when access is allowed, chromatin compression acts as a regulatory mechanism for gene expression (reference [Verdin and Ott, 2015, Nat Rev Mol Cell Biol 16: 258-264]).

[0008] So far, 11 mammalian HDACs have been identified. These HDACs are roughly divided into four categories based on the degree of homology with yeast HDACs. Class I HDACs include HDAC1, 2, 3, and 8; Class II HDACs are divided into Class IIa (HDAC4, 5, 7, and 9) and Class IIb (HDAC6 and 10) based on structural similarity. Class III HDACs include SIR T1-7, and Class IV HDACs include HDAC11.

[0009] Class I HDACs are mainly confined to the nucleus, while class II HDACs shuttle between the nucleus and cytoplasm through phosphorylation of specific serine residues. The N-terminal domain of HDAC interacts with several tissue-specific transcription factors and acts as a transcriptional repressor. The C-terminal domain of HDAC has deacetylase activity. However, class IIa HDACs do not have deacetylase activity because this type of HDAC carries a loss-of-function mutation in which the tyrosine (Tyr) residue of the C-terminal catalytic domain is replaced by histidine (His).

[0010] HDAC4

[0011] HDAC4 is expressed throughout the body. HDAC4 is particularly highly expressed in the brain, heart, and skeletal muscle (documents [Grozinger et al., 1999, Proc. Natl. Acad. Sci. USA 96, 4868-4873]; document [Darcy et al., 2010, J. Comp. Neurol. 518, 722-740]). In the brain, HDAC4 levels peak shortly after birth (documents [Sando et al., 2012, Cell 151, 821-834]). HDAC4 was detected in corticotropin-releasing hormone (CRH) neurons (100±0%), oxytocin neurons (98±2%), vasopressin neurons (100±0%), orexin neurons (100±0%), AgRP neurons (100±0%), POMC neurons (92±4%), histamine neurons (85±7%), dopamine neurons (100±0%), serotonin neurons (93±2%), and norepinephrine neurons (100±0%) (reference [Takase et al., 2013, PloS ONE 8: e58473]).

[0012] Cytoplasmic HDAC4 responds to low potassium or excitotoxic glutamate conditions that induce apoptosis by rapidly translocating to the nucleus. Ectopic overexpression of HDAC4 in the nucleus promotes neuronal cell death and inhibits the transcriptional activity of survival factors such as MEF2 and CREB (reference [Bolger and Yao, 2005, J Neurosci. 2005; 25: 9544-9553]). Neurons containing HDAC4 are uniform in size and widely distributed in neuropils including the paraventricular nucleus (PVN), lateral hypothalamus (LHA), hypothalamic arcuate nucleus (ARC), tuberous mammary nucleus (TMN), dorsal raphe (DR) and locus coeruleus (LC). In particular, HDAC4 co-localizes with PSD95 (reference [Mielcarek et al., 2013, PLoS Biol. 11: e1001717]; reference [Takase et al., 2013, PloS ONE 8: e58473]), suggesting a role for HDAC4 in synaptic plasticity (reference [Sando et al., 2012, Cell 151, 821-834]; reference [Mielcarek et al., PLoS Biol. 11: e1001717]).

[0013] In animal experimental models, tissue-specific deletion of HDAC4 in rat hippocampus eliminates behavioral changes induced by prolonged stress (document [Sailaja et al., 2012, Proc. Natl. Acad. Sci. USA 109, E3687-E3695]). HDAC4 overexpression increases sensitivity to H2O2 damage by inhibiting the activity of peroxisome proliferator-activated receptor α (PPARα), thereby accelerating the death of cerebellar granule neurons (document [Bolger and Yao, 2005, J. Neurosci. 25, 9544-9553]; document [Li et al., 2012, Nat. Med. 18, 783-790]; document [Sando et al., 2012; Cell 151, 821-834]; document [Yang et al., 2011, FEBS Lett. 585, 761-766]). Overexpression of HDAC4 in the rat hippocampus induces depressive-like behavior (reference [Sarkar et al., 2014, Neuropsychopharmacology 39, 2221-2232]).

[0014] In the Drosophila model, overexpression of HDAC4 in adult mushroom body neurons, which are important structures for memory formation, impaired long-term courtship memory but had no effect on short-term memory (reference [Fitzsimons et al., 2013, PloS ONE8: e83903]). Subsequent studies investigating the relationship with the intracellular distribution of HDAC4 showed that mushroom body morphogenesis, eye development, and long-term memory loss were associated with nuclear HDAC4 abundance (reference [Main et al., 2021, Front. Mol. Neurosci. 14: 616642]).

[0015] Elevated levels of human HDAC4 were found in postmortem HD anterior temporal lobar degeneration (FTLD) brains (reference [Yeh et al., 2013, Brain Res. 1504, 16-24]; reference [Whitehouse et al., 2014, Neuropathol. Appl. Neurobiol. 41, 245-257]). HDAC4 was identified as a component of Lewy bodies in Parkinson's disease brains and a component of nuclear inclusions in neuronal nuclear inclusion disease (reference [Takahashi-Fujigasaki and Fujigasaki, 2006, Neuropathol. Appl. Neurobiol. 32, 562-566]. HDAC4 was observed to be significantly overexpressed in specific cortical areas of autistic patients (reference [Nardone et al., 2014, Transl. Psychiatry 4: e433]).

[0016] HDAC inhibitors and synaptic plasticity

[0017] Histone modification has been proposed as a potential method to restore cortical plasticity in adulthood. Valproic acid is known to be a histone deacetylase (HDAC) inhibitor. In a clinical study in which participants took valproic acid capsules, the critical period was restarted, and even adults could achieve absolute pitch learning that was only possible during the critical period (reference [Gervain et al., 2013, Front Syst Neurosci.7:102]). When adult rats were exposed to an enriched environment compared to normal cage conditions, the total amount of H3 acetylation in the visual cortex increased compared to the control group, and ocular dominance plasticity that only appeared during the critical period was observed after the critical period (reference [Baroncelli L et al., 2016, J Neurosci.36:3430-40]).

[0018] After treatment with the HDAC inhibitor suberoylanilide hydroxamic acid (SAHA), the H3 acetylation level in the visual cortex increased to the level generally observed in young mice, especially the H3 acetylation of the P3 promoter of brain-derived neurotrophic factor (BNDF), which is important for developmental synaptic plasticity and long-term memory in the visual cortex, also increased (reference [Baroncelli L et al., 2016, J Neu rosci. 36: 3430-40]). Increased BDNF expression was also observed in neurospheres (reference [Bagheri et al., 2019, Int. J. Mol. Sci. 20: 1109]).

[0019] SAHA or other HDAC inhibitors are reported to have the effect of improving the symptoms of Huntington's disease (HD) mouse models (reference [Ferrante et al., 2003]; reference [Hockly et al., 2003, J Biol. Chem. 278, 16059-16072]; reference [Gardian et al., 2005, J. Biol. Chem. 280, 556-563]). HDA C4 has a correlation with the length of polyglutamine expressed in Huntington's disease. It co-localizes with cytoplasmic inclusion bodies and various peripheral organ lesions such as skeletal muscle atrophy and heart failure in Huntington's disease (reference [Zie lonka et al., 2014, Front. Physiol. 5: 380]; reference [Mielcarek et al., 2014, PLoS Genet. 10: e1004550]; reference [Mielcarek et al., 2014, PloS ONE 9: e108961]; reference [Zielonka et al., 2014, Exp. Clin. Cardiol. 20, 2547-2554]). If HDAC4 levels are reduced in the R6 / 2 mouse model of Huntington's disease, the formation of cytoplasmic aggregates in various regions of the brain is delayed, motor coordination and nervous system phenotypes are improved, and the effect of prolonging life span is achieved (reference [Mielcarek et al., 2013, PLoS Biol. 11: e1001717]).

[0020] Interestingly, BDNF cortical transcription levels were restored after SAHA treatment in R6 / 2 mice (reference [Mielcarek et al., 2011, PloS ONE 6: e27746]). Since HDAC4 and HDAC5 can inhibit specific BDNF transcription, this effect was shown to be reversed by SAHA treatment, so the memory enhancement and neuroprotective effects of HDAC inhibitors may be related to increased BDNF expression (reference [Koppel and Timmusk, 2013, Neur opharmacology 75, 106-11]).

[0021] HDAC4 can play a central role in brain physiology and can be a useful target for treating a variety of neurodegenerative disorders. However, currently available HDAC inhibitors widely inhibit HDACs and are therefore not suitable for inhibiting specific HDACs. Although SAHA can enhance synaptic plasticity, it causes serious side effects, including fatigue, nausea, diarrhea, or thrombocytopenia, so SAHA is not suitable for use in humans (literature [Meghan E. et al., 2011, Bone. 48: 1117-1126]).

[0022] Therefore, it would be useful to develop selective HDAC inhibitors for targeted therapy. Summary of the invention

[0023] Technical issues to be solved

[0024] The object of the present invention is to solve all the above-mentioned problems.

[0025] An object of the present invention is to provide a nitrogen-containing heterocyclic compound having a phenyl group, a stereoisomer thereof or a pharmaceutically acceptable salt thereof for enhancing synaptic plasticity.

[0026] Another object of the present invention is to provide a pharmaceutical composition for treating or preventing HDAC-mediated neurotic disorders or neurodegenerative disorders, which comprises as an active ingredient a nitrogen-containing heterocyclic compound having a phenyl group, a stereoisomer thereof, or a pharmaceutically acceptable salt thereof for enhancing synaptic plasticity.

[0027] Another object of the present invention is to provide a method for treating or preventing HDAC-mediated neurotic disorders or neurodegenerative disorders, comprising administering to a subject a nitrogen-containing heterocyclic compound having a phenyl group, a stereoisomer thereof, or a pharmaceutically acceptable salt thereof for enhancing synaptic plasticity.

[0028] Another object of the present invention is to provide a pharmaceutical composition for combined administration and a combined administration method using the same, which comprises a nitrogen-containing heterocyclic compound having a phenyl group, a stereoisomer thereof or a pharmaceutically acceptable salt thereof for enhancing synaptic plasticity and a second therapeutic agent.

[0029] The purpose of the present invention is not limited to the above-mentioned purpose. The purpose of the present invention will become more clear through the following description and can be achieved by adopting the means described in the claims and their combination.

[0030] Technical solutions to technical issues

[0031] The representative configuration of the present invention for achieving the above-mentioned object is as follows:

[0032] According to one aspect of the present invention, there is provided a compound represented by formula (1), a stereoisomer thereof or a pharmaceutically acceptable salt thereof:

[0033]

[0034] In the formula, R 1 is an aryl or heteroaryl group, or is combined with an adjacent phenyl group to form a saturated or partially saturated heterocyclic ring, wherein one or more hydrogen atoms in the aryl, heteroaryl or heterocyclic ring are not substituted, or are replaced by halogen atoms, C 1-6 Alkyl, C 3-12 Cycloalkyl, C 1-6Alkoxy, aryl, heteroaryl, amino or nitro substituted, said substituent being unsubstituted or substituted with one or more halogen atoms or C 1-6 Alkyl substitution,

[0035] R 2 For hydrogen, C 1-6 Alkyl or aryl,

[0036] R 3 is hydrogen, carboxyl, N-hydroxycarboxamide or carboxamide, wherein the hydrogen in the group can be replaced by C 1-6 Alkyl substituted, n is 0 or 1,

[0037] m is 0 to 6.

[0038] In one embodiment, R 1 The radical may be phenyl, pyridyl, pyridazinyl, pyrimidinyl, pyrazinyl, furanyl, thienyl, pyrrolyl, imidazolyl or oxazolyl, or may be combined with an adjacent phenyl group to form a quinoxalinyl or dihydrobenzodioxy group.

[0039] In another embodiment, R 1 One or more hydrogen atoms in the carbon atoms may be substituted by halogen atoms, by one or more halogen atoms, or by unsubstituted C 1-6 Alkyl or C 3-12 Cycloalkyl, C 1-6 Alkoxy, phenyl, pyridyl, pyridazinyl, pyrimidinyl, substituted with one or more C 1-6 The alkyl group may be substituted or unsubstituted with amino or nitro.

[0040] In one embodiment, R 1 It can be phenyl, biphenyl, pyridin-4-yl, pyridin-3-yl, pyridin-2-yl, methylpyridin-3-yl, 6-methoxy-pyridin-3-yl, 6-cyclopropyl-pyridin-3-yl, trifluoromethylpyridin-3-yl, phenylpyridin-3-yl, pyridazin-4-yl, pyridazin-3-yl, pyridazin-2-yl, pyrimidin-2-yl, pyrimidin-4-yl, pyrimidin-5-yl, methylpyrimidin-5-yl, 5-fluoropyrimidin-2-yl, 2-(trifluoromethyl)pyrimidin-5-yl, 2-cyclopropylpyrimidin-5-yl, pyrazin-2-yl, thiophene-2-yl, furan-2-yl, oxazol-2-yl, 3-nitrophenyl, 4-nitrophenyl, 3-aminophenyl, 4-aminophenyl or 4-diethylaminophenyl.

[0041] In one embodiment, R 2 Can be H or C 1-6 alkyl.

[0042] In one embodiment, R 3 It may be H, carboxyl, methylcarboxyl, ethylcarboxyl, N-hydroxycarboxamide or carboxamide.

[0043] In one embodiment, the stereoisomers may be optical isomers.

[0044] In one embodiment, the stereoisomer may be a (3R, 6S)-optical isomer.

[0045] In one embodiment, the compound can be a compound selected from the compounds shown in Table 2 and Table 3, a stereoisomer thereof, or a pharmaceutically acceptable salt thereof.

[0046] In another embodiment, the compound can be selected from BnH12003, BnH12017, BnH12045, BnH12046, BnH12047, BnH12048, BnH12051, BnH12053, BnH12057, BnH12058, BnH12064, BnH12066, BnH1206 7. The group consisting of BnH12071, BnH12072, BnH12078, BnH12085, BnH12086, BnH12088, BnH12089, BnH12090, BnH12091, BnH12092, BnH12093, BnH12095, BnH12097 and BnH12098.

[0047] In one embodiment, the compound may be an inhibitor of HDAC.

[0048] In another embodiment, the HDAC may be HDAC4.

[0049] In one embodiment, the compound can enhance synaptic plasticity.

[0050] According to another aspect of the present invention, there is provided a pharmaceutical composition comprising the compound, its stereoisomer or a pharmaceutically acceptable salt thereof as an active ingredient.

[0051] In one embodiment, the composition can be used to prevent or treat neurotic disorders or neurodegenerative disorders.

[0052] In another embodiment, the compound, a stereoisomer thereof, or a pharmaceutically acceptable salt thereof can be delivered to the brain at a concentration of about 0.1 to about 3 μM.

[0053] In another embodiment, the disorder may be Alzheimer's disease.

[0054] In another embodiment, the disorder may be PTSD.

[0055] In one embodiment, the composition may further comprise a second therapeutic agent.

[0056] In another embodiment, the second therapeutic agent may be sulanizumab.

[0057] According to another aspect of the present invention, there is provided a method for preventing or treating a neurotic disorder or a neurodegenerative disorder, comprising administering the compound, a stereoisomer thereof or a pharmaceutically acceptable salt thereof to an individual in need of preventing or treating a neurotic disorder or a neurodegenerative disorder.

[0058] According to another aspect of the present invention, there is provided a medicine or use of the compound, its stereoisomer or pharmaceutically acceptable salt for the preparation of medicine.

[0059] According to one embodiment, the use is for reactivating or enhancing brain synaptic plasticity.

[0060] According to another embodiment, the use is for preventing or treating a neurotic disorder or a neurodegenerative disorder.

[0061] Effects of the Invention

[0062] The compounds of the present invention can exert therapeutic effects on various neurological disorders such as neurodegenerative diseases, neurodegenerative lesions, neuropsychiatric disorders, memory loss, cognitive dysfunction / injury, and regression learning disorders by effectively enhancing or reactivating synaptic plasticity without side effects. BRIEF DESCRIPTION OF THE DRAWINGS

[0063] Figure 1a Shown are the results of measuring the cell viability in SH-SY5Y cells in response to the administration of BnH12003 (0, 0.1, 1, 10, 100 μM).

[0064] Figure 1b Shown are the results of measuring cell viability in 293T cells in response to administration of BnH12003 (0, 0.1, 1, 10, 100 μM).

[0065] Figure 2a Shows the injection site of the osmotic pump (Os pump) in the mouse experiment.

[0066] Figure 2b Shown are the patch recording sites in mouse experiments.

[0067] Figure 3a Shown are the results of measuring the excitation / inhibition balance in the barrel cortex (layer 4) of mice in response to the administration of BnH12003 (Os pump, intracerebroventricular injection, 3 μM).

[0068] Figure 3bShown are changes in TC EPSC potency in mouse barrel cortex (layer 4) in response to administration of BnH12003 (Os pump, intracerebroventricular injection, 3 μM).

[0069] Figure 4a Shown are the results of an assay of excitation / inhibition balance in the barrel cortex (layer 4) of mice in response to intraperitoneal injection of BnH12003 (25 mg / kg).

[0070] Figure 4b Shown are changes in TCEPSC potency in mouse barrel cortex (layer 4) in response to intraperitoneal injection of BnH12003 (25 mg / kg).

[0071] Figure 5 The graph shows the results of measuring changes in the expression level of HDAC4 protein in the barrel cortex (layer 4) of mice in response to administration of BnH12003 (Os pump, barrel cortex injection).

[0072] Figure 6 Shown is the extent of symptom improvement in a rodent (rat) model of post-traumatic stress disorder in response to intraperitoneal injection of BnH12003 (25 mg / kg).

[0073] Figure 7a Shown are changes in the input / output curve (I / O curve) of the field excitatory postsynaptic potential (fEPSP) in the hippocampus of the Alzheimer's disease mouse model in response to the administration of BnH12003 and sulanizumab (Os pump; 3 μM, 200 μg).

[0074] Figure 7b Shown are the results of LTP assay of field excitatory postsynaptic current in the hippocampus of an Alzheimer's disease mouse model in response to administration of BnH12003 and sulantuzumab (Os pump; 3 μM, 200 μg).

[0075] Figure 8a Shown are the results of measuring the excitation / inhibition balance in the barrel cortex (layer 4) of an Alzheimer's disease mouse model in response to administration of BnH12003 and sulantuzumab (intracerebroventricular, Os pump; 3 μM, 200 μg).

[0076] Figure 8b Shown are changes in TC EPSC potency in the barrel cortex (layer 4) of an Alzheimer's disease mouse model in response to administration of BnH12003 and sulantuzumab (Os pump; 3 μM, 200 μg).

[0077] Fig. 9 The binding properties of BnH12003 to HDAC4 are shown.

[0078] Fig.10a and Fig.10b Shown is the knockdown effect of HDAC4 shRNA on HDAC4, BDNF and GluN2B expression in the human cell line SH-SY5Y.

[0079] Figures 11a to 11c Shown are the effects of BnH12003 on the expression of BDNF and GluN2B.

[0080] Fig.12a and Figure 12b Shown is the time-dependent effect of BnH12003 on HDAC4 expression. DETAILED DESCRIPTION

[0081] The present invention is described in detail below with reference to specific drawings for specific embodiments in which the present invention can be implemented, but the present invention is not limited thereto and, if properly described, is limited only by the appended claims and the scope of protection required by the claims. Unless otherwise specified, the terms used in the description of the present invention should be understood as their ordinary meanings and apply to the embodiments or examples of the invention in which these terms are defined and the same terms used in this specification.

[0082] Throughout the detailed description of the present invention, when compositions and kits are described as having or comprising specific components, it is contemplated that the compositions and kits of the present invention consist of the recited components or further exist consisting of the components.

[0083] In applications where an factor or component is included and / or comprises or is selected from a list of factors or components mentioned, it should be understood that the factor or component may be any one of the factors or components mentioned, or the factor or component may be selected from the group consisting of the factors or components.

[0084] It should be understood that the order or sequence of steps used to perform a particular action is not important as long as the invention remains feasible. Moreover, more than two steps or actions may be performed simultaneously.

[0085] At various places in the present specification, variables or parameters are disclosed in groups or ranges. The specific description is specifically intended to include all individual subcombinations of these groups and ranges.

[0086] In this specification, the use of examples or illustrative expressions such as "such as ~" or "including ~" is only intended to better illustrate the present invention, and does not limit the present invention unless otherwise stated. Any expression in this specification should not be interpreted as indicating that any unclaimed factor is essential to the implementation of the present invention.

[0087] I. Definitions

[0088] In this specification, singular terms also refer to the plural form (ie, at least one) unless the context is inappropriate.

[0089] Unless otherwise stated, in this specification, "and / or" means "and" or "or".

[0090] Unless otherwise understood from the context and usage, “at least one” includes each of the items mentioned after it and various combinations of more than two of the items mentioned.

[0091] “Comprise,” “comprises,” “comprising,” “Include,” “includes,” “including,” “have,” “has,” or “having” (including grammatical equivalents thereof) should generally be construed as open-ended and non-limiting, e.g., not excluding other unrecited elements or steps unless the context specifically states or understands otherwise.

[0092] "About" means approximately, in the range of, roughly, or about. When the term "about" is used with a numerical range, it modifies the range by extending the upper and lower boundaries of the listed numerical values. Generally, the term "about" is used in this specification to modify the numerical value by a variation of 10% above and below the indicated value.

[0093] "Individual," "patient," and "subject" are used interchangeably and include any animal, including mammals (e.g., primates including mice, rats, other rodents, rabbits, dogs, cats, pigs, cows, sheep, horses, or humans).

[0094] "Treat", "treating", "treatment" includes any effect that improves, alleviates, reduces, modulates, improves, relieves or eliminates, or ameliorates the symptoms of a condition, disease, disorder, etc. Treatment can be a cure, an amelioration, or at least a partial amelioration of a disorder. In certain embodiments, treatment refers to curing a disease.

[0095] "Active agent" is used to refer to a biologically active compound or a pharmaceutically acceptable salt thereof. In some embodiments, an "active agent" is a compound or a pharmaceutically acceptable salt thereof that has a pharmaceutical use. For example, an active agent can be an anti-neurodegenerative therapeutic agent.

[0096] The "compound" refers to a chemical substance having a structure represented by a chemical formula described in the present specification, a stereoisomer thereof (including a mixture of stereoisomers), or a pharmaceutically acceptable salt thereof.

[0097] "Pharmaceutically acceptable" includes molecular entities and formulations that do not produce adverse, allergic or other untoward reactions when properly administered to animals or humans.

[0098] "Pharmaceutically acceptable salt" refers to a salt that retains the biological effects and properties of a free base or free acid. For example, a pharmaceutically acceptable salt can be prepared by adding an inorganic base or an organic base to a free acid. Salts from inorganic bases include, but are not limited to, sodium, potassium, lithium, ammonium, calcium, magnesium salts, and the like. Salts from organic bases include, but are not limited to, primary amines, secondary amines, and tertiary amines, substituted amines including naturally occurring substituted amines, cyclic amines, and basic ion exchange resins, such as, but not limited to, isopropylamine, trimethylamine, diethylamine, triethylamine, tripropylamine, ethanolamine, diethylamine, lysine, arginine, N-ethylpiperidine, piperidine, piperazine, and the like.

[0099] "Pharmaceutically acceptable excipients" and "pharmaceutically acceptable carriers" refer to substances that facilitate the administration of an active agent to a subject and absorption by the subject, and can be included in the compositions of the present invention without causing significant adverse toxicological effects on the patient. Non-limiting examples of pharmaceutically acceptable excipients include water, NaCl, saline, lactated Ringer's, normal sucrose, normal glucose, binders, fillers, disintegrants, lubricants, coatings, sweeteners, flavoring agents, saline solutions (e.g., Ringer's solution), alcohols, oils, gelatin, carbohydrates (e.g., lactose, amylose or starch), fatty acid esters, hydroxymethylcellulose, polyvinylpyrrolidine, pigments, and the like. Such preparations can be sterilized and, as desired, can be mixed with adjuvants that do not react adversely with the compounds of the present invention, such as lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts that affect osmotic pressure, buffers, colorants, and / or aromatic substances. Those skilled in the art will appreciate that other pharmaceutical excipients are useful for the present invention.

[0100] Exemplary pharmaceutically acceptable carriers or components thereof include sugars, such as lactose, glucose and sucrose; starches, such as corn starch and potato starch; cellulose and its derivatives, such as sodium carboxymethylcellulose, ethylcellulose and methylcellulose; tragacanth powder; malt; gelatin; talc; solid lubricants, such as stearic acid and magnesium stearate; calcium sulfate; synthetic oils; vegetable oils, such as peanut oil, cottonseed oil, sesame oil, olive oil and corn oil; polyols, such as propylene glycol, glycerol, sorbitol, mannitol and polyethylene glycol; alginic acid; phosphate buffer; emulsifiers, such as Wetting agents, such as sodium lauryl sulfate; coloring agents; flavoring agents; tableting agents; stabilizers; antioxidants; preservatives; pyrogen-free water; isotonic saline; and phosphate buffered saline.

[0101] "Pharmaceutical composition" or "pharmaceutical formulation" refers to the combination of an active agent and an inert or active carrier.

[0102] "Effective amount" refers to an amount of a compound or composition (e.g., a compound or composition of the invention) sufficient to achieve a beneficial or desired result. An effective amount can be administered, applied, or dosed once or more and is not intended to be limited to a particular formulation or route of administration.

[0103] "Administering" refers to oral administration, suppository administration, topical contact administration, intravenous administration, parenteral administration, intraperitoneal administration, intramuscular administration, intralesional administration, intrathecal administration, intracranial administration, intraventricular administration, intranasal administration or subcutaneous administration, or implantation of a sustained release device (e.g., mini-Os pump). Administration can be carried out by any route, including parenteral administration and transmucosal administration (e.g., oral, sublingual, palate, gums, nasal cavity, vagina, rectum or transdermal). Parenteral administration includes, for example, intravenous administration, intramuscular administration, intraarterial administration, intradermal administration, subcutaneous administration, intraperitoneal administration, intraventricular administration and intracranial administration. Other delivery methods include, but are not limited to, the use of liposome preparations, intravenous injections, transdermal patches, etc. "Co-administering" or "combined administration" refers to the use of the composition described in this specification sheet while, before or after applying more than one additional therapy (e.g., anticancer agent, chemotherapeutic agent or neurodegenerative disease therapeutic agent). The compound of the present invention can be administered alone or can be co-administered to the patient. Co-administration refers to the simultaneous or sequential administration of the compounds, including single administration or combined administration (of more than one compound or formulation). Thus, the formulation may also be combined with other active substances as desired (e.g., to reduce metabolic degradation).

[0104] The pharmaceutical formulations of the present invention can be administered to mammals, such as humans, but can also be administered to other mammals, such as animals requiring veterinary treatment, such as livestock (e.g., dogs, cats, etc.), farm animals (e.g., cattle, sheep, pigs, horses, etc.), and experimental animals (e.g., rats, mice, guinea pigs, etc.).

[0105] The "cognitive function" of a subject can be defined as an intellectual activity or function. Examples of intellectual activities or functions include, but are not limited to, attention, processing speed, learning and memory, executive function, verbal fluency, and working memory. For example, if the composition of the present invention improves one or more intellectual activities or functions of a subject with impaired cognitive function, it can improve cognitive function.

[0106] "Histone deacetylase" or "HDAC" is intended to refer to any of a family of enzymes that remove Nε-acetyl groups from the ε-amino groups of lysine residues of proteins (e.g., histones or tubulin). Unless the context indicates otherwise, the term "histone" is intended to refer to any histone of any species, including H1, H2A, H2B, H3, H4, and H5.

[0107] "HDAC-mediated disease or disorder" or "histone deacetylase-mediated disease or disorder" refers to a disease or disorder for which HDAC and / or the action of HDAC is important or necessary for the onset, progression or expression.

[0108] "Inhibiting HDAC enzyme activity" or "inhibiting HDAC" refers to reducing the catalytic activity of HDAC or reducing HDAC activity that is not related to catalytic activity.

[0109] "Neurological disorders" include neurodegenerative diseases, neuropsychiatric diseases, memory loss, cognitive dysfunction / impairment, and regression learning disabilities.

[0110] "Neurodegenerative disease" refers to any disease that can be reversed, prevented, controlled, treated, ameliorated or eliminated by an agent that stimulates the generation of new neurons.

[0111] "Memory" refers to the ability to retrieve information about past events or knowledge.

[0112] "Age-related memory loss" refers to a continuum of conditions characterized by a deterioration of neurological function that has not yet reached the level of dementia, as further defined herein and / or as defined in the Diagnostic and Statistical Manual of Mental Disorders: 4th Edition of the American Psychiatric Association (DSM-IV, 1994).

[0113] "Injury-related memory loss" is memory loss caused by damage to the brain and may also involve neurological damage.

[0114] "Cognitive impairment" refers to a state in which cognitive function is not as robust as that of age-matched normal subjects, including a state of cognitive decline.

[0115] Unless otherwise specified, the "alkyl" used in this specification refers to a C1 to C 10 Saturated straight-chain, branched-chain or cyclic primary, secondary or tertiary hydrocarbons, including methyl, CF3, CCl3, CFCl2, CF2C l, ethyl, CH2CF3, CF2CF3, propyl, isopropyl, cyclopropyl, butyl, isobutyl, sec-butyl, tert-butyl, pentyl, cyclopentyl, isopentyl, neopentyl, hexyl, isohexyl, cyclohexyl, cyclohexylmethyl, 3-methylpentyl, 2,2-dimethylbutyl and 2,3-dimethylbutyl. The term includes substituted and unsubstituted alkyl, especially haloalkyl, more especially fluoroalkyl. Non-limiting examples of parts that can replace alkyl are known to those skilled in the art, for example, as disclosed in the literature [Greene et al., Protective Groups in Organic Synthesis, John Wiley and Sons, Second Edition, 1991] to which this specification is referred, selected from the group consisting of unprotected or protected halogen (fluorine, chlorine, bromine or iodine), hydroxyl, amino, alkylamino, arylamino, alkoxy, aryloxy, nitro, cyano, sulfonic acid, sulfate, phosphoric acid, phosphate or phosphate ester as needed.

[0116] As used in this specification, unless otherwise indicated, "aryl" refers to an aromatic monocyclic or polycyclic system containing 6 to 14 carbon atoms, specifically including phenyl, biphenyl or naphthyl, preferably phenyl. The term includes substituted and unsubstituted parts. As known to those skilled in the art, for example, as disclosed in the literature [Gre ene et al., Protective Groups in Organic Synthesis, John Wiley and Sons, Second Edition, 1991] to which this specification is referred, aryl can be selected from unprotected or protected halogen (fluorine, chlorine, bromine or iodine), hydroxyl, amino, alkylamino, arylamino, cycloalkyl, alkoxy, aryloxy, nitro, cyano, sulfonic acid, sulfate, phosphoric acid, phosphate or phosphate ester, as required, and any part of the part recorded is substituted.

[0117] As used in this specification, "heteroaryl", unless otherwise specified, refers to an aromatic monocyclic or polycyclic system having 5 to 14 ring atoms, wherein 1 to 4 ring atoms are independently O, N or S, and the remaining ring atoms are carbon atoms, preferably an aromatic monocyclic system having 5 or 6 ring atoms, wherein 1 to 4 ring atoms are independently O, N or S, and the remaining ring atoms are carbon atoms, specifically including pyridyl, pyridazinyl, pyrimidinyl, pyrazinyl, pyrrolyl, furanyl, thienyl, imidazolyl or oxazolyl. As known to those skilled in the art, for example, as disclosed in the literature [Greene et al., Protective Groups in Organic Synthesis, John Wiley and Sons, 2nd edition, 1991] to which this specification refers, the heteroaryl group may be substituted as required with any of the described moieties including, but not limited to, unprotected or protected, halogen (fluorine, chlorine, bromine or iodine), hydroxyl, amino, alkylamino, cycloalkyl, arylamino, alkoxy, aryloxy, thiol, nitro, cyano, sulfonic acid, sulfate, phosphoric acid, phosphate or phosphate ester, or one or more moieties selected from the group consisting of.

[0118] II. Active Compounds

[0119] In one aspect of the present invention, there is provided a compound represented by formula (1), a stereoisomer thereof or a pharmaceutically acceptable salt thereof:

[0120]

[0121] In the formula,

[0122] R 1 is an aryl or heteroaryl group, or is combined with an adjacent phenyl group to form a saturated or partially saturated heterocyclic ring, wherein one or more hydrogen atoms in the aryl, heteroaryl or heterocyclic ring are not substituted, or are replaced by halogen atoms, C 1-6 Alkyl, C 3-12 Cycloalkyl, C 1-6 Alkoxy, aryl, heteroaryl, amino or nitro substituted, said substituent being unsubstituted or further substituted with one or more halogen atoms or C 1-6 Alkyl substitution,

[0123] R 2 For hydrogen, C 1-6 Alkyl or aryl,

[0124] R 3 is hydrogen, carboxyl, N-hydroxycarboxamide or carboxamide, wherein the hydrogen in the group may be unsubstituted or replaced by C 1-6 Alkyl substitution,

[0125] n is 0 or 1,

[0126] m is 0 to 6.

[0127] In one embodiment, the saturated or partially saturated heterocycle can be a bicyclic ring having 9 to 12 ring atoms, one or more (preferably one or two) of the ring atoms are independently O, N or S, and the remaining ring atoms are carbon atoms.

[0128] In one embodiment, the stereoisomer may be an optical isomer. Preferably, the compound may be in the form of a (3R, 6S)-optical isomer or a (3S, 6R)-optical isomer.

[0129] In one embodiment, R 1 It may be phenyl, pyridyl, pyridazinyl, pyrimidinyl, pyrazinyl, furyl, thienyl, pyrrolyl, imidazolyl or oxazolyl, or may be combined with an adjacent phenyl group to form a quinoxalinyl or dihydrobenzodioxy group.

[0130] In one embodiment, R 1 One or more hydrogen atoms in may be unsubstituted or replaced by halogen atoms, C 1-6 Alkyl, C 3-12 Cycloalkyl, C 1-6 The substituents are substituted by alkoxy, aryl (preferably phenyl), heteroaryl (preferably pyridyl, pyridazinyl, pyrimidinyl, pyrrolyl, furyl, thienyl, imidazolyl or oxazolyl), amino or nitro groups, and the substituents may be selected from halogen atoms and C 1-6 The alkyl group is substituted with more than one group.

[0131] In one embodiment, R 1 One or more hydrogen atoms in the may be substituted by halogen atoms, by one or more halogen atoms, or by unsubstituted C 1-6 Alkyl or C 3-12 Cycloalkyl, C 1-6 Alkoxy, phenyl, pyridyl, pyridazinyl, pyrimidinyl, substituted with one or more C 1-6 The alkyl group may be substituted with an unsubstituted amino group or a nitro group.

[0132] In one embodiment, R 1 It can be phenyl, biphenyl, pyridin-4-yl, pyridin-3-yl, pyridin-2-yl, methylpyridin-3-yl, 6-methoxy-pyridin-3-yl, 6-cyclopropyl-pyridin-3-yl, trifluoromethylpyridin-3-yl, phenylpyridin-3-yl, pyridazin-4-yl, pyridazin-3-yl, pyridazin-2-yl, pyrimidin-2-yl, pyrimidin-4-yl, pyrimidin-5-yl, methylpyrimidin-5-yl, 5-fluoropyrimidin-2-yl, 2-(trifluoromethyl)pyrimidin-5-yl, 2-cyclopropylpyrimidin-5-yl, thiophen-2-yl, furan-2-yl, oxazol-2-yl, 3-nitrophenyl, 4-nitrophenyl, 3-aminophenyl, 4-aminophenyl or 4-diethylaminophenyl.

[0133] In one embodiment, R 1 The phenyl group may be substituted at the 3- or 4-position.

[0134] In one embodiment, R 2 Can be H or C 1-6 alkyl.

[0135] In one embodiment, R 3 It may be H, carboxyl, methylcarboxyl, ethylcarboxyl, N-hydroxycarboxamide or carboxamide.

[0136] In one embodiment, m can be 0 to 3.

[0137] In another embodiment, m can be 0 or 1.

[0138] In one embodiment, the compound of formula (1) can be provided in the form of a pharmaceutically acceptable salt thereof. Preferably, the salt can be a sodium salt.

[0139] In one embodiment, the compounds of formula (1) include but are not limited to the compounds shown in Table 1 below.

[0140] [Table 1]

[0141]

[0142]

[0143]

[0144]

[0145] In one example, the compounds and compositions described in this specification can be HDAC inhibitors. Preferably, the HDAC is HDAC4.

[0146] In another aspect, the compounds and compositions described herein are synaptic plasticity modulators. Preferably, the synaptic plasticity is synaptic plasticity in the barrel cortex (eg, layer 4) of the brain.

[0147] III. Pharmaceutical Compositions

[0148] Generally, the compounds described in this specification can be formulated into pharmaceutical compositions using methods well known to those skilled in the art. The concentration of the active compound in the pharmaceutical composition will vary according to the absorption, inactivation and excretion rate of the drug and other factors known to those skilled in the art. It should be noted that the dosage value will also vary with the severity of the disease to be alleviated. It should also be understood that for any particular subject, the specific application regimen should be adjusted over time according to the needs of the individual and the professional judgment of the person administering the composition or supervising the administration of the composition, and the concentration ranges described in this specification are only illustrative and are not intended to limit the scope or implementation of the claimed composition. The active ingredient can be administered in one go or divided into multiple smaller doses and administered at different time intervals.

[0149] The inhibitor concentration that reduced HDAC activity to 50% of that that did not inhibit HDAC activity was determined as the IC 50 In some embodiments, the reduction in HDAC is at least 50%, such as at least about 75%, such as at least about 90%. In some embodiments, the reduction in HDAC activity is at least 95%, such as at least 99%. In some embodiments, the IC values ​​of the compounds described in this specification are 50 The value is less than 100 nanomolar. In some embodiments, the IC of the compounds described in this specification is 50 The value is 100 nanomolar to 1 micromolar. In some embodiments, the IC of the compounds described in this specification 50 Values ​​range from 1 to 25 micromolar.

[0150] In some embodiments, the inhibition is specific, i.e., the histone deacetylase inhibitor reduces the ability of the histone deacetylase to remove acetyl groups from proteins at a concentration lower than the concentration of the inhibitor required to produce another unrelated biological effect. In some embodiments, the concentration of the inhibitor required for histone deacetylase inhibitory activity is at least 2 times lower than the concentration required to produce an unrelated biological effect, such as at least 5 times lower, such as at least 10 times lower, such as at least 20 times lower.

[0151] In some embodiments, the pharmaceutical composition comprises about 25 mg, about 50 mg, about 75 mg, about 100 mg, about 150 mg, about 200 mg, about 250 mg, about 300 mg, about 350 mg, about 400 mg, about 450 mg, about 500 mg, about 600 mg, about 700 mg, about 800 mg, about 900 mg, about 1000 mg, about 1250 mg, about 1500 mg, about 1750 mg, about 2000 mg, about 2250 mg, about 2500 mg, about 2750 mg, or about 3000 mg of the compound.

[0152] In some embodiments, the pharmaceutical composition comprises about 0.01 mg / kg to about 125 mg / kg of subject body weight / day, preferably about 1 mg / kg to about 50 mg / kg of subject body weight / day, once or more per day to achieve the desired therapeutic effect.

[0153] In a specific embodiment, the composition contains, for example, 0.0001 to 99.9 wt %, preferably 0.001 to 50 wt % of the compound based on the total composition weight. The content ratio is a value based on the dry amount after solvent removal.

[0154] In certain embodiments, the composition comprises a 5% (w / v), 10% (w / v), 15% (w / v), 20% (w / v), 25% (w / v), 30% (w / v), 35% (w / v) or 40% (w / v) aqueous solution of one or more compounds. In some embodiments, the effective amount of the composition comprises a 25% (w / v) solution of one or more compounds.

[0155] In certain embodiments, the pharmaceutical composition of the present invention further comprises one or more pharmaceutically acceptable excipients. In certain embodiments, one or more pharmaceutically acceptable excipients are selected from the group consisting of diluents, buffers, preservatives, stabilizers, solubilizers or any combination thereof.

[0156] In certain embodiments, the pharmaceutical composition can be formulated into a liquid dosage form suitable for oral, intracavitary, intradermal, intramuscular, intrathecal, intravenous, subcutaneous or intracerebroventricular administration.

[0157] In certain embodiments, the liquid dosage form of the pharmaceutical composition as described in the specification further comprises a diluent. In some embodiments, the inactive diluent is physiological saline.

[0158] In a specific embodiment, the liquid dosage form of the pharmaceutical composition as described in the specification also includes a buffer. For example, buffers suitable for use in the present invention include, but are not limited to, organic acids, inorganic acids and salts thereof, such as citrate buffers (e.g., monosodium citrate-disodium citrate mixtures, citric acid-trisodium citrate mixtures, citric acid-monosodium citrate mixtures), succinate buffers (e.g., succinic acid-monosodium succinate mixtures, succinic acid-sodium hydroxide mixtures, succinic acid-disodium succinate mixtures), tartrate buffers (e.g., tartaric acid-sodium tartrate mixtures, tartaric acid-potassium tartrate mixtures, tartaric acid-sodium hydroxide mixtures), fumarate buffers (e.g., fumaric acid-monosodium fumarate mixtures, The present invention also can be used as a buffer of the present invention. The buffer of the present invention can be a mixture of fumaric acid and disodium fumarate, a mixture of monosodium fumarate and disodium fumarate, a gluconate buffer (e.g., a gluconate-sodium gluconate mixture, a gluconate-sodium hydroxide mixture, a gluconate-potassium gluconate mixture), an oxalate buffer (e.g., an oxalic acid-sodium oxalate mixture, an oxalic acid-sodium hydroxide mixture, an oxalic acid-potassium oxalate mixture, etc.), a lactate buffer (e.g., a lactic acid-sodium lactate mixture, a lactic acid-sodium hydroxide mixture, a lactic acid-potassium lactate mixture, etc.) and an acetate buffer (e.g., an acetic acid-sodium acetate mixture, an acetic acid-sodium hydroxide mixture, etc.). In addition, a phosphate buffer, a histidine buffer and a trimethylamine salt (e.g., Tris) can also be used.

[0159] In a particular embodiment, the liquid dosage form of the pharmaceutical composition as described in this specification also includes a preservative. For example, preservatives suitable for use in the present invention include, but are not limited to, phenol, benzyl alcohol, metacresol, methylparaben, propylparaben, octadecyldimethylbenzyl ammonium chloride, benzalkonium chloride halides (e.g., chloride, bromide and iodide), hexamethylammonium chloride and alkylparabens (e.g., methylparaben or propylparaben, catechol, resorcinol, cyclohexanol and 3-pentanol).

[0160] In a specific embodiment, the liquid dosage form of the pharmaceutical composition as described in this specification also includes a stabilizer. For example, suitable stabilizers include, but are not limited to, polyols, triols or higher, amino acids, organic sugars or sugar alcohols, polyvinyl pyrrolidone monosaccharides, trisaccharides, polysaccharides, proteins, sulfur-containing reducing agents, amino acid polymers, and polyethylene glycol.

[0161] In a particular embodiment, the liquid dosage form of the pharmaceutical composition as recorded in this specification also includes a solubilizing agent. In certain embodiments, the solubilizing agent is an ionic surfactant. The example of a nonionic surfactant includes but is not limited to polysorbate, poloxamer, pluronic polyol and polyoxyethylene sorbitol monoether.

[0162] In specific embodiments, the pharmaceutical composition disclosed in the present specification can be prepared into a lyophilized preparation or aqueous solution by mixing the composition with any pharmaceutically acceptable carrier, excipient or stabilizer (e.g., buffer, stabilizer, preservative, isotonic agent, non-ionic detergent, antioxidant and various other additives) commonly used in the art for storage.

[0163] If the compound is administered orally, it can be formulated with pharmaceutically acceptable excipients into pills, capsules, cachets, tablets, and the like.

[0164] Compressed tablets can be prepared by compressing the active ingredient in a free-flowing form (e.g., powder or granules) in a suitable machine, optionally mixed with a binder, lubricant, inactive diluent, preservative, surfactant or dispersant. Molded tablets can be prepared by molding a mixture of powdered active ingredients moistened with an inactive liquid diluent in a suitable machine. The tablets may be optionally coated or scored, and optionally formulated to provide slow or regulated release of the active ingredient. Tablets, lozenges, lozenges, aqueous or oily suspensions, dispersible powders or granules, emulsions, hard or soft capsules (e.g., gelatin capsules), syrups or elixirs can be prepared for oral administration. Preparations of the compounds of the present invention for oral administration can be prepared according to methods for manufacturing pharmaceutical compositions known in the art, and such compositions may contain more than one preparation including sweeteners, flavoring agents, colorants and preservatives to provide palatable preparations. The purified active ingredient is suitably mixed with non-toxic pharmaceutically acceptable excipients suitable for preparing tablets. These excipients may be, for example, inactive diluents such as sodium carbonate or calcium carbonate, lactose, calcium phosphate or sodium phosphate; granulating agents and disintegrants such as corn starch or alginic acid; binders such as starch, gelatin or gum arabic; and lubricants such as magnesium stearate, stearic acid or talc. Tablets may be uncoated or coated by known techniques including microencapsulation to delay disintegration and absorption in the gastrointestinal tract, thereby providing a sustained action over a longer period of time. For example, a time-delaying agent such as glyceryl monostearate or glyceryl distearate may be used alone or with a wax.

[0165] In certain embodiments, the pharmaceutical compositions of the present disclosure are administered to a subject, for example, orally, intracavitarily, intradermally, intramuscularly, intrathecally, intravenously, subcutaneously, or intraventricularly.

[0166] IV. Bioassay

[0167] This specification describes a method for selecting compounds useful for the present invention.

[0168] In one aspect, the compounds of the invention are selected based on their ability to interact with HDAC. In one embodiment, the HDAC is HDAC4. In another embodiment, the binding of the compound to HDAC is determined by surface plasmon resonance identification. In one embodiment, the compound is BnH12003.

[0169] In one aspect, the compound is selected based on its ability to increase the expression of BDNF and / or GluN2B in the targeted neurons. In one aspect, the compound is selected based on its ability to increase the expression of BDNF in the targeted neurons. In another embodiment, the compound is selected based on its ability to increase the expression of GluN2B in the targeted neurons. In one embodiment, RT-PCR is used to determine the expression level. In one embodiment, the compound is BnH12003, BnH12017, BnH12045, BnH12046, BnH12047, BnH12048, BnH12051, BnH12053, BnH12057, BnH12058, BnH12064, BnH12066, BnH12067 7, BnH12071, BnH12072, BnH12078, BnH12085, BnH12086, BnH12088, BnH12089, BnH12090, BnH12091, BnH12092, BnH12093, BnH12095, BnH12097 or BnH12098. In another embodiment, the compound is BnH12003, BnH12046, BnH12057, BnH12067, BnH12091, BnH12092, BnH12095, BnH12097 or BnH12098.

[0170] In one aspect, the compounds of the present invention are selected based on their non-toxicity to human cells. In one embodiment, the compounds of the present invention are selected based on their lack of significant effect on the cell viability of the human cell line SH-SY5Y. In another embodiment, the compounds of the present invention are selected based on their lack of significant effect on the cell viability of the human cell line 293T. The compounds of the present invention do not reduce the cell viability of SH-SY5Y or 293T at a concentration of about 0.1, 1, 10, 100 μM. In one embodiment, the compound can be one selected from the compounds shown in Table 4. Preferably, the compound is BnH120003.

[0171] In one aspect, the compounds of the present invention are selected based on their ability to increase potency when measured by TC EPS C potency in rodent barrel cortex (layer 4). In one embodiment, the compound increases potency measured at a concentration of about 0.1 to about 5 μM when delivered by intraventricular injection via an Os pump. In another embodiment, the concentration can be about 0.1 to about 3 μM. In another embodiment, the concentration can be about 3 μM. In another embodiment, the concentration is about 0.03, 0.1, 0.3, 1, 3 or 10 mg / kg. In one embodiment, the compound is BnH12003. In another embodiment, the compound is delivered by intraperitoneal injection, in which case the compound is BnH12003. In another embodiment, the intraperitoneal injection delivers about 25 mg / kg of the compound.

[0172] In one aspect, the compounds of the invention increase the I / O slope (ms) of the field excitatory postsynaptic potential (fEPSP) in the hippocampus of a rodent model, either alone or in combination with a monoclonal antibody against an amyloid peptide. -1 ). In one embodiment, when the compound and the antibody are administered at a rate of about 3 μM and 200 μg, respectively, by the Os pump in combination with a monoclonal antibody against amyloid β peptide, the compound increases the I / O slope. In another embodiment, the monoclonal antibody is Sulanzhumab. In another embodiment, the compound is BnH12003 and Sulanzhumab.

[0173] In one aspect, the compounds of the invention are selected based on their ability to increase the LTP of the fEPSP slope in the hippocampus of a rodent model of Alzheimer's disease by combining with a monoclonal antibody against amyloid β peptide. In one embodiment, the compound increases the fEPSP slope when the compound and the antibody are administered at a rate of about 3 μM and 200 μg, respectively, by combining an Os pump with a monoclonal antibody against amyloid β peptide. In another embodiment, the monoclonal antibody is sulanzhudan. In another embodiment, the compound is BnH12003.

[0174] In one aspect, the compounds of the invention are selected based on their ability to increase potency when measured by TC EPSC potency in the barrel cortex (layer 4) of an Alzheimer's disease rodent model. In one embodiment, when delivered by intraventricular injection via an Os pump, the compound increases potency measured at a concentration of about 3 μM. In another embodiment, when the compound is delivered in combination with a monoclonal antibody against amyloid beta peptide, the compound increases TC EPSC potency. In another embodiment, the monoclonal antibody is Sulanzhumab. In another embodiment, Sulanzhumab is delivered at a concentration of about 200 μg. In another embodiment, the compound is BnH12003.

[0175] In one aspect, the compounds of the invention are selected for their ability to reduce HDAC 4 expression in rodent barrel cortex (layer 4). In one embodiment, the compound is BnH12003.

[0176] In one aspect, the compounds of the invention are selected based on their ability to reduce symptoms of post-traumatic stress disorder. In one embodiment, the selection is performed by measuring the freezing percentage in a rodent model of post-traumatic stress disorder, wherein the rodents adapt to freezing in response to environmental cues. In one embodiment, the compound is BnH12003.

[0177] Detailed examples of useful methods for selecting compounds of the present invention are described throughout this specification.

[0178] V. Therapeutic Uses of Compounds

[0179] The compounds of the present invention can be useful when inhibiting at least one HDAC type. On the one hand, the compounds described in this specification can be useful in treatment, because it is known that specific HDACs are involved in biological pathways for controlling higher brain functions. Therefore, the compounds described in this application can be useful when brain lesions are related to HDAC or HDAC-mediated.

[0180] Recent reports have detailed the importance of histone acetylation in central nervous system (CNS) functions such as neuronal differentiation, memory formation, drug addiction, and depression (Citrome, Psychopharmacol. Bull. 2003, 37, Suppl. 2, 74-88; Johannessen, CNS Drug Rev. 2003, 9, 199-216; Tsankova et al., 2006, Nat. Neurosci. 9, 519-525).

[0181] A neurotic disorder is a condition characterized by dysfunction of the central or peripheral nervous system. Neurotic disorders may result from developmental abnormalities, disease, genetic defects, injury, or toxins that cause disturbances in the structure or function of the nervous system. These disorders may affect the central nervous system (e.g., the cerebrum, brainstem, and cerebellum), the peripheral nervous system (e.g., cranial nerves, spinal nerves, sympathetic nervous system, and parasympathetic nervous system), and / or the autonomic nervous system (e.g., the part of the nervous system that regulates involuntary behavior, divided into the sympathetic and parasympathetic nervous systems).

[0182] Therefore, the present specification provides a method for treating or preventing an HDAC-mediated neurotic disorder or neurodegenerative disorder in a subject in need of treatment or prevention, comprising administering to the subject a therapeutically effective amount of at least one compound described in the present specification. In some embodiments, the compound described in the present specification can be used to regulate the activity of Class IIa HDAC. In some embodiments, the compound is an inhibitor of HDAC4.

[0183] Most neurodegenerative disorders are caused by degeneration of brain neurons. Neurons containing HDAC4 are widely distributed in the brain (document [Mielcarek et al., 2013, PLoS Biol.11: e1001717]; document [Takase et al., 2013, PloS ONE 8: e58473]). Therefore, the therapeutic method of regulating HDAC4 activity in the brain of the present invention can be useful for any brain neurodegenerative disease, because the intervention mechanism envisioned in the present invention can target HDAC4 in neurons independently of the observed brain lesions. The compounds of the present invention are useful for any neurodegenerative disease. The compounds of the present invention are not subject to the current understanding of the molecular mechanism of HDAC4 in brain neurons. Thus, the compounds of the present invention can be useful for any chronic or acute neurodegenerative disease in which neurons express HDAC4 affected by the pathological manifestations of the disease.

[0184] Examples of chronic neurodegenerative disorders include: chronic neurodegenerative diseases such as familial and sporadic amyotrophic lateral sclerosis (FALS and ALS, respectively), familial and sporadic Parkinson's disease, Huntington's disease, familial and sporadic Alzheimer's disease, multiple sclerosis, muscular dystrophy, olivopontocerebellar atrophy, multiple system atrophy, Wilson's disease, progressive supranuclear palsy, diffuse Lewy body disease, cortical dentate nucleus, The invention relates to neurodegenerative diseases caused by prion protein (PrP) associated with transmissible spongiform encephalopathies (CJD, Gerstmann syndrome, scrapie and kuru) and diseases caused by excess cystatin C accumulation (hereditary cystatin C angiopathy). Examples of acute neurodegenerative disorders include: traumatic brain injury (e.g., surgery-related brain injury), cerebral edema, peripheral nerve injury, spinal cord injury, Leigh's disease, Guillain-Barré syndrome, lysosomal storage diseases, such as lipofuscin deposition, Alpers' disease, restless legs syndrome, vertigo caused by CNS degeneration; pathology caused by, for example, long-term alcohol or drug abuse, including degeneration of the locus coeruleus, cerebellar neurons, drug-induced movement disorders; pathology caused by aging, including degeneration of cerebellar neurons and cortical neurons leading to cognitive and movement disorders; and pathology caused by chronic amphetamine abuse, including degeneration of basal ganglia neurons leading to movement disorders; pathological changes caused by local trauma such as stroke, ischemic lesions, premature vascular aging, hypoxic-ischemic encephalopathy, hyperglycemia, hypoglycemia or direct trauma; pathology caused by negative side effects of therapeutic drugs and treatment methods (e.g., degeneration of target and entorhinal cortical neurons in response to anticonvulsant doses of NMD A antagonists of glutamate receptors) and Wernicke-Korsakoff syndrome.

[0185] In addition to acute or chronic degenerative disorders, the compounds of the present invention may also be useful for treating other types of brain diseases in which the affected neurons are partially regulated by HDAC4. Examples of these diseases include: neuropsychiatric diseases associated with cognition, dementia, social behavior, anxiety or other personality disorders, such as schizophrenia, delirium, attention deficit disorder (ADD), bipolar disorder, obsessive-compulsive disorder or eating disorders; fear and anxiety disorders, such as panic disorder, various phobias, post-traumatic stress disorder (PTSD), psychogenic erectile dysfunction or insomnia; various forms of addiction; and mood disorders such as depression.

[0186] The types of diseases that can benefit from the use of the compounds described in this specification are not limited to brain diseases. Any neurotic disorder in which the affected neurons are regulated by HDAC4 can benefit from the compounds of the present invention. As described in this specification, although Alzheimer's disease and PTSD are very different in pathology and known causes of the disease, they all benefit from the treatment of the compounds described in this specification. Regarding PTSD, BnH12003 allows rodents to get rid of trauma significantly faster than untreated rodents in conditioned fear (fear-conditioned ed). Examples of neurotic disorders that can benefit from the compounds of the present invention include: peripheral neurotic disorders due to degeneration or injury, such as ataxia or trauma; and acute or chronic degenerative diseases, such as glaucoma.

[0187] Memory loss or cognitive impairment may also benefit from treatment with the compounds of the invention, provided that the plasticity of the affected neurons is regulated in part by HDAC4. Examples of such disorders include conditions associated with cognitive function, such as memory loss / impairment, creative behavior, problem solving, and intuition.

[0188] Memory includes short-term memory (also called working memory or recent memory) and long-term memory. Short-term memory includes recent events, while long-term memory includes the recollection of events in the more distant past. Methods for assessing recall memory ability are known to those skilled in the art and may include routine cognitive experiments.

[0189] Age-related memory loss is characterized by objective memory loss in older subjects compared to when they were young, but cognitive test scores are within the normal range for the subject's age. As described in DSM-IV, the scores in the standardized diagnostic test for dementia in subjects with age-related memory loss are within the normal range. Moreover, DSM-IV provides separate diagnostic criteria for a condition named as age-related cognitive decline. Age-related memory loss can include decreased brain weight, gyral atrophy, ventricular dilatation, and selective loss of neurons in different brain regions. For some embodiments of the present invention, more progressive forms of memory loss are also included in the definition of age-related memory impairment. Therefore, people with memory loss and cognitive impairment exceeding normal age but scoring below the diagnostic threshold of Frank's dementia can be referred to as suffering from mild neurocognitive disorder, mild cognitive impairment, late-life amnesia, benign senescent amnesia, early dementia, temporary dementia, etc. These subjects may be more susceptible to Frank's dementia in their later years (also refer to U.S. Patent Application 2006 / 008517).

[0190] Symptoms associated with age-related memory loss include, but are not limited to, changes in brain-related biochemical markers such as IL-1β, IFN-γ, p-JNK, p-ERK, etc., which are manifested as a decline in long-term potentiation, decreased memory and learning ability, and decreased synaptic activity or function. In some implementations, the compounds of the present invention regulate the activity of IL-1β, IFN-γ, p-JNK or p-ERK.

[0191] Methods for enhancing memory may include reestablishing access to memory and memory recovery. The term "reestablishing access" as used in this specification refers to increasing the retrieval of memory. Although not limited by the mechanism of action, the compounds of the present invention can effectively increase the retrieval of memory by reestablishing the synaptic network. The process of reestablishing the synaptic network may include increasing the number of active brain synapses and / or reversing neuronal loss.

[0192] In some cases, learning is referred to as memory. Unlike memory enhancement, learning refers to the ability to form new memories that did not exist before. In some embodiments, in order for the experimental compound to affect the subject's ability to learn rather than recall old memories, at least one compound of the present invention is administered before or simultaneously with memory formation. In some embodiments, in order for the experimental compound to affect the ability to recall previously formed memories, at least one compound described in this specification is administered after memory formation, preferably after memory extinction.

[0193] In addition, a method for enhancing learning and memory formation in a subject suffering from memory loss is provided, comprising administering to the subject an effective amount of at least one compound described in the specification. The method is also useful for enhancing learning and memory formation in normal subjects.

[0194] Neurogenesis, or the birth of new nerve cells, is thought to occur only in developing organisms. However, recent studies have shown that neurogenesis has been confirmed to continue into adulthood and throughout adulthood. Ongoing neurogenesis is considered to be an important mechanism that enables organisms to adapt to environmental changes and affects learning and memory throughout the life process, becoming the basis of neural plasticity. In one aspect, the present invention includes a method for increasing the synaptic density of a subject, comprising administering a compound of the present invention or a pharmaceutically acceptable salt, hydrate, solvate or prodrug thereof to a subject in need of increasing synaptic density. In one aspect, the present invention includes a method for enhancing synaptic plasticity of a subject, comprising administering a compound of the present invention or a pharmaceutically acceptable salt, hydrate, solvate or prodrug thereof to a subject in need of enhancing synaptic plasticity. In one aspect, the present invention includes a method for increasing the density of dendrites of neurons in a subject, comprising administering a compound of the present invention or a pharmaceutically acceptable salt, hydrate, solvate or prodrug thereof to a subject in need of increasing the density of dendrites of neurons.

[0195] The present invention provides a method for enhancing the memory of a subject suffering from memory disorder. Examples of memory disorder types include Alzheimer's disease, absent-minded professor, amnesia, amnesia, anterograde amnesia, blackout (alcohol-related amnesia), bromine poisoning, childhood amnesia, false memory syndrome, fugue state, hyperthymesia, Korsakoff syndrome, intermittent amnesia, memory mistrust syndrome, amnesia, post-traumatic amnesia, prosopamnesia, psychogenic amnesia, repressed memory, retrograde amnesia, Ribot's Law, selective amnesia, source amnesia, source monitoring error, seven sins of memory, tip of the tongue, transient epileptic amnesia, transient global amnesia and twilight sleep.

[0196] In one embodiment, the memory disorder is Alzheimer's disease. The method optionally includes administering the inhibitor and monitoring the subject to confirm whether the previously lost memory is restored. The subject can be monitored by routine experiments known in the art.

[0197] In another embodiment, the Alzheimer's disease subject is a subject with late-stage Alzheimer's disease. Many compounds proposed for treating Alzheimer's disease are designed to treat the early stages of the disease by preventing plaque accumulation. The compounds of the present invention are useful for treating both the early and late stages of dementia because they improve memory and cognition, not just prevent plaque accumulation.

[0198] In one embodiment, the disease or disorder mediated by HDAC is cognitive dysfunction / injury. Therefore, a method for promoting cognitive function in a subject suffering from cognitive dysfunction / injury is also provided, comprising administering to the subject an effective amount of at least one compound described in this specification. The present invention also provides a method for promoting cognitive function in a normal subject.

[0199] In some cases, cognitive function is decreased by about 5%, about 10%, about 30% or more compared to cognitive function measured in age-matched normal subjects. Cognitive function can be improved to any detectable extent, and if it is a human, it is preferably sufficiently improved to enable the impaired subject to carry out daily activities of normal life.

[0200] Cognitive function can be assessed by one or more tests or examinations of cognitive function, which can be selectively defined as such. Non-limiting examples of tests or examinations of cognitive function include CANTAB (e.g., see [Fray et al., "CANTAB battery: proposed utility in neurotoxicology." Neurotoxicol Teratol 1996; 18(4): 499-504]), Stroop Test, Trail Making, Wechsler Digit Span, or CogState computerized cognitive test (see also [Dehaene et al., "Reward-dependent learning in neuronal networks for planning and decision making." Brain Res. 2000; 126: 217-29]; [Iverson et al., "Interpreting change on the WAIS-III / WMS-I11 in clinical samples." Arch Clin Neuropsychol. 2001; 16(2): 183-91]; and [Weaver et al., "Mild memory impairment in healthy older adults is distinct from normal aging." Cogn. 2006; 60(2): 146-55]). The method of the present invention can be used to promote cognitive function of normal subjects or treat, alleviate and / or prevent cognitive dysfunction in subjects. The normal subjects used in this specification refer to subjects who have not yet been diagnosed with diseases related to cognitive impairment.

[0201] In some embodiments, cognitive dysfunction or impairment is associated with, but not limited to, Alzheimer's disease, Huntington's disease, memory loss due to epilepsy, schizophrenia, Rubinstein-Taybi syndrome, Rett syndrome, Fragile X syndrome, dementia with Lewy bodies, vascular dementia, bipolar disorder, and social, cognitive and learning disabilities associated with autism spectrum disorder (ASD), attention deficit hyperactivity disorder (ADHD), dyslexia, learning disabilities, traumatic head injury, cognitive and motor impairment due to stroke, traumatic brain injury, cognitive impairment mediated by neurodegeneration and neuronal loss, and attention deficit disorder.

[0202] In some embodiments, cognitive dysfunction or impairment is associated with, but not limited to, anxiety disorders, conditioned fear responses, panic disorder, obsessive-compulsive disorder, post-traumatic stress disorder, phobias, social anxiety disorder, substance dependence recovery, or age-associated memory impairment (AAMI) and age-related cognitive decline (ARCD).

[0203] It has been confirmed that the administration of HDAC inhibitors sodium butyrate or trichostatin A can promote fear extinction in mice, which reflects the promotion caused by commonly used behavioral manipulations and is consistent with other studies demonstrating the role of the hippocampus in contextual fear extinction (literature [Lattal et al., 2007, Behav. Neurosci. 121, 5, 1125-1131]). In one embodiment, the HDAC-mediated disease or disorder is an extinction learning disorder, such as a fear extinction defect. Therefore, a method for treating or preventing extinction learning disorders in a subject suffering from extinction learning disorders is also provided, comprising administering to the subject an effective amount of at least one compound described in this specification.

[0204] The compounds of the present invention can be used to promote the psychological process of extinction learning, thereby being useful for treating, alleviating and / or preventing neuropsychiatric disorders and other related disorders. Unlike traditional antianxiety drugs that are administered chronically and target the physiological symptoms of anxiety, the compounds of the present invention can be used long-term or short-term with a second therapy (e.g., psychotherapy).

[0205] Although not thoroughly investigated in this specification, HDAC4 mediates gene expression in other cell types including immune cells. The compounds of the present invention are not constrained by the current understanding of the molecular mechanisms of HDAC4 in other types of cells found in immune cells or cancer. Thus, the compounds of the present invention may be useful for any disease, including: hyperproliferative diseases, such as malignant tumors of various origins; immune system diseases, such as autoimmune diseases, inflammation or allergies; infectious diseases; transplant rejection; and fibrotic diseases.

[0206] In some embodiments, the HDAC-mediated disease or disorder is an immune disorder that can be treated together with TNFα or other immunomodulators when a therapeutically effective amount of at least one compound described in this specification is administered to a subject. Therefore, a method for treating an HDAC-mediated immune disorder in a subject is also provided, comprising administering a therapeutically effective amount of at least one compound described in this specification to a subject who needs immune disorder treatment before / during treatment with TNFα or other immunomodulators or after treatment.

[0207] In some embodiments, HDAC-mediated disorders or disorders include the following disorders that can be treated by progenitor cell / stem cell-based therapies: disorders associated with diabetes (organ failure, cirrhosis, and hepatitis); central nervous system (CNS) disorders associated with brain progenitor cell dysregulation (e.g., PTSD); tumors (e.g., retinoblastoma); disorders affecting oligodendrocyte progenitor cells (e.g., astrocytomas and ependymal cell tumors); multiple sclerosis; demyelinating disorders such as leukodystrophy; neuropathy associated with white matter loss; cerebellar disorders such as ataxia; and olfactory precursor disorders (e.g., anosmia disorders). Therefore, a method for treating an HDAC-mediated disease in a subject is also provided, comprising administering to the subject a therapeutically effective amount of at least one compound described in this specification before, during, or after treatment with a progenitor cell / stem cell-based therapy.

[0208] In some embodiments, HDAC-mediated conditions or disorders include blood pressure disorders associated with nitric oxide (NO) regulation (e.g., hypertension, erectile dysfunction, asthma; and eye diseases such as glaucoma). Therefore, a method for treating HDAC-mediated blood pressure diseases associated with nitric oxide (NO) regulation in a subject is also provided, comprising administering a therapeutically effective amount of at least one compound described in this specification to a subject in need of treatment of a blood pressure disease associated with nitric oxide (NO) regulation.

[0209] In some embodiments, the condition or disorder is a cardiac hypertrophic disorder.Therefore, a method for treating HDAC-mediated cardiac hypertrophic disorder in a subject is also provided, comprising administering a therapeutically effective amount of at least one compound described in this specification to a subject in need of cardiac hypertrophic disorder treatment.

[0210] In some embodiments, HDAC-mediated diseases or disorders include blood disorders, such as thalassemia, anemia, and sickle cell anemia. Therefore, a method for treating HDAC-mediated blood disorders in a subject is also provided, comprising administering a therapeutically effective amount of at least one compound described in this specification to a subject in need of blood disorder treatment.

[0211] In some embodiments, HDAC-mediated diseases or disorders include metabolic diseases such as prediabetes or diabetes (type I or type II). Therefore, a method for treating a metabolic disease in a subject is also provided, comprising administering a therapeutically effective amount of at least one compound described in the specification to a subject who needs treatment for a metabolic disease such as prediabetes or diabetes (type I or type II) mediated by HDAC.

[0212] In one aspect, the present invention provides a pharmaceutical composition further comprising a second therapeutic agent for treating an HDAC-mediated disorder or condition in a subject suffering from an HDAC-mediated disorder or condition. In some embodiments, the second therapeutic agent is HDAC4, preferably, for treating an HDAC-mediated disease or condition.

[0213] Also provided is a method for treating an HDAC-mediated disease or disorder in a subject suffering from the HDAC-mediated disease or disorder, wherein at least one compound described in the present specification or a pharmaceutically acceptable salt thereof is administered to the subject in combination with one or more additional active agents.

[0214] In some embodiments, the second therapeutic agent is selected from the group consisting of donepezil, rivastigmine, galantamine, memantine, vilocitate, sulanizumab, bapizumab, aducanumab, lencanizumab, tigrelocibub, epothilone D, and ABBV-8E12.

[0215] In some embodiments, the second therapeutic agent is selected from the group consisting of a cholinesterase inhibitor, an NMDA receptor antagonist, a humanized antibody targeting tau protein, a humanized antibody targeting amyloid beta protein, and a BACE inhibitor.

[0216] Typical treatment methods included in the present invention include combination therapy. For example, the combination therapy can be drug therapy (i.e., the compound of the present invention) and behavioral therapy. Behavioral therapy includes, but is not limited to, electroconvulsive epilepsy therapy, exercise, group therapy, talk therapy, or conditioning. In another embodiment, behavioral therapy is cognitive behavioral therapy. The full content of examples of behavioral therapy that can be used for ongoing methods is, for example, recorded in the literature [Cognitive-Behavioral Therapies by K. Dobson, ed., Guilford Publications, Inc., 2002] and the literature [The new Handbook of Cognitive Therapy: Basics and Beyond by Judith SS Beck, Guilford Publications, Inc. 1995] as a reference to this specification. Any active pharmaceutical ingredient known to those skilled in the art to enhance learning or conditioned reflexes can be used in the method of the present invention. For example, a class of active pharmaceutical ingredients envisioned in this specification includes compounds that increase brain norepinephrine levels. Such compounds include compounds that act as norepinephrine reuptake inhibitors, such as atomoxetine, reboxetine, duloxetine, venlafaxine, and milnacipran, and compounds that cause norepinephrine release, such as amphetamine, dextroamphetamine, pemoline, and methylphenidate. Another class of active pharmaceutical ingredients are compounds that increase brain acetylcholine levels, such as compounds that prevent the breakdown of acetylcholine. Examples of such compounds include, but are not limited to, donepezil hydrochloride or Aric ept, which inhibit cholinesterase activity. TM and tacrine.

[0217] The method for combined treatment may include subjecting the subject to one or more parts of a combined treatment regimen, wherein the combined treatment regimen includes acute administration of a therapeutically effective amount of a compound of the invention that enhances learning or regulation, combined with a psychotherapy component. In one aspect, treatment with the compound occurs within about 24 hours prior to the start of the psychotherapy component, preferably within about 12 hours prior to the start of the psychotherapy component, and more preferably within about 6 hours. The entire course of treatment of a neuropsychiatric disorder requires at least one part of this combined treatment regimen.

[0218] Hereinafter, a more detailed description will be given by the following examples. The following examples are provided to help understand the present invention, but are not intended to limit the scope of the present invention in any way and should not be interpreted as limiting.

[0219] For those skilled in the art, methods for obtaining the compounds described in the present specification or pharmaceutically acceptable salts thereof are obvious, and suitable steps are described in, for example, the following preparation examples and references cited in the present specification.

[0220] VI. Preparation of active compounds

[0221] The present invention provides methods for synthesizing the compounds of the present invention. The names and structures of the compounds are shown in Tables 2 and 3.

[0222] [Table 2]

[0223]

[0224]

[0225]

[0226]

[0227] [Table 3]

[0228]

[0229]

[0230]

[0231]

[0232]

[0233] For those skilled in the art, methods for obtaining the compounds of the present invention, pharmaceutically acceptable salts thereof or stereoisomers described in this application are obvious, and suitable methods are described in the following preparation examples, examples and references cited in this application as examples.

[0234] Preparation Example

[0235] Preparation Example 1. Preparation of active compounds according to representative reaction formula 1

[0236] [Reaction formula 1]

[0237]

[0238]

[0239] (1) Synthesis of compound BnH12036

[0240] (3R,6S)-6-Methyl-1-(2-(quinoxalin-6-yl)acetyl)piperidine-3-carboxylic acid

[0241] Step 1: Synthesis of methyl (3R,6S)-6-methyl-1-(2-(quinoxalin-6-yl)acetyl)piperidine-3-carboxylate

[0242] To a solution of 2-(quinoxalin-6-yl)acetic acid (100 mg, 0.531 mmol) in DMF (2.50 mL) was added (3R, 6S)-rel-6-methyl-3-piperidinecarboxylic acid methyl ester (87.7 mg, 0.558 mg), DIPEA (0.139 mL, 0.797 mmol), HOBt (86.2 mg, 0.638 mmol) and EDC·HCl (99.0 mg, 0.638 mmol). The mixture was stirred overnight at room temperature. The mixture was diluted with EtOAc (5.00 mL) and washed with saturated NH4Cl aqueous solution (5.00 mL) and brine (5.00 mL). The organic layer was dried over MgSO4, filtered and concentrated under reduced pressure. The residue was purified by SiO2 column chromatography (DCM: MeOH = 0 to 5%) to give the desired compound (80.4 mg, 46%) as a dark yellow oil.

[0243] Step 2: Synthesis of compound BnH12036

[0244] 1N NaOH (0.332 mL, 0.332 mmol) was added to a solution of (3R, 6S)-6-methyl-1-(2-(quinoxaline-6-yl)acetyl)piperidine-3-carboxylic acid methyl ester (72.5 mg, 0.221 mmol) in THF (1.50 mL). The mixture was stirred for 2 hours at room temperature. The mixture was diluted with H2O (5.00 mL) and washed twice with DCM (5.00 mL×2). The aqueous layer was acidified to pH 2 to 3 with 1N HCl at 0°C and extracted with EtOAc (5.00 mL). The organic layer was washed with brine (5.00 mL), dried over MgSO4, filtered, and concentrated under reduced pressure to give a white solid compound BnH12036 (20.0 mg, 28%).

[0245] 1H NMR (400MHz, DMSO-d6) δ12.42 (s, 1H), 8.92 (d, J = 4.1Hz, 2H), 8.04 (d, J = 8.6Hz, 1H), 7.94 (d, J = 23.0 Hz, 1H), 7.73 (dd, J=14.3, 8.6Hz, 1H), 4.76 (d, J=8.4Hz, 0.5H), 4.55 (dd, J=13.5, 4.2Hz, 0.5H), 4.36 (d, J=8.9Hz, 0.5H), 1.44-3.97 (m, 2.5H), 3.08 (t, J=12.8Hz, 0.5H), 2.65 (t, J=12.6Hz, 0.5H), 2.29- 2.17 (m, 1H), 1.83-1.78 (m, 1H), 1.73-1.62 (m, 1H), 1.56-1.54 (m, 2H), 1.10 (dd, J=18.1, 6.9Hz, 3H).

[0246] (2) Synthesis of compound BnH12037

[0247] (3R,6S)-1-(2-(2,3-dihydrobenzo[b][1,4]dioxin-6-yl)acetyl)-6-methylpiperidine-3-carboxylic acid

[0248] Step 1: Synthesis of methyl (3R,6S)-1-(2-(2,3-dihydrobenzo[b][1,4]dioxin-6-yl)acetyl)-6-methylpiperidine-3-carboxylate

[0249] To a solution of 2-(2,3-dihydrobenzo[b][1,4]dioxin-6-yl)acetic acid (100 mg, 0.515 mmol) in DMF (2.50 mL) was added (3R,6S)-rel-6-methyl-3-piperidinecarboxylic acid methyl ester (85.0 mg, 0.541 mmol), DIPEA (0.135 mL, 0.772 mmol), HOBt (83.5 mg, 0.618 mmol) and EDC·HCl (95.9 mg, 0.618 mmol). The mixture was stirred overnight at room temperature. The mixture was diluted with EtOAc (5.00 mL) and washed with saturated NH4Cl aqueous solution (5.00 mL) and brine (5.00 mL). The organic layer was dried over MgSO4, filtered, and concentrated under reduced pressure. The residue was purified by SiO2 column chromatography (DCM:MeOH=0 to 5%) to give the desired compound (62.0 mg, 38%) as a dark yellow oil.

[0250] Step 2: Synthesis of compound BnH12037

[0251] 1N NaOH (0.607 mL, 0.607 mmol) was added to a solution of (3R,6S)-1-(2-(2,3-dihydrobenzo[b][1,4]dioxin-6-yl)acetyl)-6-methylpiperidine-3-carboxylic acid methyl ester (135 mg, 0.405 mmol) in THF (2.00 mL). The mixture was stirred at room temperature for 2 hours. The mixture was diluted with H2O (5.00 mL) and washed twice with DCM (5.00 mL×2). The aqueous layer was acidified to pH 1 to 2 with 1N HCl at 0°C and extracted with EtOAc (5.00 mL). The organic layer was washed with brine (5.00 mL), dried over MgSO4, filtered, and concentrated under reduced pressure to give a white solid compound BnH12037 (90.0 mg, 69%).

[0252] 1 H NMR (400MHz, DMSO-d6) δ12.36 (s, 1H), 6.78-6.61 (m, 3H), 4.71 (s, 0.5H), 4.51 ( dd, J=13.3, 4.3Hz, 0.5H), 4.20 (s, 4H), 3.88-3.84 (m, 0.5H), 3.63-3.54 (m, 2H) , 2.97 (t, J=12.9Hz, 0.5H), 2.58 (t, J=12.7Hz, 0.5H), 2.18-2.09 (m, 1H), 1.81- 1.75 (m, 1H), 1.69-1.59 (m, 1H), 1.50-1.43 (m, 2H), 1.03 (dd, J=7.0, 3.4Hz, 3H).

[0253] (3) Synthesis of compound BnH12042

[0254] (3R,6S)-1-(2-([1,1'-biphenyl]-4-yl)acetyl)-6-methylpiperidine-3-carboxylic acid

[0255] Step 1: Synthesis of methyl (3R,6S)-1-(2-([1,1'-biphenyl]-4-yl)acetyl)-6-methylpiperidine-3-carboxylate

[0256] To a solution of 4-biphenylacetic acid (110 mg, 0.518 mmol) in DMF (1.73 mL) were added (3R, 6S)-rel-6-methyl-3-piperidinecarboxylic acid methyl ester (85.6 mg, 0.544 mmol), DIPEA (0.135 mL, 0.777 mmol), HOBt (84.0 mg, 0.622 mmol) and EDC·HCl (96.6 mg, 0.622 mmol). The mixture was stirred at room temperature for 17 hours. The mixture was diluted with EtOAc (5.00 mL) and washed with saturated NH4Cl aqueous solution (5.00 mL) and brine (5.00 mL). The organic layer was dried over MgSO4, filtered, and concentrated under reduced pressure. The residue was purified by SiO2 column chromatography (n-hexane: EtOAc = 3:1) to obtain the desired compound (145 mg, 79%) as a colorless oil.

[0257] Step 2: Synthesis of compound BnH12042

[0258] 1N NaOH (0.619 mL, 0.619 mmol) was added to a solution of (3R, 6S)-1-(2-([1,1'-biphenyl]-4-yl)acetyl)-6-methylpiperidine-3-carboxylic acid methyl ester (145 mg, 0.413 mmol) in THF (1.42 mL). The mixture was stirred for 2 hours at room temperature. The mixture was diluted with H2O (3.00 mL) and washed twice with DCM (3.00 mL×2). The aqueous layer was acidified to pH 1 to 2 with 1N HCl at 0°C and extracted with EtOAc (3.00 mL). The organic layer was washed with brine (3.00 mL), dried over MgSO4, filtered, and concentrated under reduced pressure to give a white solid compound BnH12042 (120 mg, 86%).

[0259] 1 H NMR (400MHz, Chloroform-d) δ7.57 (dd, J=10.6, 7.8Hz, 4H), 7.43 (t, J=7.5Hz, 2H), 7.33 (dd, J=10 .8, 7.6Hz, 3H), 4.99 (s, 0.5H), 4.84 (d, J = 13.7Hz, 0.5H), 4.22 (s, 0.5H), 3.96 (d, J = 13.8Hz, 0.5H) ), 3.79 (s, 2H), 3.17 (t, J = 12.9Hz, 0.5H), 2.79 (t, J = 12.9Hz, 0.5H), 2.41 (s, 0.5H), 2.14 (s, 0.5H) ), 1.92 (d, J = 13.0Hz, 1H), 1.80 (d, J = 13.6Hz, 1H), 1.58 (d, J = 24.0Hz, 2H), 1.15 (d, J = 6.8Hz, 3H).

[0260] (4) Synthesis of compound BnH12078

[0261] (3R,6S)-1-(2-([1,1'-biphenyl]-3-yl)acetyl)-6-methylpiperidine-3-carboxylic acid

[0262] Step 1: Synthesis of methyl (3R,6S)-1-(2-([1,1'-biphenyl]-3-yl)acetyl)-6-methylpiperidine-3-carboxylate

[0263] To a solution of 3-biphenylacetic acid (70.0 mg, 0.328 mmol) in DMF (1.09 mL) were added (3R, 6S)-rel-6-methyl-3-piperidinecarboxylic acid methyl ester (54.2 mg, 0.345 mmol), DIPEA (0.086 mL, 0.492 mmol), HOBt (53.2 mg, 0.394 mmol) and EDC·HCl (61.2 mg, 0.394 mmol). The mixture was stirred overnight at room temperature. The mixture was diluted with EtOAc (5.00 mL) and washed with saturated NH4Cl aqueous solution (5.00 mL) and brine (5.00 mL). The organic layer was dried over MgSO4, filtered, and concentrated under reduced pressure. The residue was purified by SiO2 column chromatography (n-hexane: EtOAc = 2:1) to obtain the desired compound (69.2 mg, 60%) as a colorless oil.

[0264] Step 2: Synthesis of compound BnH12078

[0265] To a solution of (3R,6S)-1-(2-([1,1'-biphenyl]-3-yl)acetyl)-6-methylpiperidine-3-carboxylate (69.2 mg, 0.196 mmol) in THF (0.675 mL) was added 1N NaOH (0.294 mL, 0.294 mmol). The mixture was stirred at room temperature for 2 hours. The mixture was diluted with H2O (3.00 mL) and washed twice with EtOAc (3.00 mL×2). The aqueous layer was acidified to pH 1 to 2 with 1N HCl at 0°C and extracted with EtOAc (3.00 mL). The organic layer was washed with brine (3.00 mL), dried over MgSO4, filtered, and concentrated under reduced pressure. The residue was purified by SiO2 column chromatography (10% MeOH in DCM) to give compound BnH12078 (50.0 mg, 76%) as a white solid.

[0266] 1H NMR (400MHz, DMSO-d6) δ12.43 (s, 1H), 7.63 (t, J=6.1Hz, 2H), 7.49 (dt, J=15.4, 9.1Hz, 4H), 7.39 (dt, J= 14.3, 7.5Hz, 2H), 7.22 (dd, J=16.7, 7.6Hz, 1H), 4.75 (s, 0.5H), 4.54 (d, J=13.6Hz, 0.5H), 4.32 (s, 0.5H) , 3.96 (d, J=13.8Hz, 0.5H), 3.89-3.72 (m, 2H), 3.03 (t, J=12.9Hz, 0.5H), 2.62 (t, J=12.7Hz, 0.5H), 2.16 (d, J=12.8Hz, 1H), 1.79 (d, J=12.8Hz, 1H), 1.71-1.59 (m, 1H), 1.57-1.42 (m, 2H), 1.06 (t, J=6.5Hz, 3H).

[0267] (5) Synthesis of compound BnH12080

[0268] (3R,6S)-6-Methyl-1-(4-(pyridin-3-yl)benzoyl)piperidine-3-carboxylic acid

[0269] Step 1: Synthesis of methyl (3R,6S)-6-methyl-1-(4-(pyridin-3-yl)benzoyl)piperidine-3-carboxylate

[0270] To a suspension of 4-(pyridin-3-yl)benzoic acid (100 mg, 0.502 mmol) in DMF (1.67 mL) was added (3R, 6S)-6-methylpiperidine-3-carboxylic acid methyl ester (82.9 mg, 0.527 mmol), DIPEA (0.132 mL, 0.753 mmol), HOBt (81.4 mg, 0.602 mmol) and EDC·HCl (93.5 mg, 0.602 mmol). The mixture was stirred at room temperature for 2 hours. The mixture was diluted with EtOAc (4.00 mL) and washed with saturated NH4Cl aqueous solution (4.00 mL) and brine (4.00 mL). The organic layer was dried over MgSO4, filtered and concentrated under reduced pressure. The residue was purified by SiO2 column chromatography (DCM: MeOH = 0 to 2%) to give the desired compound (82.0 mg, 48.3%) as a light yellow oil.

[0271] Step 2: Synthesis of compound BnH12080

[0272] 1N NaOH (0.363 mL, 0.363 mmol) was added to a solution of (3R, 6S)-6-methyl-1-(4-(pyridin-3-yl)benzoyl)piperidine-3-carboxylic acid methyl ester (82.0 mg, 0.242 mmol) in THF (0.836 mL). The mixture was stirred at room temperature for 2 hours. The mixture was diluted with H2O (5.00 mL) and washed twice with DCM (5.00 mL×2). The aqueous layer was acidified to pH 3 to 4 with 1N HCl at 0°C and extracted with EtOAc (5.00 mL). The organic layer was washed with brine (5.00 mL), dried over MgSO4, filtered, and concentrated under reduced pressure to give a white solid compound BnH12080 (47.0 mg, 59.8%).

[0273] 1 H NMR (400MHz, DMSO-d6) δ12.47 (s, 1H), 8.95 (d, J=2.4Hz, 1H), 8.62-8.60 (dd, J= 4.8, 1.6Hz, 1H), 8.15-8.12 (m, 1H), 7.83-7.81 (d, J=8.0Hz, 2H), 7.53-7.50 (dd , J=7.9, 4.5Hz, 3H), 2.45-2.34 (m, 2H), 1.92-1.88 (d, J=15.5Hz, 1.5H), 1.80-1 .69 (dt, J=20.7, 7.5Hz, 2H), 1.57 (s, 1.5H), 1.21-1.18 (dd, J=7.1, 2.8Hz, 4H).

[0274] Preparation Example 2. Preparation of active compound according to representative reaction formula 3 [Reaction formula 3]

[0275]

[0276]

[0277]

[0278] Step 1: Synthesis of (3R,6S)-6-methyl-1-(2-(4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl)acetyl)piperidine-3-carboxylic acid methyl ester (Compound 3-1)

[0279] The first step of the above reaction formula 3 was implemented to obtain compound BnH12032. Next, a suspension of compound BnH12032 (1.60 g, 4.52 mmol), biboronic acid pinacol ester (1.62 g, 4.97 mmol) and KOAc (1.33 g, 13.6 mmol) in 1,4-dioxane (15.6 mL) was vigorously stirred, and after bubbling with N2 gas for 5 minutes, Pd(dppf)Cl2 (327 mg, 0.447 mmol) was added. The mixture was bubbled with N2 gas for 5 minutes and refluxed at 100°C for 17 hours. After the reaction was completed, the reaction mixture was filtered through a diatomaceous earth pad and washed with DCM (10.0 mL×3). The combined organic layer was washed with H2O (40.0 mL), dried with MgSO4, filtered, and concentrated under reduced pressure. The residue was purified by SiO2 column chromatography (n-hexane: EtOAc = 1:1) to give brown oily compound 3-1 (1.40 g, 77%).

[0280] (1) Synthesis of compound BnH12043

[0281] (3R,6S)-6-Methyl-1-(2-(4-(pyridin-4-yl)phenyl)acetyl)piperidine-3-carboxylic acid

[0282] Step 1: Synthesis of compound BnH12043

[0283] A solution of compound 3-1 (235 mg, 0.586 mmol), 4-bromopyridine (125 mg, 0.644 mmol) and Na2CO3 (186 mg, 1.76 mmol) in MeCN / H2O (2:1, 7.55 mL) was vigorously stirred, bubbled with N2 for 5 minutes, and Pd(dppf)Cl2 (42.9 mg, 0.059 mmol) was added. The mixture was bubbled with N2 gas for 5 minutes and refluxed at 90°C for 3 hours. Then, after the mixture was cooled to room temperature, 1N NaOH (1.17 mL, 1.17 mmol) was added to the mixture and stirred at room temperature for 3 hours. The mixture was diluted with H2O (3.00 mL) and washed with DCM (3.00 mL×3). 1N NaOH was added to the aqueous layer to adjust the pH value to pH 4 to 5, and the mixture was extracted with EtOAc (3.00 mL×3). The combined organic layers were dried over MgSO4, filtered, and concentrated under reduced pressure. The residue was purified by SiO2 column chromatography (3% MeOH in DCM) to afford compound BnH12043 (85.0 mg, 42%) as a white solid.

[0284] 1H NMR (400MHz, DMSO-d6) δ8.65-8.59 (m, 2H), 7.76 (d, J=7.9Hz, 2H), 7.71 (d, J=5.6Hz, 2H), 7.37 (dd, J =18.7, 7.9Hz, 2H), 4.75 (s, 0.5H), 4.60-4.50 (m, 0.5H), 4.27 (d, J = 7.7Hz, 0.5H), 3.92 (d, J = 13.7Hz, 0.5H), 3.88-3.72(m, 2H), 3.04(t, J=12.9Hz, 0.5H), 2.63(d, J=12.6Hz, 0.5H), 2.24-2.12(m, 1H), 1. 79 (dt, J=16.9, 5.7Hz, 1H), 1.65 (d, J=12.6Hz, 1H), 1.57-1.49 (m, 2H), 1.08 (dt, J=11.7, 4.9Hz, 3H).

[0285] (2) Synthesis of compound BnH12044

[0286] (3R,6S)-6-Methyl-1-(2-(4-(pyridin-2-yl)phenyl)acetyl)piperidine-3-carboxylic acid

[0287] Step 1: Synthesis of compound BnH12044

[0288] A solution of compound 3-1 (235 mg, 0.586 mmol), 2-bromopyridine (125 mg, 0.644 mmol) and Na2CO3 (186 mg, 1.76 mmol) in MeCN / H2O (2:1, 7.55 mL) was vigorously stirred, bubbled with N2 gas for 5 minutes, and Pd(dppf)Cl2 (42.9 mg, 0.059 mmol) was added. The mixture was bubbled with N2 gas for 5 minutes and refluxed at 90°C for 3 hours. Then, the mixture was cooled to room temperature, 1N NaOH (1.17 mL, 1.17 mmol) was added to the mixture, and stirred at room temperature for 3 hours. The mixture was diluted with H2O (3.00 mL) and washed with DCM (3.00 mL×3). 1N NaOH was added to the aqueous layer to adjust the pH value to pH 4 to 5, and the mixture was extracted with EtOAc (3.00 mL×3). The combined organic layers were dried over MgSO4, filtered, and concentrated under reduced pressure. The residue was purified by SiO2 column chromatography (3% to 5% MeOH in DCM) to afford compound BnH12044 (85.0 mg, 42%) as a white solid.

[0289] 1H NMR (400MHz, Chloroform-d) δ8.75 (d, J=23.7Hz, 1H), 7.89 (dd, J=26.8, 7.9Hz, 2H), 7.83-7.67 (m, 2 H), 7.40 (dd, J=16.2, 7.9Hz, 2H), 7.26 (m, 1H), 4.97 (s, 0.5H), 4.81 (d, J=13.9Hz, 0.5H), 4.18 (s, 0.5 H), 3.99 (d, J=13.7Hz, 0.5H), 3.83 (s, 2H), 3.13 (t, J=12.9Hz, 0.5H), 2.80 (t, J=12.9Hz, 0.5H), 2.40 (s, 0.5H), 2.02 (s, 0.5H), 1.88 (s, 1H), 1.81-1.69 (m, 1H), 1.62-1.40 (m, 2H), 1.14 (d, J=6.4Hz, 3H).

[0290] (3) Synthesis of compound BnH12045

[0291] (3R,6S)-6-Methyl-1-(2-(4-(pyridazin-4-yl)phenyl)acetyl)piperidine-3-carboxylic acid

[0292] Step 1: Synthesis of compound BnH12045

[0293] A solution of compound 3-1 (240 mg, 0.598 mmol), 4-bromopyridazine hydrobromide (158 mg, 0.658 mmol) and Na2CO3 (190 mg, 1.79 mmol) in MeCN / H2O (2:1, 7.47 mL) was vigorously stirred, bubbled with N2 gas for 5 minutes, and Pd(dppf)Cl2 (43.8 mg, 0.060 mmol) was added. The mixture was bubbled with N2 gas for 5 minutes and refluxed at 90°C for 3 hours. Then, the mixture was cooled to room temperature, and 1N NaOH (1.20 mL, 1.20 mmol) was added to the mixture and stirred at room temperature for 3 hours. The mixture was diluted with H2O (3.00 mL) and washed with DCM (3.00 mL×3). 1N NaOH was added to the aqueous layer to adjust the pH value to pH 4 to 5, and the mixture was extracted with EtOAc (3.00 mL×3). The combined organic layers were dried over MgSO4, filtered, and concentrated under reduced pressure. The residue was purified by SiO2 column chromatography (5% MeOH in DCM) to afford compound BnH12045 (65.0 mg, 32%) as a pink solid.

[0294] 1H NMR (400MHz, Chloroform-d) δ9.48 (s, 1H), 9.23 (d, J = 5.4Hz, 1H), 7.65 (d, J = 8.1Hz, 3H) , 7.44 (d, J=7.9Hz, 2H), 4.98 (s, 0.5H), 4.84 (d, J=13.6Hz, 0.5H), 4.21 (s, 0.5H), 3.94 ( d, J=14.9Hz, 0.5H), 3.82 (s, 2H), 3.20 (t, J=12.9Hz, 0.5H), 2.82 (s, 0.5H), 2.43 (s, 0.5 H), 2.20 (s, 0.5H), 1.97 (d, J=13.7Hz, 1H), 1.81 (s, 1H), 1.62 (s, 2H), 1.24-1.13 (m, 3H).

[0295] (4) Synthesis of compound BnH12046

[0296] (3R,6S)-6-Methyl-1-(2-(4-(pyridin-3-yl)phenyl)acetyl)piperidine-3-carboxylic acid

[0297] Step 1: Synthesis of compound BnH12046

[0298] A solution of compound 3-1 (235 mg, 0.586 mmol), 3-bromopyridine (102 mg, 0.644 mmol) and Na2CO3 (124 mg, 1.17 mmol) in MeCN / H2O (2:1, 7.55 mL) was vigorously stirred, bubbled with N2 gas for 5 minutes, and Pd(dppf)Cl2 (42.9 mg, 0.059 mmol) was added. The mixture was bubbled with N2 gas for 5 minutes and refluxed at 90°C for 3 hours. Then, the mixture was cooled to room temperature, and 1N NaOH (1.17 mL, 1.17 mmol) was added to the mixture and stirred at room temperature for 3 hours. The mixture was diluted with H2O (3.00 mL) and washed with DCM (3.00 mL×3). 1N NaOH was added to the aqueous layer to adjust the pH value to pH 4 to 5, and the mixture was extracted with EtOAc (3.00 mL×3). The combined organic layers were dried over MgSO4, filtered, and concentrated under reduced pressure. The residue was purified by SiO2 column chromatography (3% to 5% MeOH in DCM) to afford compound BnH12046 (90.2 mg, 45%) as a white solid.

[0299] 1H NMR (400MHz, DMSO-d6) δ12.41 (s, 1H), 8.89 (d, J=2.4Hz, 1H), 8.56 (dd, J=4.8, 1.6Hz, 1H), 8.07 (dt, J=8.0, 2.0Hz, 1H ), 7.68 (d, J=7.8Hz, 2H), 7.48 (dd, J=7.9, 4.7Hz, 1H), 7.35 (dd, J=18.4, 7.8Hz, 2H), 4.75 (s, 0.5H), 4.57-4.49 (m, 0.5 H), 4.29 (s, 0.5H), 3.98-3.87 (m, 0.5H), 3.87-3.71 (m, 2H), 3.04 (t, J=12.9Hz, 0.5H), 2.62 (t, J=12.7Hz, 0.5H), 2.2 0 (dq, J=12.0, 8.1, 7.1Hz, 1H), 1.80 (dd, J=13.4, 3.9Hz, 1H), 1.66 (d, J=13.6Hz, 1H), 1.53 (s, 2H), 1.12-1.03 (m, 3H).

[0300] (5) Synthesis of compound BnH12047

[0301] (3R,6S)-6-Methyl-1-(2-(4-(pyrazin-2-yl)phenyl)acetyl)piperidine-3-carboxylic acid

[0302] Step 1: Synthesis of compound BnH12047

[0303] A solution of compound 3-1 (235 mg, 0.586 mmol), 2-bromopyrazine (102 mg, 0.644 mmol) and Na2CO3 (124 mg, 1.17 mmol) in MeCN / H2O (2:1, 7.55 mL) was vigorously stirred, bubbled with N2 gas for 5 minutes, and Pd(dppf)Cl2 (42.9 mg, 0.059 mmol) was added. The mixture was bubbled with N2 gas for 5 minutes and refluxed at 90°C for 3 hours. Then, the mixture was cooled to room temperature, and 1N NaOH (1.17 mL, 1.17 mmol) was added to the mixture and stirred at room temperature for 3 hours. The mixture was diluted with H2O (3.00 mL) and washed with DCM (3.00 mL×3). 1N NaOH was added to the aqueous layer to adjust the pH value to pH 1 to 2, and the mixture was extracted with EtOAc (3.00 mL×3). The combined organic layers were dried over MgSO4, filtered, and concentrated under reduced pressure. The residue was purified by SiO2 column chromatography (3% to 5% MeOH in DCM) to afford compound BnH12047 (76.0 mg, 38%) as a white solid.

[0304] 1 H NMR (400MHz, DMSO-d6) δ12.41 (s, 1H), 9.25 (d, J = 1.5Hz, 1H), 8.71 (t, J = 2.0Hz, 1H), 8.60 (d, J = 2.5Hz, 1H), 8.10 (d, J =7.9Hz, 2H), 7.39 (dd, J = 18.2, 7.9Hz, 2H), 4.75 (s, 0.5H), 4.55 (dd, J = 13.6, 4.2Hz, 0.5H), 4.28 (s, 0.5H), 3.97-3.89 (m, 0.5H), 3.89-3.74 (m, 2H), 3.04 (t, J=12.9Hz, 0.5H), 2.63 (t, J=12.7Hz, 0.5H), 2.19 (tt, J=12.0, 4.2Hz, 1H), 1.79 (dd, J=13.5, 3.9Hz, 1H), 1.66 (h, J=13.1, 10.8Hz, 1H), 1.52 (dq, J=8.8, 4.9, 4.2Hz, 2H), 1.07 (dd, J=9.1, 6.8Hz, 3H).

[0305] (6) Synthesis of compound BnH12048

[0306] (3R,6S)-6-Methyl-1-(2-(4-(pyrimidin-2-yl)phenyl)acetyl)piperidine-3-carboxylic acid

[0307] Step 1: Synthesis of compound BnH12048

[0308] A solution of compound 3-1 (170 mg, 0.424 mmol), 2-bromopyrimidine (67.4 mg, 0.424 mmol) and Na2CO3 (89.8 mg, 0.847 mmol) in MeCN / H2O (2:1, 5.47 mL) was vigorously stirred, bubbled with N2 gas for 5 minutes, and Pd(dppf)Cl2 (31.0 mg, 0.042 mmol) was added. The mixture was bubbled with N2 gas for 5 minutes and refluxed at 90°C for 3 hours. Then, the mixture was cooled to room temperature, and 1N NaOH (0.847 mL, 0.847 mmol) was added to the mixture and stirred at room temperature for 3 hours. The mixture was diluted with H2O (2.00 mL) and washed with DCM (3.00 mL×3). 1N NaOH was added to the aqueous layer to adjust the pH value to pH 1 to 2, and the mixture was extracted with EtOAc (3.00 mL×3). The combined organic layers were dried over MgSO4, filtered, and concentrated under reduced pressure. The residue was purified by SiO2 column chromatography (3% to 5% MeOH in DCM) to afford compound BnH12048 (34.0 mg, 23%) as a white solid.

[0309] 1 H NMR (400MHz, Chloroform-d) δ8.83 (t, J=5.6Hz, 2H), 8.37 (dd, J=16.1, 7.9Hz, 2H), 7.41 (t, J=6.8 Hz, 2H), 7.20 (t, J=4.9Hz, 1H), 4.98 (s, 0.5H), 4.83 (d, J=13.7Hz, 0.5H), 4.17 (s, 0.5H), 3.99-3. 91 (m, 0.5H), 3.84 (s, 2H), 3.13 (t, J=13.0Hz, 0.5H), 2.80 (t, J=12.8Hz, 0.5H), 2.40 (s, 0.5H), 2. 03 (d, J=7.0Hz, 0.5H), 1.88 (s, 1H), 1.76 (t, J=11.8Hz, 1H), 1.62-1.40 (m, 2H), 1.17-1.09 (m, 3H).

[0310] (7) Synthesis of compound BnH12049

[0311] (3R,6S)-1-(2-(4-(5-fluoropyrimidin-2-yl)phenyl)acetyl)-6-methylpiperidine-3-carboxylic acid

[0312] Step 1: Synthesis of compound BnH12049

[0313] A solution of compound 3-1 (170 mg, 0.424 mmol), 2-bromo-5-fluoropyrimidine (82.5 mg, 0.466 mmol) and Na2CO3 (89.8 mg, 0.847 mmol) in MeCN / H2O (2:1, 5.47 mL) was vigorously stirred, bubbled with N2 gas for 5 minutes, and Pd(dppf)Cl2 (31.0 mg, 0.042 mmol) was added. The mixture was bubbled with N2 gas for 5 minutes and refluxed at 90°C for 3 hours. Then, the mixture was cooled to room temperature, and 1N NaOH (0.847 mL, 0.847 mmol) was added to the mixture and stirred at room temperature for 3 hours. The mixture was diluted with H2O (2.00 mL) and washed with DCM (3.00 mL×3). 1N NaOH was added to the aqueous layer to adjust the pH value to pH 1 to 2, and the mixture was extracted with EtOAc (3.00 mL×3). The combined organic layers were dried over MgSO4, filtered, and concentrated under reduced pressure. The residue was purified by SiO2 column chromatography (3% to 5% MeOH in DCM) to afford compound BnH12049 (42.0 mg, 27%) as a white solid.

[0314] 1H NMR (400MHz, Chloroform-d) δ8.66 (s, 2H), 8.33 (s, 2H), 7.38 (d, J=8.3Hz, 2H), 4.98 (s , 0.5H), 4.83 (d, J=13.8Hz, 0.5H), 4.18 (s, 0.5H), 3.93 (d, J=13.9Hz, 0.5H), 3.82 (s, 2 H), 3.14 (t, J=13.0Hz, 0.5H), 2.79 (t, J=12.8Hz, 0.5H), 2.40 (s, 0.5H), 2.10 (s, 0.5H) , 1.91 (d, J=13.2Hz, 1H), 1.78 (d, J=13.3Hz, 1H), 1.56 (d, J=31.7Hz, 2H), 1.13 (s, 3H).

[0315] (8) Synthesis of compound BnH12050

[0316] (3R,6S)-6-Methyl-1-(2-(4-(2-methylpyrimidin-5-yl)phenyl)acetyl)piperidine-3-carboxylic acid

[0317] Step 1: Synthesis of compound BnH12050

[0318] A solution of compound 3-1 (233 mg, 0.581 mmol), 5-bromo-2-methylpyrimidine (110 mg, 0.639 mmol) and Na2CO3 (123 mg, 1.16 mmol) in MeCN / H2O (2:1, 7.49 mL) was vigorously stirred, bubbled with N2 gas for 5 minutes, and Pd(dppf)Cl2 (42.5 mg, 0.058 mmol) was added. The mixture was bubbled with N2 gas for 5 minutes and refluxed at 90°C for 3 hours. Then, the mixture was cooled to room temperature, and 1N NaOH (1.16 mL, 1.16 mmol) was added to the mixture and stirred at room temperature for 3 hours. The mixture was diluted with H2O (2.00 mL) and washed with DCM (3.00 mL×3). 1N NaOH was added to the aqueous layer to adjust the pH value to pH 1 to 2, and the mixture was extracted with EtOAc (3.00 mL×3). The combined organic layers were dried over MgSO4, filtered, and concentrated under reduced pressure. The residue was purified by SiO2 column chromatography (3% to 5% MeOH in DCM) to afford compound BnH12050 (45.0 mg, 21%) as a white solid.

[0319] 1H NMR (400MHz, Chloroform-d) δ8.88 (d, J=8.6Hz, 2H), 7.53 (d, J=8.0Hz, 2H), 7.39 (s, 2H) , 4.99 (s, 0.5H), 4.84 (d, J = 13.5Hz, 0.5H), 4.21 (s, 0.5H), 3.92 (d, J = 13.9Hz, 0.5H), 3.8 2 (s, 2H), 3.16 (t, J = 12.9Hz, 0.5H), 2.79 (s, 3.5H), 2.42 (s, 1H), 2.19 (d, J = 11.2Hz, 0.5H ), 1.96 (s, 0.5H), 1.80 (t, J = 13.5Hz, 1H), 1.61 (d, J = 16.9Hz, 2H), 1.18 (q, J = 8.0Hz, 3H).

[0320] (9) Synthesis of compound BnH12051

[0321] (3R,6S)-6-Methyl-1-(2-(4-(2-(trifluoromethyl)pyrimidin-5-yl)phenyl)acetyl)piperidine-3-carboxylic acid

[0322] Step 1: Synthesis of compound BnH12051

[0323] A solution of compound 3-1 (240 mg, 0.598 mmol), 2-chloro-5-(trifluoromethyl)pyrimidine (120 mg, 0.658 mmol) and Na2CO3 (127 mg, 1.20 mmol) in MeCN / H2O (2:1, 7.72 mL) was vigorously stirred, bubbled with N2 gas for 5 minutes, and Pd(dppf)Cl2 (43.8 mg, 0.060 mmol) was added. The mixture was bubbled with N2 gas for 5 minutes and refluxed at 90°C for 3 hours. Then, the mixture was cooled to room temperature, and 1N NaOH (1.20 mL, 1.20 mmol) was added to the mixture and stirred at room temperature for 3 hours. The mixture was diluted with H2O (3.00 mL) and washed with DCM (3.00 mL×3). 1N NaOH was added to the aqueous layer to adjust the pH value to pH 1 to 2, and the mixture was extracted with EtOAc (3.00 mL×3). The combined organic layers were dried over MgSO4, filtered, and concentrated under reduced pressure. The residue was purified by SiO2 column chromatography (5% to 10% MeOH in DCM) to afford compound BnH12051 (142 mg, 58%) as a white solid.

[0324] 1H NMR (400MHz, DMSO-d6) δ12.44 (s, 1H), 9.33 (s, 2H), 8.40 (dd, J=8.3, 2.0Hz, 2H), 7.43 (dd, J=17.7, 8.0 Hz, 2H), 4.75 (d, J=9.4Hz, 0.5H), 4.55 (dd, J=13.5, 4.1Hz, 0.5H), 4.26 (d, J=8.6Hz, 0.5H), 3.98-3.78 ( m, 2.5H), 3.04 (t, J=12.9Hz, 0.5H), 2.63 (t, J=12.8Hz, 0.5H), 2.25-2.11 (m, 1H), 1.78 (dt, J=12.4, 3.9 Hz, 1H), 1.66 (dq, J=19.1, 12.9, 10.3Hz, 1H), 1.52 (dq, J=11.8, 7.5, 5.7Hz, 2H), 1.07 (t, J=7.2Hz, 3H).

[0325] (10) Synthesis of compound BnH12052

[0326] (3R,6S)-1-(2-(4-(2-cyclopropylpyrimidin-5-yl)phenyl)acetyl)-6-methylpiperidine-3-carboxylic acid

[0327] Step 1: Synthesis of compound BnH12052

[0328] A solution of compound 3-1 (240 mg, 0.598 mmol), 5-bromo-2-cyclopropylpyrimidine (131 mg, 0.658 mmol) and Na2CO3 (127 mg, 1.20 mmol) in MeCN / H2O (2:1, 7.72 mL) was vigorously stirred, bubbled with N2 gas for 5 minutes, and Pd(dppf)Cl2 (43.8 mg, 0.060 mmol) was added. The mixture was bubbled with N2 gas for 5 minutes and refluxed at 90°C for 3 hours. Then, the mixture was cooled to room temperature, and 1N NaOH (1.20 mL, 1.20 mmol) was added to the mixture and stirred at room temperature for 3 hours. The mixture was diluted with H2O (3.00 mL) and washed with DCM (3.00 mL×3). 1N NaOH was added to the aqueous layer to adjust the pH value to pH 1 to 2, and the mixture was extracted with EtOAc (3.00 mL×3). The combined organic layers were dried over MgSO4, filtered, and concentrated under reduced pressure. The residue was purified by SiO2 column chromatography (5% to 10% MeOH in DCM) to afford compound BnH12052 (84.9 mg, 37%) as a white solid.

[0329] 1H NMR (400MHz, Chloroform-d) δ8.79 (s, 2H), 7.50 (d, J=8.0Hz, 2H), 7.38 (d, J=8.2Hz, 2H), 4.99 (s, 0 .5H), 4.84 (d, J=13.8Hz, 0.5H), 4.21 (s, 0.5H), 3.93 (d, J=14.0Hz, 0.5H), 3.80 (s, 2H), 3.17 (t, J=1 2.9Hz, 0.5H), 2.81 (t, J=12.9Hz, 0.5H), 2.43 (s, 0.5H), 2.30 (ddd, J=13.1, 8.2, 4.8Hz, 1H), 2.20 (s , 0.5H), 1.95 (s, 1H), 1.81 (d, J=15.7Hz, 1H), 1.61 (d, J=16.2Hz, 2H), 1.15 (dd, J=16.0, 9.3Hz, 7H).

[0330] (11) Synthesis of compound BnH12053

[0331] Sodium (3R,6S)-6-methyl-1-(2-(4-(1-methyl-1H-imidazol-2-yl)phenyl)acetyl)piperidine-3-carboxylate

[0332] Step 1: Synthesis of compound BnH12053

[0333] A solution of compound 3-1 (240 mg, 0.598 mmol), 2-bromo-1-methylimidazole (106 mg, 0.658 mmol) and Na2CO3 (127 mg, 1.20 mmol) in MeCN / H2O (2:1, 7.72 mL) was vigorously stirred, bubbled with N2 gas for 5 minutes, and Pd(dppf)Cl2 (43.8 mg, 0.060 mmol) was added. The mixture was bubbled with N2 gas for 5 minutes and refluxed at 90°C for 3 hours. Then, the mixture was cooled to room temperature, and 1N NaOH (1.20 mL, 1.20 mmol) was added to the mixture and stirred at room temperature for 3 hours. The mixture was diluted with H2O (3.00 mL) and washed with DCM (3.00 mL×3). The aqueous layer was concentrated under reduced pressure and purified by C18-SiO2 column chromatography (MeOH:H2O=1:1) to obtain a white solid compound BnH12053 (163 mg, 75%).

[0334] 1H NMR (400MHz, DMSO-d6) δ7.65-7.57 (m, 2H), 7.33 (d, J=7.9Hz, 1H), 7.28 (d, J=7.9Hz, 1 H), 7.23 (s, 1H), 6.95 (s, 1H), 4.72 (s, 0.5H), 4.46 (dd, J=14.6, 3.8Hz, 0.5H), 4.20 (d , J=5.7Hz, 0.5H), 3.86-3.66 (m, 5.5H), 2.96 (t, J=12.9Hz, 0.5H), 2.55 (t, J=12.9Hz, 0.5H), 1.88-1.66 (m, 2H), 1.51 (tq, J=31.1, 16.4, 13.9Hz, 3H), 1.05 (tq, J=7.2Hz, 3H).

[0335] (12) Synthesis of compound BnH12054

[0336] (3R,6S)-6-Methyl-1-(2-(4-(pyrimidin-4-yl)phenyl)acetyl)piperidine-3-carboxylic acid

[0337] Step 1: Synthesis of compound BnH12054

[0338] A solution of compound 3-1 (240 mg, 0.598 mmol), 4-chloropyrimidine (99.3 mg, 0.658 mmol) and Na2CO3 (190 mg, 1.79 mmol) was vigorously stirred, bubbled with N2 gas for 5 minutes, and Pd(dppf)Cl2 (43.8 mg, 0.060 mmol) was added. The mixture was bubbled with N2 gas for 5 minutes and refluxed at 90°C for 3 hours. Then, the mixture was cooled to room temperature, and 1N NaOH (1.20 mL, 1.20 mmol) was added to the mixture and stirred at room temperature for 3 hours. The mixture was diluted with H2O (3.00 mL) and washed with DCM (3.00 mL×3). 1N NaOH was added to the aqueous layer to adjust the pH value to pH 1 to 2, and the mixture was extracted with EtOAc (3.00 mL×3). The combined organic layer was dried with MgSO4, filtered, and concentrated under reduced pressure. The residue was purified by SiO2 column chromatography (5% to 10% MeOH in DCM) to afford compound BnH12054 (83.4 mg, 41%) as a white solid.

[0339] 1H NMR (400MHz, DMSO-d6) δ12.44 (s, 1H), 9.23 (s, 1H), 8.85 (d, J = 5.4Hz, 1H), 8.17 (d, J = 8.0Hz, 2H), 8.08 (d, J = 5.4 Hz, 1H), 7.40 (dd, J=18.3, 7.9Hz, 2H), 4.75 (s, 0.5H), 4.54 (dd, J=14.0, 4.2Hz, 0.5H), 4.28 (d, J=8.3Hz, 0.5H), 3 .96-3.73 (m, 2.5H), 3.03 (t, J=12.9Hz, 0.5H), 2.62 (t, J=12.7Hz, 0.5H), 2.19 (tt, J=12.0, 4.1Hz, 1H), 1.79 (dt , J=13.4, 4.5Hz, 1H), 1.67 (tt, J=17.4, 8.0Hz, 1H), 1.51 (tq, J=9.3, 4.6, 4.0Hz, 2H), 1.08 (q, J=8.3, 7.8Hz, 3H).

[0340] (13) Synthesis of compound BnH12055

[0341] (3R,6S)-6-Methyl-1-(2-(4-(thiophen-2-yl)phenyl)acetyl)piperidine-3-carboxylic acid

[0342] Step 1: Synthesis of compound BnH12055

[0343] A solution of compound 3-1 (240 mg, 0.598 mmol), 2-bromothiophene (107 mg, 0.658 mmol) and Na2CO3 (190 mg, 1.79 mmol) in MeCN / H2O (2:1, 7.72 mL) was vigorously stirred, bubbled with N2 gas for 5 minutes, and Pd(dppf)Cl2 (43.8 mg, 0.060 mmol) was added. The mixture was bubbled with N2 gas for 5 minutes and refluxed at 90°C for 3 hours. Then, the mixture was cooled to room temperature, and 1N NaOH (1.20 mL, 1.20 mmol) was added to the mixture and stirred at room temperature for 3 hours. The mixture was diluted with H2O (3.00 mL) and washed with DCM (3.00 mL×3). 1N NaOH was added to the aqueous layer to adjust the pH value to pH 1 to 2, and the mixture was extracted with EtOAc (3.00 mL×3). The combined organic layers were dried over MgSO4, filtered, and concentrated under reduced pressure. The residue was purified by SiO2 column chromatography (5% MeOH in DCM) to afford compound BnH12055 (30 mg, 14%) as an ivory solid.

[0344] 1H NMR (400MHz, Chloroform-d) δ7.57 (d, J=7.9Hz, 2H), 7.26 (d, J=3.4Hz, 4H), 7.07 (dd, J=5.1, 3. 6Hz, 1H), 4.98 (s, 0.5H), 4.83 (d, J = 13.6Hz, 0.5H), 4.18 (s, 0.5H), 3.93 (d, J = 14.1Hz, 0.5H), 3 .75(s, 2H), 3.15(t, J=13.1Hz, 0.5H), 2.78(t, J=12.9Hz, 0.5H), 2.40(s, 0.5H), 2.15(s, 0.5H) , 1.92 (d, J = 12.7Hz, 1H), 1.79 (d, J = 12.3Hz, 1H), 1.57 (d, J = 27.2Hz, 2H), 1.14 (d, J = 6.9Hz, 3H).

[0345] (14) Synthesis of compound BnH12056

[0346] (3R,6S)-1-(2-(4-(Furan-2-yl)phenyl)acetyl)-6-methylpiperidine-3-carboxylic acid

[0347] Step 1: Synthesis of compound BnH12056

[0348] A solution of compound 3-1 (240 mg, 0.598 mmol), 5-bromofuran (96.7 mg, 0.658 mmol) and Na2CO3 (190 mg, 1.79 mmol) in MeCN / H2O (2:1, 7.72 mL) was vigorously stirred, bubbled with N2 gas for 5 minutes, and Pd(dppf)Cl2 (43.8 mg, 0.060 mmol) was added. The mixture was bubbled with N2 gas for 5 minutes and refluxed at 90°C for 3 hours. Then, the mixture was cooled to room temperature, and 1N NaOH (1.20 mL, 1.20 mmol) was added to the mixture and stirred at room temperature for 3 hours. The mixture was diluted with H2O (3.00 mL) and washed with DCM (3.00 mL×3). 1N NaOH was added to the aqueous layer to adjust the pH value to pH 1 to 2, and the mixture was extracted with EtOAc (3.00 mL×3). The combined organic layers were dried over MgSO4, filtered, and concentrated under reduced pressure. The residue was purified by SiO2 column chromatography (5% MeOH in DCM) to afford compound BnH12056 (109 mg, 55%) as an ivory solid.

[0349] 1H NMR (400MHz, Chloroform-d) δ7.63 (d, J=8.0Hz, 2H), 7.48-7.43 (m, 1H), 7.27 (d, J=6.0Hz, 2H), 6.63 (d, J =3.3Hz, 1H), 6.46 (dd, J = 3.4, 1.8Hz, 1H), 4.97 (s, 0.5H), 4.82 (d, J = 13.6Hz, 0.5H), 4.17 (s, 0.5H), 3.92 (d, J=13.7Hz, 0.5H), 3.76 (s, 2H), 3.13 (t, J=13.0Hz, 0.5H), 2.78 (t, J=12.8Hz, 0.5H), 2.39 (s, 0.5H), 2 .11 (s, 0.5H), 1.91 (d, J = 12.7Hz, 1H), 1.77 (d, J = 13.0Hz, 1H), 1.67-1.40 (m, 2H), 1.13 (d, J = 8.7Hz, 3H).

[0350] (15) Synthesis of compound BnH12072

[0351] (3R,6S)-6-Methyl-1-(2-(3'-nitro-[1,1'-biphenyl]-4-yl)acetyl)piperidine-3-carboxylic acid

[0352] Step 1: Synthesis of compound BnH12072

[0353] A solution of compound 3-1 (150 mg, 0.374 mmol), 3-bromonitrobenzene (75.5 mg, 0.374 mmol) and Na2CO3 (79.2 mg, 0.4748 mmol) in MeCN / H2O (2:1, 4.82 mL) was vigorously stirred, bubbled with N2 gas for 5 minutes, and Pd(dppf)Cl2 (27.4 mg, 0.037 mmol) was added. The mixture was bubbled with N2 gas for 5 minutes and refluxed at 90°C for 3 hours. Then, the mixture was cooled to room temperature, and 1N NaOH (0.748 mL, 0.748 mmol) was added to the mixture and stirred at room temperature for 17 hours. The mixture was diluted with H2O (4.00 mL) and washed with EtOAc (4.00 mL×3). 1N NaOH was added to the aqueous layer to adjust the pH value to pH 3 to 4, and the mixture was extracted with EtOAc (4.00 mL×3). The combined organic layers were dried over MgSO4, filtered, and concentrated under reduced pressure. The residue was purified by SiO2 column chromatography (3% to 5% MeOH in DCM) to afford BnH12072 (120 mg, 84%) as an off-white solid.

[0354] 1H NMR (400MHz, DMSO-d6) δ8.44 (t, J=2.0Hz, 1H), 8.25-8.13 (m, 2H), 7.77 (t, J=8.1Hz, 3H), 7 .38 (dd, J=18.2, 7.9Hz, 2H), 4.75 (s, 0.5H), 4.55 (d, J=13.3Hz, 0.5H), 4.29 (s, 0.5H), 3.94 (s, 0.5H), 3.85-3.73 (m, 2H), 3.05 (t, J=12.8Hz, 0.5H), 2.67-2.57 (t, J=12.8Hz, 0.5H), 2. 20 (s, 1H), 1.80 (dd, J=18.3, 6.8Hz, 1H), 1.67 (d, J=13.3Hz, 1H), 1.54 (s, 2H), 1.08 (s, 3H).

[0355] (16) Synthesis of compound BnH12077

[0356] (3R,6S)-6-Methyl-1-(2-(4'-nitro-[1,1'-biphenyl]-4-yl)acetyl)piperidine-3-carboxylic acid

[0357] Step 1: Synthesis of compound BnH12077

[0358] A solution of compound 3-1 (150 mg, 0.374 mmol), 4-bromonitrobenzene (75.5 mg, 0.374 mmol) and Na2CO3 (79.2 mg, 0.748 mmol) in MeCN / H2O (2:1, 4.82 mL) was vigorously stirred, bubbled with N2 gas for 5 minutes, and Pd(dppf)Cl2 (27.4 mg, 0.037 mmol) was added. The mixture was bubbled with N2 gas for 5 minutes and refluxed at 90°C for 3 hours. Then, the mixture was cooled to room temperature, and 1N NaOH (0.748 mL, 0.748 mmol) was added to the mixture and stirred at room temperature for 17 hours. The mixture was diluted with H2O (4.00 mL) and washed with EtOAc (4.00 mL×3). 1N NaOH was added to the aqueous layer to adjust the pH value to pH 3 to 4, and the mixture was extracted with EtOAc (4.00 mL×3). The combined organic layers were dried over MgSO4, filtered, and concentrated under reduced pressure. The residue was purified by SiO2 column chromatography (5% to 10% MeOH in DCM) to afford compound BnH12077 (107 mg, 75%) as a brown solid.

[0359] 1H NMR (400MHz, DMSO-d6) δ8.30 (d, J=8.3Hz, 2H), 7.97 (d, J=8.4Hz, 2H), 7.75 (d, J=7.8Hz, 2H), 7.38 (dd, J=18.5, 7.8Hz, 2H), 4.75 (s, 0.5H), 4.54 (dd, J=13.1, 4.0Hz, 0.5H), 4.29 (s, 0.5H), 3.92 (d, J=12.9Hz , 0.5H), 3.82 (q, J=11.9, 8.6Hz, 2H), 3.04 (t, J=12.9Hz, 0.5H), 2.62 (t, J=12.8Hz, 0.5H), 2.19 (d, J=1 0.1Hz, 1H), 1.79 (q, J=9.5, 6.7Hz, 1H), 1.66 (d, J=13.2Hz, 1H), 1.57-1.49 (m, 2H), 1.15-1.08 (m, 3H).

[0360] (17) Synthesis of compound BnH12081

[0361] (3R,6S)-1-(2-(4-(6-methoxypyridin-3-yl)phenyl)acetyl)-6-methylpiperidine-3-carboxylic acid

[0362] Step 1: Synthesis of compound BnH12081

[0363] A solution of compound 3-1 (220 mg, 0.548 mmol), 5-bromo-2-methoxypyridine (0.071 mL, 0.548 mmol) and Na2CO3 (116 mg, 1.10 mmol) in MeCN / H2O (2:1, 7.07 mL) was vigorously stirred, bubbled with N2 gas for 5 minutes, and Pd(dppf)Cl2 (40.1 mg, 0.055 mmol) was added. The mixture was bubbled with N2 gas for 5 minutes and refluxed at 90°C for 3 hours. Then, the mixture was cooled to room temperature, and 1N NaOH (1.10 mL, 1.10 mmol) was added to the mixture and stirred at room temperature for 17 hours. The mixture was diluted with H2O (7.00 mL) and washed with EtOAc (5.00 mL×3). 1N NaOH was added to the aqueous layer to adjust the pH value to pH 3 to 4, and the mixture was extracted with EtOAc (5.00 mL×3). The combined organic layers were dried over MgSO4, filtered, and concentrated under reduced pressure. The residue was purified by SiO2 column chromatography (10% MeOH in DCM) to afford compound BnH12081 (107 mg, 75%) as a white solid.

[0364] 1H NMR (400MHz, DMSO-d6) δ12.37 (s, 1H), 8.47 (d, J=2.5Hz, 1H), 8.00 (dd, J=8.6, 2.6Hz, 1H), 7.60 (d, J=7.9Hz, 2H), 7.30 (dd, J=18.4, 7.8Hz, 2H), 6.90 (d, J=8.6Hz, 1H), 4.75 (s, 0.5H), 4.54 (d, J=13.5 Hz, 0.5H), 4.28 (s, 0.5H), 3.89 (s, 0.5H), 3.84-3.68 (m, 2H), 3.03 (t, J=12.9Hz, 0.5H), 2.67-2.56 (m, 0.5H), 2.19 (s, 1H), 1.85-1.74 (m, 1H), 1.66 (d, J=13.1Hz, 1H), 1.52 (s, 2H), 1.10-1.04 (m, 3H).

[0365] (18) Synthesis of compound BnH12082

[0366] (3R,6S)-1-(2-(4-(6-cyclopropylpyridin-3-yl)phenyl)acetyl)-6-methylpiperidine-3-carboxylic acid

[0367] Step 1: Synthesis of compound BnH12082

[0368] A solution of compound 3-1 (200 mg, 0.498 mmol), 3-bromo-6-(cyclopropyl)pyridine (0.060 mL, 0.498 mmol) and Na2CO3 (106 mg, 0.997 mmol) in MeCN / H2O (2:1, 6.42 mL) was vigorously stirred, bubbled with N2 gas for 5 minutes, and Pd(dppf)Cl2 (36.5 mg, 0.050 mmol) was added. The mixture was bubbled with N2 gas for 5 minutes and refluxed at 90°C for 2 hours. Then, the mixture was cooled to room temperature, and 1N NaOH (1.10 mL, 1.10 mmol) was added to the mixture and stirred at room temperature for 17 hours. The mixture was diluted with H2O (6.00 mL) and washed with EtOAc (4.00 mL×3). 1N NaOH was added to the aqueous layer to adjust the pH value to pH 1 to 2, and the mixture was washed with EtOAc (4.00 mL×2). 1N NaOH was added to the aqueous layer to adjust the pH value to pH 4 to 5, and the mixture was extracted with EtOAc (4.00 mL x 3). The combined organic layer was dried over MgSO4, filtered, and concentrated under reduced pressure to give a white solid compound BnH12082 (120 mg, 64%).

[0369] 1H NMR (400MHz, DMSO-d6) δ12.30 (s, 1H), 8.70 (d, J = 2.4Hz, 1H), 7.92 (dd, J = 8.1, 2.4Hz, 1H), 7.63 (d, J = 7.8Hz, 2 H), 7.40-7.26 (m, 3H), 4.75 (s, 0.5H), 4.59-4.50 (m, 1=0.5H), 4.29 (s, 0.5H), 3.93 (d, J=11.1Hz, 0.5H), 3.85 -3.69 (m, 2H), 3.04 (t, J=12.8Hz, 0.5H), 2.68-2.57 (t, J=12.8Hz, 0.5H), 2.31-2.04 (m, 2H), 1.80 (dd, J=13.2 , 3.6Hz, 1H), 1.66 (d, J=12.5Hz, 1H), 1.58-1.43 (m, 2H), 1.14-1.03 (m, 3H), 0.96 (td, J=7.3, 6.5, 2.5Hz, 4H).

[0370] (19) Synthesis of compound BnH12083

[0371] (3R,6S)-6-Methyl-1-(2-(4-(6-(trifluoromethyl)pyridin-3-yl)phenyl)acetyl)piperidine-3-carboxylic acid

[0372] Step 1: Synthesis of compound BnH12083

[0373] A solution of compound 3-1 (240 mg, 0.598 mmol), 5-bromo-2-trifluoromethylpyridine (135 mg, 0.598 mmol) and Na2CO3 (127 mg, 1.20 mmol) in MeCN / H2O (2:1, 7.71 mL) was vigorously stirred, bubbled with N2 gas for 5 minutes, and Pd(dppf)Cl2 (43.8 mg, 0.060 mmol) was added. The mixture was bubbled with N2 gas for 5 minutes and refluxed at 90°C for 3 hours. Then, the mixture was cooled to room temperature, and 1N NaOH (1.20 mL, 1.20 mmol) was added to the mixture and stirred at room temperature for 17 hours. The mixture was diluted with H2O (7.00 mL) and washed with EtOAc (5.00 mL×3). 1N NaOH was added to the aqueous layer to adjust the pH value to pH 3 to 4, and the mixture was extracted with EtOAc (5.00 mL×3). The combined organic layers were dried over MgSO4, filtered, and concentrated under reduced pressure. The residue was purified by SiO2 column chromatography (10% MeOH in DCM) to afford compound BnH12083 (167 mg, 69%) as an off-white solid.

[0374] 1H NMR (400MHz, DMSO-d6) δ12.41 (s, 1H), 9.10 (d, J = 2.3Hz, 1H), 8.37 (dd, J = 8.2, 2.3Hz, 1H), 7.98 (d, J = 8.2Hz, 1H) , 7.79 (d, J = 8.0Hz, 2H), 7.40 (dd, J = 18.3, 7.9Hz, 2H), 4.76 (s, 0.5H), 4.59-4.51 (d, J = 13.3Hz, 0.5H), 4.34-4.25 (m, 0.5H), 3.94 (d, J=13.3Hz, 0.5H), 3.82 (qd, J=15.4, 5.8Hz, 2H), 3.06 (t, J=12.8Hz, 0.5H), 2.69-2.58 (m, 0.5H ), 2.31-2.13(m, 1H), 1.87-1.77(m, 1H), 1.67(d, J=11.6Hz, 1H), 1.54(dt, J=6.7, 3.8Hz, 2H), 1.14-1.02(m, 3H).

[0375] (20) Synthesis of compound BnH12084

[0376] (3R,6S)-6-Methyl-1-(2-(4-(6-methylpyridin-3-yl)phenyl)acetyl)piperidine-3-carboxylic acid

[0377] Step 1: Synthesis of compound BnH12084

[0378] A solution of compound 3-1 (200 mg, 0.498 mmol), 5-bromo-2-methylpyridine (85.7 mg, 0.498 mmol) and Na2CO3 (106 mg, 0.997 mmol) in MeCN / H2O (2:1, 6.42 mL) was vigorously stirred, bubbled with N2 gas for 5 minutes, and Pd(dppf)Cl2 (36.5 mg, 0.050 mmol) was added. The mixture was bubbled with N2 gas for 5 minutes and refluxed at 90°C for 2.5 hours. Then, the mixture was cooled to room temperature, and 1 N NaOH (0.997 mL, 0.997 mmol) was added to the mixture and stirred at room temperature for 3 hours. The mixture was diluted with H2O (6.00 mL) and washed with EtOAc (4.00 mL×3). 1 N NaOH was added to the aqueous layer to adjust the pH value to pH 3 to 4, and the mixture was extracted with EtOAc (4.00 mL×3). The combined organic layer was dried over MgSO4, filtered, and concentrated under reduced pressure. Et2O (2.00 mL) was added to the residue and stirred at room temperature for 30 minutes. The precipitate was filtered and washed with Et2O (3.00 mL) to obtain a white solid compound BnH12084 (92.0 mg, 52%).

[0379] 1 H NMR (400MHz, Chloroform-d) δ8.82 (s, 1H), 8.02 (d, J = 7.9Hz, 1H), 7.56 (d, J = 7.6Hz, 2H), 7.41 (d, J=7.5Hz, 3H), 5.00 (s, 0.5H), 4.86 (s, 0.5H), 4.23 (s, 0.5H), 3.95 (d, J=13.6Hz, 0 .5H), 3.84(s, 2H), 3.18(t, J=12.8Hz, 0.5H), 2.84(s, 0.5H), 2.74(s, 3H), 2.44(s, 0.5H) , 2.19 (s, 0.5H), 1.99 (d, J = 13.4Hz, 1H), 1.82 (s, 1H), 1.64 (s, 2H), 1.17 (d, J = 7.9Hz, 3H).

[0380] (21) Synthesis of compound BnH12085

[0381] (3R,6S)-1-(2-(4'-cyclohexyl-[1,1'-biphenyl]-4-yl)acetyl)-6-methylpiperidine-3-carboxylic acid Step 1: Synthesis of compound BnH12085

[0382] A solution of compound 3-1 (191 mg, 0.476 mmol), 1-bromo-4-cyclohexylbenzene (0.088 mL, 0.476 mmol) and Na2CO3 (101 mg, 0.952 mmol) in MeCN / H2O (2:1, 6.14 mL) was vigorously stirred, bubbled with N2 gas for 5 minutes, and Pd(dppf)Cl2 (34.8 mg, 0.048 mmol) was added. The mixture was bubbled with N2 gas for 5 minutes and refluxed at 90°C for 2.5 hours. Then, the mixture was cooled to room temperature, and 1 N NaOH (1.20 mL, 1.20 mmol) was added to the mixture and stirred at room temperature for 2 hours. The mixture was diluted with H2O (6.00 mL) and washed with EtOAc (4.00 mL×3). 1 N NaOH was added to the aqueous layer to adjust the pH value to pH 2 to 3, and the mixture was extracted with EtOAc (4.00 mL×3). The combined organic layers were dried over MgSO4, filtered, and concentrated under reduced pressure. The residue was purified by SiO2 column chromatography (10% MeOH in DCM). Et2O (3.00 mL) was added to the residue and stirred at room temperature for 30 minutes. The precipitate was filtered and washed with Et2O (4.00 mL) to give BnH12085 (127 mg, 64%) as an off-white solid.

[0383] 1 H NMR (400MHz, DMSO-d6) δ12.44 (s, 1H), 7.57 (t, J=7.0Hz, 4H), 7.28 (dd, J=16 .4, 7.9Hz, 4H), 4.75(s, 0.5H), 4.58-4.50(m, 0.5H), 4.28(s, 0.5H), 3.92(d, J=13.6Hz, 0.5H), 3.86-3.67(m, 2H), 3.04(t, J=12.8Hz, 0.5H), 2.63((t, J=1 2.8Hz, 0.5H), 2.27-2.12(m, 1H), 1.91-1.15(m, 15H), 1.07(t, J=6.4Hz, 3H).

[0384] (22) Synthesis of compound BnH12086

[0385] (3R,6S)-1-(2-(4'-amino-[1,1'-biphenyl]-4-yl)acetyl)-6-methylpiperidine-3-carboxylic acid

[0386] Step 3: Synthesis of compound BnH12086

[0387] A solution of compound 3-1 (225 mg, 0.561 mmol), 4-bromoaniline (96.5 mg, 0.561 mmol) and Na2CO3 (119 mg, 1.12 mmol) in MeCN / H2O (2:1, 7.01 mL) was vigorously stirred, bubbled with N2 gas for 5 minutes, and Pd(dppf)Cl2 (41.0 mg, 0.06 mmol) was added. The mixture was bubbled with N2 gas for 5 minutes and refluxed at 90°C for 2 hours. Then, the mixture was cooled to room temperature, and 1N NaOH (1.12 mL, 1.12 mmol) was added to the mixture and stirred at room temperature for 4 hours. The mixture was diluted with H2O (5.00 mL) and washed with EtOAc (5.00 mL×3). 1N NaOH was added to the aqueous layer to adjust the pH value to pH 1 to 2, and the mixture was washed with EtOAc (5.00 mL×2). 1N NaOH was added to the aqueous layer to adjust the pH value to pH 5 to 6, and the mixture was extracted with EtOAc (5.00 mL×3). The combined organic layer was dried over MgSO4, filtered, and concentrated under reduced pressure. The residue was purified by SiO2 column chromatography (0 to 10% MeOH in DCM). Et2O (2.00 mL) was added to the residue and stirred at room temperature for 30 minutes. The precipitate was filtered and washed with Et2O (2.00 mL) to obtain beige solid compound BnH12086 (70.0 mg, 35%).

[0388] 1H NMR (400MHz, DMSO-d6) δ12.44 (s, 1H), 7.49-7.46 (m, 2H), 7.36-7.34 (d, J=8.2Hz, 2H), 7.24-7.17 (dd, J=18.4, 7.8Hz, 2H) , 6.64-6.62 (d, J=8.2Hz, 2H), 5.20 (s, 2H), 4.75 (s, 0.5H), 4.56-4.52 (m, 0.5H), 4.26 (s, 0.5H), 3.92-3.89 (d, J=13.7Hz, 0 .5H), 3.77-3.66 (m, 2H), 3.04-2.98 (t, J=12.8Hz, 0.5H), 2.64-2.57 (t, J=12.9Hz, 0.5H), 2.16-2.12 (d, J=13.6Hz, 1H), 1. 80-1.77 (d, J=12.9Hz, 1H), 1.66-1.63 (d, J=13.0Hz, 1H), 1.53-1.50 (d, J=10.9Hz, 2H), 1.07-1.05 (dd, J=6.9, 2.3Hz, 3H).

[0389] (23) Synthesis of compound BnH12087

[0390] (3R,6S)-6-Methyl-1-(2-(4-(6-phenylpyridin-3-yl)phenyl)acetyl)piperidine-3-carboxylic acid

[0391] Step 3: Synthesis of compound BnH12087

[0392] A solution of compound 3-1 (194 mg, 0.483 mmol), 5-bromo-2-phenylpyridine (113 mg, 0.483 mmol) and Na2CO3 (102 mg, 0.967 mmol) in MeCN / H2O (2:1, 6.04 mL) was vigorously stirred, bubbled with N2 gas for 5 minutes, and Pd(dppf)Cl2 (35.4 mg, 0.05 mmol) was added. The mixture was bubbled with N2 gas for 5 minutes and refluxed at 90°C for 2 hours. Then, the mixture was cooled to room temperature, and 1N NaOH (0.967 mL, 0.967 mmol) was added to the mixture and stirred at room temperature for 4 hours. The mixture was diluted with H2O (5.00 mL) and washed with EtOAc (5.00 mL×3). 1N NaOH was added to the aqueous layer to adjust the pH value to pH 1 to 2, and the mixture was extracted with EtOAc (4.00 mL×3). The combined organic layers were dried over MgSO4, filtered, and concentrated under reduced pressure. The residue was purified by SiO2 column chromatography (0 to 4% MeOH in DCM). Et2O (2.00 mL) was added to the residue and stirred at room temperature for 30 minutes. The precipitate was filtered and washed with Et2O (2.00 mL) to give BnH12087 (70.1 mg, 35%) as an off-white solid.

[0393] 1 H NMR (400MHz, DMSO-d6) δ8.99 (s, 1H), 8.18-8.13 (t, J=8.7Hz, 3H), 8.06-8.04 (d, J=8.4Hz, 1H), 7.76-7.73 (dd, J=8.0, 4.4Hz, 2H), 7.53- 7.49 (t, J=7.5Hz, 2H), 7.47-7.43 (t, J=7.2Hz, 1H), 7.39-7.37 (d, J=7.8Hz, 1H), 7.34-7.32 (d, J=7.9Hz, 1H), 4.74 (s, 0.5H), 4.55-4.50 (m, 0.5H), 4.28 (s, 0.5H), 3.92-3.89 (d, J=13.8Hz, 0.5H), 3.83-3.76 (m, 2H), 3.04-2.98 (t, J=12.9Hz, 0.5H), 2.63-2.56 (d, J=12.6Hz, 0.5H), 2.11-2.08 (d, J=10.2Hz, 1H), 1.80-1.76 (d, J=12.8Hz, 1H), 1.64-1.61 (m, 1H), 1.51 (s, 2H), 1.10-1.05 (dd, J=14.4, 6.8Hz, 3H).

[0394] (24) Synthesis of compound BnH12088

[0395] (3R,6S)-1-(2-(3'-amino-[1,1'-biphenyl]-4-yl)acetyl)-6-methylpiperidine-3-carboxylic acid

[0396] Step 1: Synthesis of compound BnH12088

[0397] A solution of compound 3-1 (210 mg, 0.523 mmol), 3-bromoaniline (0.057 mL, 0.523 mmol) and Na2CO3 (111 mg, 1.05 mmol) in MeCN / H2O (2:1, 6.75 mL) was vigorously stirred, bubbled with N2 gas for 5 minutes, and Pd(dppf)Cl2 (38.3 mg, 0.052 mmol) was added. The mixture was bubbled with N2 gas for 5 minutes and refluxed at 90°C for 2.5 hours. Then, the mixture was cooled to room temperature, and 1N NaOH (1.05 mL, 1.05 mmol) was added to the mixture and stirred at room temperature for 3 hours. The mixture was diluted with H2O (6.00 mL) and washed with EtOAc (4.00 mL×3). 1N NaOH was added to the aqueous layer to adjust the pH value to pH 1 to 2, and the mixture was washed with EtOAc (4.00 mL×2). 1N NaOH was added to the aqueous layer to adjust the pH value to pH 5 to 6, and the mixture was extracted with EtOAc (4.00 mL×3). The combined organic layer was dried over MgSO4, filtered, and concentrated under reduced pressure. Et2O / n-hexane (2:1, 2.00 mL) was added to the residue and stirred at room temperature for 30 minutes. The precipitate was filtered and washed with Et2O / n-hexane (2:1, 3.00 mL) to obtain a beige solid compound BnH12088 (115 mg, 62%).

[0398] 1H NMR (400MHz, DMSO-d6) δ12.43 (s, 1H), 7.49 (d, J=7.7Hz, 2H), 7.26 (dd, J=18.0, 7.8Hz, 2H), 7.08 (t, J=7.8Hz, 1H), 6.83 (d, J=2.1Hz, 1H), 6.76 (d, J=7.7Hz, 1H), 6.54 (dd, J=7.9, 2.2Hz, 1H), 5.13 (s, 2H), 4.75 (s, 0.5H), 4.55 (d, J=1 3.6Hz, 0.5H), 4.27 (s, 0.5H), 3.90 (s, 0.5H), 3.84-3.61 (m, 2H), 3.03 (t, J=12.8Hz, 0.5H), 2.66 (t, J=12.8Hz, 0.5 H), 2.18 (s, 1H), 1.79 (d, J = 12.7Hz, 1H), 1.66 (d, J = 12.6Hz, 1H), 1.52 (d, J = 8.8Hz, 2H), 1.08 (q, J = 6.5, 6.1Hz, 3H).

[0399] (25) Synthesis of compound BnH12089

[0400] (3R,6S)-6-Methyl-1-(2-(4'-(pyridin-3-yl)-[1,1'-biphenyl]-4-yl)acetyl)piperidine-3-carboxylic acid

[0401] Step 1: Synthesis of compound BnH12089

[0402] A solution of compound 3-1 (201 mg, 0.501 mmol), 3-(4-bromophenyl)pyridine (117 mg, 0.501 mmol) and Na2CO3 (106 mg, 1.00 mmol) in MeCN / H2O (2:1, 6.46 mL) was vigorously stirred, bubbled with N2 gas for 5 minutes, and Pd(dppf)Cl2 (36.7 mg, 0.050 mmol) was added. The mixture was bubbled with N2 gas for 5 minutes and refluxed at 90°C for 2 hours. Then, the mixture was cooled to room temperature, and 1N NaOH (1.00 mL, 1.00 mmol) was added to the mixture and stirred at room temperature for 3 hours. The mixture was diluted with H2O (6.00 mL) and washed with EtOAc (4.00 mL×3). 1N NaOH was added to the aqueous layer to adjust the pH value to pH 1 to 2, and the mixture was washed with EtOAc (4.00 mL×2). 1N NaOH was added to the aqueous layer to adjust the pH value to pH 4 to 5, and the mixture was extracted with EtOAc (4.00 mL × 3). The combined organic layer was dried over MgSO4, filtered, and concentrated under reduced pressure. Et2O (3.00 mL) was added to the residue and stirred at room temperature for 30 minutes. The precipitate was filtered and washed with Et2O (4.00 mL) to obtain a white solid compound BnH12089 (127 mg, 61%).

[0403] 1 H NMR (400MHz, DMSO-d6) δ12.43 (s, 1H), 8.96 (d, J=2.4Hz, 1H), 8.59 (dd, J=4.8, 1.6Hz, 1H), 8.14 (dt, J=8.0, 2.0Hz, 1H), 7.84 ( t, J=6.4Hz, 4H), 7.70 (d, J=7.8Hz, 2H), 7.51 (dd, J=7.9, 4.7Hz, 1H), 7.34 (dd, J=18.2, 7.8Hz, 2H), 4.76 (s, 0.5H), 4.56 (d, J= 13.8Hz, 0.5H), 4.30 (s, 0.5H), 4.00-3.90 (d, J=13.8Hz, 0.5H), 3.87-3.71 (m, 2H), 3.05 (t, J=12.9Hz, 0.5H), 2.68-2.58 (t, J =12.9Hz, 0.5H), 2.20 (d, J = 3.9Hz, 1H), 1.81 (d, J = 12.7Hz, 1H), 1.75-1.60 (m, 1H), 1.54 (s, 2H), 1.09 (dd, J = 10.5, 6.8Hz, 3H).

[0404] (26) Synthesis of compound BnH12090

[0405] (3R,6S)-1-(2-(4'-(diethylamino)-[1,1'-biphenyl]-4-yl)acetyl)-6-methylpiperidine-3-carboxylic acid

[0406] Step 1: Synthesis of compound BnH12090

[0407] A solution of compound 3-1 (252 mg, 0.628 mmol), 4-bromo-N,N-diethylaniline (143 mg, 0.628 mmol) and Na2CO3 (106 mg, 1.00 mmol) in MeCN / H2O (2:1, 7.85 mL) was vigorously stirred, bubbled with N2 gas for 5 minutes, and Pd(dppf)Cl2 (46.0 mg, 0.06 mmol) was added. The mixture was bubbled with N2 gas for 5 minutes and refluxed at 90°C for 2 hours. Then, the mixture was cooled to room temperature, and 1N NaOH (1.00 mL, 1.00 mmol) was added to the mixture and stirred at room temperature for 4 hours. The mixture was diluted with H2O (6.00 mL) and washed with EtOAc (4.00 mL×3). 1N NaOH was added to the aqueous layer to adjust the pH value to pH 4 to 5, and the mixture was extracted with EtOAc (4.00 mL×3). The combined organic layers were dried over MgSO4, filtered, and concentrated under reduced pressure. The residue was purified by SiO2 column chromatography (5 to 10% MeOH in DCM). Et2O (2.00 mL) was added to the residue and stirred at room temperature for 30 minutes. The precipitate was filtered and washed with Et2O (3.00 mL) to give the off-white compound BnH12090 (55.0 mg, 21%).

[0408] 1H NMR (400MHz, DMSO-d6) δ12.47 (s, 1H), 7.52-7.47 (dd, J=13.4, 7.9Hz, 4H), 7.26-7.19 (dd, J=18.3, 7.8Hz, 2H), 6.74-6.72 (d, J=8.6Hz, 2H), 4.75 (s, 0.5H), 4.57-4.53 (d, J=13.9Hz, 0.5H), 4.28 (s, 0.5H), 3.94-3.90 (d, J=14.1Hz, 0.5H), 3.78-3.67 (m, 2H), 3.48-3.34(m, 4H), 3.05-2.99(t, J=12.8Hz, 0.5H), 2.64-2.58(t, J=12.8Hz, 0.5H), 2.20-2.14(m, 1H), 1.81-1.77(m, 1H ), 1.70-1.64 (d, J=12.6Hz, 1H), 1.53-1.51 (d, J=9.3Hz, 2H), 1.13-1.10 (t, J=6.9Hz, 6H), 1.08-1.05 (dd, J=7.1, 2.9Hz, 3H).

[0409] Preparation Example 3. Preparation of active compounds according to representative reaction formula 4

[0410] [Reaction 4]

[0411]

[0412]

[0413] (1) Synthesis of compound BnH12015

[0414] (R)-N-Hydroxy-1-(2-(4-(pyrimidin-5-yl)phenyl)acetyl)pyrrolidine-2-carboxamide

[0415] Step 1: Synthesis of 2-(4-(pyrimidin-5-yl)phenyl)acetic acid

[0416] A suspension of 4-bromophenylacetic acid (1.00 g, 4.65 mmol), pyrimidine-5-boronic acid pinacol ester (910 mg, 4.42 mmol) and Na2CO3 (986 mg, 9.30 mmol) in MeCN / H2O (2:1, 60.0 mL) was vigorously stirred and bubbled with N2 gas for 5 minutes, followed by the addition of Pd(dppf)Cl2 (340 mg, 0.465 mmol). The mixture was bubbled with N2 gas for 5 minutes and refluxed at 90°C for 2 hours. After the reaction was completed, the reaction mixture was filtered through a celite pad and washed with EtOAc (10.0 mL×2). The filtrate was diluted with H2O (40.0 mL) and washed with EtOAc (40.0 mL×2). The aqueous layer was acidified to pH 1 to 2 with 1N HCl and stirred for 30 minutes. The precipitate was filtered and washed with H2O (40.0 mL). The filter cake was dried under reduced pressure to give the desired compound (542 mg, 54%) as a white solid.

[0417] Step 2: Synthesis of (2-(4-(pyrimidin-5-yl)phenyl)acetyl)-D-proline methyl ester

[0418] To a solution of 2-(4-(pyrimidin-5-yl)phenyl)acetic acid (110 mg, 0.513 mmol) in DMF (1.71 mL) were added D-proline methyl ester (10.2 mg, 0.616 mmol), DIPEA (0.135 mL, 0.770 mmol), HOBt (83.3 mg, 0.616 mmol) and EDC·HCl (95.7 mg, 0.616 mmol). The mixture was stirred at room temperature for 3 hours and 3 minutes. The mixture was diluted with EtOAc (5.00 mL) and washed with saturated NH4Cl aqueous solution (5.00 mL) and brine (5.00 mL). The organic layer was dried over MgSO4, filtered, and concentrated under reduced pressure. The residue was purified by SiO2 column chromatography (n-hexane: EtOAc = 2:1) to give the desired compound (145 mg, 79%) as a colorless oil.

[0419] Step 3: Synthesis of compound BnH12015

[0420] To a solution of (2-(4-(pyrimidin-5-yl)phenyl)acetyl)-D-proline methyl ester (83.0 mg, 0.255 mmol) in THF / MeOH (1:1, 3.00 mL) were added hydroxylamine hydrochloride (169 mg, 2.55 mmol) and KOH (28.6 mg, 0.510 mmol). The mixture was stirred at room temperature for 2 hours. The mixture was diluted with H2O (2.00 mL) and washed twice with DCM (3.00 mL×2). The aqueous layer was acidified to pH 1 to 2 with 1N HCl at 0°C and extracted with EtOAc (3.00 mL). The organic layer was washed with brine (3.00 mL), dried over MgSO4, filtered, and concentrated under reduced pressure. The residue was purified by SiO2 column chromatography (DCM:MeOH=9:1) to give a white solid compound BnH12015 (48.0 mg, 57%).

[0421] 1 H NMR (400MHz, Chloroform-d) δ9.90 (s, 1H), 9.21 (s, 1H), 8.94 (s, 2H), 7.60-7.53 (m, 2H), 7.40 (d, J=8.0Hz, 2H), 4.55 (d, J= 8.0Hz, 1H), 3.75 (s, 2H), 3.65-3.59 (m, 1H), 3.52 (q, J=8.7Hz, 1H), 2.49 (s, 1H), 2.25-2.12 (m, 1H), 2.00 (d, J=38.2Hz, 2H).

[0422] (2) Synthesis of compound BnH12017

[0423] Step 1: Synthesis of (2-(4-(pyrimidin-5-yl)phenyl)acetyl)-D-proline methyl ester

[0424] To a solution of 2-(4-(pyrimidin-5-yl)phenyl)acetic acid (110 mg, 0.513 mmol) in DMF (1.71 mL) were added L-proline methyl ester (10.2 mg, 0.616 mmol), DIPEA (0.135 mL, 0.770 mmol), HOBt (83.3 mg, 0.616 mmol) and EDC·HCl (95.7 mg, 0.616 mmol). The mixture was stirred at room temperature for 3 hours and 3 minutes. The mixture was diluted with EtOAc (5.00 mL) and washed with saturated aqueous NH4Cl solution (5.00 mL) and brine (5.00 mL). The organic layer was dried over MgSO4, filtered, and concentrated under reduced pressure. The residue was purified by SiO2 column chromatography (n-hexane: EtOAc = 2:1) to give the desired compound (83 mg, 49%) as a colorless oil.

[0425] Step 2: Synthesis of compound BnH12017

[0426] To a solution of (2-(4-(pyrimidin-5-yl)phenyl)acetyl)-D-proline methyl ester (80.0 mg, 0.246 mmol) in THF / MeOH (1:1, 3.00 mL) were added hydroxylamine hydrochloride (162 mg, 2.46 mmol) and KOH (27.6 mg, 0.492 mmol). The mixture was stirred at room temperature for 2 hours. The mixture was diluted with H2O (2.00 mL) and washed twice with DCM (3.00 mL×2). The aqueous layer was acidified to pH 1 to 2 with 1N HCl at 0°C and extracted with EtOAc (3.00 mL). The organic layer was washed with brine (3.00 mL), dried over MgSO4, filtered, and concentrated under reduced pressure. The residue was purified by SiO2 column chromatography (DCM:MeOH=9:1) to give white solid compound BnH12017 (52.0 mg, 64%).

[0427] 1 H NMR (400MHz, Chloroform-d) δ9.87 (s, 1H), 7.35-7.27 (m, 2H), 7.15 (dd, J=8.4, 2.6Hz, 2H), 6.99 (td, J=8.3, 2.7Hz, 2H), 4.5 4 (d, J=8.1Hz, 1H), 3.73 (d, J=2.6Hz, 2H), 3.66-3.49 (m, 1H), 2.46 (s, 1H), 2.17 (dd, J=17.6, 8.5Hz, 1H), 2.09-1.89 (m, 2H).

[0428] Preparation Example 4. Preparation of active compounds according to representative reaction formula 5

[0429] [Reaction 5]

[0430]

[0431]

[0432] (1) Synthesis of compound BnH12058

[0433] (3R,6S)-6-Methyl-1-(2-(4-(pyrimidin-2-yl)phenyl)acetyl)piperidine-3-carboxamide

[0434] Step 1: Synthesis of compound BnH12058

[0435] CDI (71.7 mg, 0.442 mmol) was added to a suspension of MeCN (3.17 mL) of compound BnH12048 (100 mg, 0.295 mmol), and stirred at room temperature for 20 minutes. NH4OH (0.172 mL, 4.42 mmol) was added to the mixture, and the mixture was stirred at room temperature for 17 hours. The mixture was diluted with EtOAc (4.00 mL), and washed with saturated NH4Cl (4.00 mL), 10% citric acid (4.00 mL) and brine (4.00 mL). The organic layer was dried, filtered and concentrated with MgSO4. The residue was purified by column chromatography (5% MeOH in DCM) to obtain compound BnH12058 (48 mg, 48%) as a white solid.

[0436] 1 H NMR (400MHz, DMSO-d6) δ8.97 (d, J=0.8Hz, 2H), 8.31-8.24 (m, 2H), 7.43-7.29 (m, 3H), 6.86 (d, J= 9.7Hz, 1H), 4.74 (d, J=6.7Hz, 0.5H), 4.38 (dd, J=13.3, 4.2Hz, 0.5H), 4.30-4.24 (m, 0.5H), 3.87- 3.75 (m, 2.5H), 3.02 (dd, J=13.7, 11.9Hz, 0.5H), 2.61 (q, J=14.0, 13.0Hz, 0.5H), 2.08 (ddd, J=1 6.4, 10.5, 3.1Hz, 1H), 1.68 (td, J=13.0, 11.4, 4.6Hz, 2H), 1.56-1.39 (m, 2H), 1.12-1.02 (m, 3H).

[0437] (2) Synthesis of compound BnH12059

[0438] (3R,6S)-1-(2-(4-(5-fluoropyrimidin-2-yl)phenyl)acetyl)-6-methylpiperidine-3-carboxamide

[0439] Step 1: Synthesis of compound BnH12059

[0440] CDI (68.1 mg, 0.420 mmol) was added to a suspension of MeCN (3.01 mL) of compound BnH12049 (100 mg, 0.280 mmol), and stirred at room temperature for 20 minutes. NH4OH (0.163 mL, 4.20 mmol) was added to the mixture, and the mixture was stirred at room temperature for 17 hours. The mixture was diluted with EtOAc (4.00 mL), and washed with saturated NH4Cl (4.00 mL), 10% citric acid (4.00 mL) and brine (4.00 mL). The organic layer was dried, filtered and concentrated with MgSO4. The residue was purified by column chromatography (5% MeOH in DCM) to obtain compound BnH12059 (52 mg, 52%) as a white solid.

[0441] 1 H NMR (400MHz, DMSO-d6) δ8.89 (d, J=4.9Hz, 2H), 8.34 (dd, J=8.4, 2.3Hz, 2H), 7.47-7.29 (m , 4H), 6.86 (d, J=9.5Hz, 1H), 4.75 (s, 0.5H), 4.38 (dd, J=13.0, 4.2Hz, 0.5H), 4.25 (d, J=6. 6Hz, 0.5H), 3.95-3.72 (m, 2.5H), 3.02 (t, J=12.8Hz, 0.5H), 2.63 (t, J=12.7Hz, 0.5H), 2. 09 (dd, J=13.6, 9.5Hz, 1H), 1.66 (d, J=14.3Hz, 2H), 1.58-1.36 (m, 2H), 1.13-1.02 (m, 3H).

[0442] Preparation Example 5. Preparation of active compounds according to representative reaction formula 6

[0443] [Reaction formula 6]

[0444]

[0445]

[0446] (1) Synthesis of compound BnH12064

[0447] (S)-1-(2-Methylpiperidin-1-yl)-2-(4-(pyridin-3-yl)phenyl)ethan-1-one

[0448] Step 1: Synthesis of 2-(4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl)acetic acid

[0449] A suspension of compound 2-(4-bromophenyl)acetic acid (700 mg, 3.26 mmol), bis(pinacolato)diboron (911 mg, 3.59 mmol) and KOAc (958.4 mg, 9.77 mmol) in 1,4-dioxane (11.2 mL) was vigorously stirred and bubbled with N2 gas for 5 minutes, and then Pd(dppf)Cl2 (238 mg, 0.326 mmol) was added. The mixture was bubbled with N2 gas for 5 minutes and refluxed at 100°C for 17 hours. After the reaction was completed, the reaction mixture was filtered through a celite pad and washed with DCM (5.00 mL×3). The combined organic layer was washed with H2O (20.0 mL), dried over MgSO4, filtered, and concentrated under reduced pressure. The residue was purified by SiO2 column chromatography (n-hexane: EtOAc = 3:1 to 2:1) to give yellow solid compound 6-1-BnH12064-1 (552 mg, 65%).

[0450] Step 2: Synthesis of 2-(4-(pyridin-3-yl)phenyl)acetic acid (6-1-BnH12064)

[0451] A solution of compound 6-1-BnH12064-1 (450 mg, 1.72 mmol), 3-bromopyridine (0.182 mL, 1.89 mmol) and Na2CO3 (546 mg, 5.15 mmol) in MeCN / H2O (2:1, 21.4 mL) was vigorously stirred, bubbled with N2 gas for 5 minutes, and Pd(dppf)Cl2 (126 mg, 0.172 mmol) was added. The mixture was bubbled with N2 gas for 5 minutes and refluxed at 90°C for 3 hours. Then, the mixture was cooled to room temperature. The mixture was diluted with H2O (10.0 mL) and washed with DCM (10.0 mL×3). 1N NaOH was added to the aqueous layer to adjust the pH value to pH 1 to 2, and extracted with EtOAc (15.0 mL×3). The combined organic layer was dried over MgSO4, filtered, concentrated under reduced pressure, and used without further purification.

[0452] Step 3: Synthesis of compound BnH12064

[0453] To a solution of 2-(4-(pyridin-3-yl)phenyl)acetic acid (6-1-BnH12064, 90 mg, 0.422 mmol) in DMF (1.41 mL) were added (S)-2-methylpiperidine (44.0 mg, 0.443 mmol), DIPEA (0.110 mL, 0.633 mmol), HOBt (68.4 mg, 0.506 mmol) and EDC·HCl (78.6 mg, 0.506 mmol). The mixture was stirred at room temperature for 3 hours. The mixture was diluted with EtOAc (2.00 mL) and washed with saturated NH4Cl aqueous solution (2.00 mL) and brine (2.00 mL). The organic layer was dried over MgSO4, filtered and concentrated under reduced pressure. The residue was purified by SiO 2 column chromatography (n-hexane:EtOAc=1:1 to 0:1) to give compound BnH12064 (46.6 mg, 38%) as a yellow oil.

[0454] 1 H NMR (400MHz, Chloroform-d) δ8.88 (d, J=2.3Hz, 1H), 8.62 (dd, J=5.0, 1.6Hz, 1H), 8.00 (dt, J=8 .0, 2.0Hz, 1H), 7.57 (d, J=7.9Hz, 2H), 7.47 (dd, J=8.0, 4.9Hz, 1H), 7.39 (d, J=8.9Hz, 2H), 4.99 ( s, 0.5H), 4.58 (d, J=13.7Hz, 0.5H), 4.22 (s, 0.5H), 3.80 (s, 2H), 3.68 (d, J=13.8Hz, 0.5H), 3.1 1(t, J=13.5Hz, 0.5H), 2.72 (t, J=13.6Hz, 0.5H), 1.58 (d, J=31.7Hz, 6H), 1.18 (d, J=6.9Hz, 3H).

[0455] Preparation Example 6. Preparation of active compound according to representative reaction formula 7 (anhydrous form)

[0456] [Reaction 7]

[0457]

[0458]

[0459] (1) Synthesis of compound BnH12066

[0460] (3S,6R)-6-Methyl-1-(2-(4-(pyridin-3-yl)phenyl)acetyl)piperidine-3-carboxylic acid

[0461] Step 1: Synthesis of methyl (3S,6R)-6-methyl-1-(2-(4-(pyridin-3-yl)phenyl)acetyl)piperidine-3-carboxylate

[0462] To a solution of 2-(4-(pyridin-3-yl)phenyl)acetic acid (6-1-BnH12064, 90 mg, 0.422 mmol) in DMF (1.41 mL) were added (3S,6R)-6-methylpiperidine-3-carboxylic acid methyl ester (anhydrous form) (69.7 mg, 0.443 mmol), DIPEA (0.110 mL, 0.633 mmol), HOBt (68.4 mg, 0.506 mmol) and EDC·HCl (78.6 mg, 0.506 mmol). The mixture was stirred at room temperature for 3 hours. The mixture was diluted with EtOAc (2.00 mL) and washed with saturated NH4Cl aqueous solution (2.00 mL) and brine (2.00 mL). The organic layer was dried over MgSO4, filtered and concentrated under reduced pressure. The residue was purified by SiO2 column chromatography (5% MeOH in DCM) to give the desired compound (37.0 mg, 25%) as a yellow oil.

[0463] Step 2: Synthesis of compound BnH12066

[0464] 1N NaOH (0.162 mL, 0.162 mmol) was added to a solution of (3S, 6R)-6-methyl-1-(2-(4-(pyridin-3-yl)phenyl)acetyl)piperidine-3-carboxylic acid methyl ester (37.0 mg, 0.108 mmol) in THF (0.373 mL). The mixture was stirred for 2 hours at room temperature. The mixture was diluted with H2O (2.00 mL) and washed twice with DCM (2.00 mL×2). The aqueous layer was acidified to pH 1 to 2 with 1N HCl at 0°C and extracted with EtOAc (3.00 mL). The organic layer was washed with brine (3.00 mL), dried over MgSO4, filtered, and concentrated under reduced pressure to give a white solid compound BnH12066 (30.0 mg, 82%).

[0465] 1H NMR (400MHz, DMSO-d6) δ9.08 (d, J=2.2Hz, 1H), 8.72 (d, J=5.2Hz, 1H), 8.50 (d, J=7.9Hz, 1H), 7.80 (dd, J=1 9.9, 8.1Hz, 3H), 7.40 (dd, J=18.3, 7.9Hz, 2H), 4.75 (s, 0.5H), 4.58-4.51 (m, 0.5H), 4.30 (s, 0.5H), 3.93 (d , J=13.6Hz, 0.5H), 3.89-3.74 (m, 2H), 3.05 (t, J=12.8Hz, 0.5H), 2.61 (t, J=12.8Hz, 0.5H), 2.22 (d, J=13. 8Hz, 1H), 1.81 (d, J=12.7Hz, 1H), 1.67 (d, J=12.6Hz, 1H), 1.58-1.46 (m, 2H), 1.09 (dd, J=16.1, 6.9Hz, 3H).

[0466] (2) Synthesis of compound BnH12071

[0467] (3S,6R)-6-Methyl-1-(2-(4-(pyrimidin-5-yl)phenyl)acetyl)piperidine-3-carboxylic acid

[0468] Step 1: Synthesis of methyl (3S,6R)-6-methyl-1-(2-(pyridin-3-yl)acetyl)piperidine-3-carboxylate

[0469] To a solution of 2-(4-(pyrimidin-5-yl)phenyl)acetic acid (100 mg, 0.467 mmol) in DMF (2.00 mL) were added (3S,6R)-6-methylpiperidine-3-carboxylic acid methyl ester (anhydrous form) (77.1 mg, 0.490 mmol), DIPEA (0.122 mL, 0.700 mmol), HOBt (75.7 mg, 0.560 mmol) and EDC·HCl (107 mg, 0.560 mmol). The mixture was stirred at room temperature for 2 hours. The mixture was diluted with EtOAc (3.00 mL) and washed with saturated NH4Cl aqueous solution (3.00 mL) and brine (3.00 mL). The organic layer was dried over MgSO4, filtered and concentrated under reduced pressure. The residue was purified by SiO2 column chromatography (EtOAc alone) to give the desired compound (93.5 mg, 57%) as a light yellow oil.

[0470] Step 2: Synthesis of compound BnH12071

[0471] To a solution of (3S,6R)-6-methyl-1-(2-(4-(pyrimidin-5-yl)phenyl)acetyl)piperidine-3-carboxylic acid methyl ester (92.0 mg, 0.260 mmol) in THF (1.00 mg, 0.260 mmol) was added 1N NaOH (0.390 mL, 0.390 mmol). The mixture was stirred at room temperature for 2 hours. The mixture was diluted with H2O (2.00 mL) and washed twice with DCM (2.00 mL×2). The aqueous layer was acidified to pH 1 to 2 with 1N HCl at 0°C and extracted with EtOAc (3.00 mL). The organic layer was washed with brine (3.00 mL), dried over MgSO4, filtered, and concentrated under reduced pressure. The residue was purified by SiO2 column chromatography (10% MeOH in DCM) to give compound BnH12071 (35.0 mg, 44%) as a white solid.

[0472] 1 H NMR (400MHz, DMSO-d6) δ9.16 (d, J=12.7Hz, 2H), 7.77 (d, J=7.9Hz, 2H), 7.38 (dd, J=19.1, 7.8Hz, 2 H), 4.75 (s, 0.5H), 4.58-4.51 (d, J = 13.8Hz, 0.5H), 4.29 (s, 0.5H), 3.92 (d, J = 13.8Hz, 0.5H), 3.8 0 (tt, J=15.5, 7.8Hz, 2H), 3.05 (t, J=12.8Hz, 1H), 2.60 (t, J=12.9Hz, 1H), 2.24-2.11 (m, 1H), 1.8 6-1.77 (m, 1H), 1.66 (d, J=13.3Hz, 1H), 1.53 (q, J=5.7, 4.6Hz, 2H), 1.08 (dd, J=16.6, 6.9Hz, 3H).

[0473] Preparation Example 7. Preparation of active compounds according to representative reaction formula 8

[0474] [Reaction formula 8]

[0475]

[0476]

[0477] (1) Synthesis of compound BnH12091

[0478] (3R,6S)-6-Methyl-1-(2-(3-(pyridin-4-yl)phenyl)acetyl)piperidine-3-carboxylic acid

[0479] Step 1: (3R,6S)-1-(2-(3-bromophenyl)acetyl)-6-methylpiperidine-3-carboxylic acid methyl ester

[0480] To a solution of 3-bromophenylacetic acid (800 mg, 3.72 mmol) in DMF (12.4 mL) were added (3R, 6S)-rel-6-methyl-3-piperidinecarboxylic acid methyl ester (614 mg, 3.91 mmol), DIPEA (0.972 mL, 5.58 mmol), HOBt (603 mg, 4.46 mmol) and EDC·HCl (692 mg, 4.46 mmol). The mixture was stirred at room temperature for 4 hours. The mixture was diluted with EtOAc (15.0 mL) and washed with saturated NH4Cl aqueous solution (15.0 mL) and brine (15.0 mL). The organic layer was dried over MgSO4, filtered and concentrated under reduced pressure. The residue was purified by SiO2 column chromatography (n-hexane: EtOAc = 2:1 to 1:1) to obtain the desired compound (990 mg, 75%) as a colorless oil.

[0481] Step 2: Synthesis of methyl (3R,6S)-6-methyl-1-(2-(3-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl)acetyl)piperidine-3-carboxylate (8-2)

[0482] A suspension of (3R,6S)-1-(2-(3-bromophenyl)acetyl)-6-methylpiperidine-3-carboxylic acid methyl ester (990 mg, 2.80 mmol), bis(pinacolato)diboron (501 mg, 1.97 mmol) and KOAc (823 mg, 3.07 mmol) in 1,4-dioxane (9.70 mL) was vigorously stirred and bubbled with N2 gas for 5 minutes, and then Pd(dppf)Cl2 (205 mg, 0.279 mmol) was added. The mixture was bubbled with N2 gas for 5 minutes and refluxed at 100°C for 14 hours. After the reaction was completed, the reaction mixture was filtered through a celite pad and washed with DCM (10.0 mL×3). The combined organic layer was washed with H2O (30.0 mL), dried over MgSO4, filtered, and concentrated under reduced pressure. The residue was purified by SiO 2 column chromatography (n-hexane:EtOAc=2:1 to 1:1) to give the desired compound (840 mg, 75%) as a yellow oil.

[0483] Step 3: Synthesis of compound BnH12091

[0484] A solution of (3R,6S)-6-methyl-1-(2-(3-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl)acetyl)piperidine-3-carboxylate (8-2, 215 mg, 0.536 mmol), 4-bromopyridine hydrochloride (104 mg, 0.536 mmol) and Na2CO3 (170 mg, 1.61 mmol) in MeCN / H2O (2:1, 6.70 mL) was vigorously stirred and bubbled with N2 gas for 5 minutes. Pd(dppf)Cl2 (31.0 mg, 0.042 mmol) was added to the mixture. The mixture was bubbled with N2 gas for 5 minutes and refluxed at 90°C for 2 hours. The reaction mixture was cooled to room temperature and 1N NaOH (2.14 mL, 2.14 mmol) was added. The mixture was stirred at room temperature for 2 hours. The mixture was diluted with H2O (7.00mL) and washed with EtOAc (7.00mL×3). 1N NaOH was added to the aqueous layer to adjust the pH value to pH 4 to 5, and extracted with EtOAc (7.00mL×3). The combined organic layers were dried with MgSO4, filtered, and concentrated under reduced pressure. Et2O (5.00mL) was added to the residue and stirred at room temperature for 30 minutes. The precipitate was filtered and washed with Et2O (3.0mL) to obtain an off-white solid compound BnH12091 (112mg, 62%).

[0485] 1 H NMR (400MHz, DMSO-d6) δ12.43 (s, 1H), 8.64-8.63 (d, J=5.1Hz, 2H), 7.69-7.63 (d, J=7.3Hz, 4H), 7.48-7.4 4 (t, J=7.7Hz, 1H), 7.35-7.29 (dd, J=15.8, 7.6Hz, 1H), 4.74 (s, 0.5H), 4.56-4.52 (m, 0.5H), 4.32 (s, 0.5H) , 3.98-3.94 (d, J=14.0Hz, 0.5H), 3.89-3.77 (m, 2H), 3.07-3.01 (t, J=12.9Hz, 0.5H), 2.62-2.58 (d, J=12. 9Hz, 0.5H), 2.18-2.14 (d, J=14.5Hz, 1H), 1.77 (s, 1H), 1.70-1.64 (m, 1H), 1.52 (s, 2H), 1.09-1.04 (m, 3H).

[0486] (2) Synthesis of compound BnH12092

[0487] (3R,6S)-1-(2-(3-(6-methoxypyridin-3-yl)phenyl)acetyl)-6-methylpiperidine-3-carboxylic acid

[0488] Step 1: Synthesis of compound BnH12092

[0489] A solution of (3R,6S)-6-methyl-1-(2-(3-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl)acetyl)piperidine-3-scarboxylic acid methyl ester (8-2, 225 mg, 0.561 mmol), 5-bromo-2-methoxypyridine (105 mg, 0.561 mmol) and Na2CO3 (119 mg, 1.12 mmol) in MeCN / H2O (2:1, 7.50 mL) was vigorously stirred and bubbled with N2 gas for 5 minutes. Pd(dppf)Cl2 (41.0 mg, 0.056 mmol) was added to the mixture. The mixture was bubbled with N2 gas for 5 minutes and refluxed at 90°C for 2 hours. The reaction mixture was cooled to room temperature and 1N NaOH (1.12 mL, 1.12 mmol) was added. The mixture was stirred at room temperature for 14 hours. The mixture was diluted with H2O (7.00 mL) and washed with EtOAc (7.00 mL×3). 1N NaOH was added to the aqueous layer to adjust the pH value to pH 4 to 5, and extracted with EtOAc (7.00 mL×3). The combined organic layer was dried over MgSO4, filtered, and concentrated under reduced pressure. The residue was purified by SiO2 column chromatography (DCM: MeOH = 20: 1 to 10:

[0490] 1) Purification. Et2O (4.00 mL) was added to the residue and stirred at room temperature for 30 minutes. The precipitate was filtered and washed with Et2O (2.0 mL) to obtain compound BnH12092 (106 mg, 52%) as an off-white solid.

[0491] 1H NMR (400MHz, DMSO-d6) δ12.43 (s, 1H), 8.45 (dd, J=7.3, 2.7Hz, 1H), 7.97 (dd, J=8.4, 2.5Hz, 1H), 7.56-7.46 (m, 2H), 7 .41 (t, J=7.6Hz, 1H), 7.22 (dd, J=16.2, 7.6Hz, 1H), 6.92 (d, J=8.6Hz, 1H), 4.75 (s, 0.5H), 4.59-4.50 (m, 0.5H), 4.32 ( s, 0.5H), 3.90 (s, 3.5H), 3.87-3.72 (m, 2H), 3.03 (t, J=12.9Hz, 0.5H), 2.62 (t, J=12.7Hz, 0.5H), 2.17 (q, J=10.2, 8. 7Hz, 1H), 1.79 (d, J=12.0Hz, 1H), 1.67 (dd, J=12.5, 6.2Hz, 1H), 1.51 (d, J=12.4Hz, 2H), 1.08 (dt, J=12.6, 4.7Hz, 3H).

[0492] (3) Synthesis of compound BnH12093

[0493] (3R,6S)-1-(2-(3-(5-fluoropyrimidin-2-yl)phenyl)acetyl)-6-methylpiperidine-3-carboxylic acid

[0494] Step 1: Synthesis of compound BnH12093

[0495] A solution of (3R,6S)-6-methyl-1-(2-(3-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl)acetyl)piperidine-3-carboxylate (8-2, 213 mg, 0.531 mmol), 2-bromo-5-fluoropyrimidine (93.9 mg, 0.531 mmol) and Na2CO3 (113 mg, 1.06 mmol) in MeCN / H2O (2:1, 6.84 mL) was vigorously stirred and bubbled with N2 gas for 5 minutes. Pd(dppf)Cl2 (38.8 mg, 0.053 mmol) was added to the mixture. The mixture was bubbled with N2 gas for 5 minutes and refluxed at 90°C for 2 hours. The reaction mixture was cooled to room temperature and 1N NaOH (1.12 mL, 1.12 mmol) was added. The mixture was stirred at room temperature for 17 hours. The mixture was diluted with H2O (7.00mL) and washed with EtOAc (7.00mL×3). 1N NaOH was added to the aqueous layer to adjust the pH value to pH 3 to 4, and extracted with EtOAc (7.00mL×3). The combined organic layers were dried over MgSO4, filtered, and concentrated under reduced pressure. The residue was purified by SiO2 column chromatography (3 to 5% MeOH in DCM). Et2O (5.00mL) was added to the residue and stirred at room temperature for 30 minutes. The precipitate was filtered and washed with Et2O (3.0mL) to give beige solid compound BnH12093 (122mg, 64%).

[0496] 1 H NMR (400MHz, DMSO-d6) δ12.39 (s, 1H), 8.98 (s, 2H), 8.22 (t, J=10.5Hz, 2H), 7.53-7.34 (m, 2H ), 4.76 (s, 0.5H), 4.55 (dd, J=13.2, 4.0Hz, 0.5H), 4.37-4.22 (m, 0.5H), 3.98-3.76 (m, 2.5H), 3.03 (t, J=12.8Hz, 0.5H), 2.62 (t, J=12.7Hz, 0.5H), 2.18 (q, J=10.8, 9.2Hz, 1H), 1.79 (d, J=1 3.0Hz, 1H), 1.65 (td, J=12.5, 7.6Hz, 1H), 1.51 (d, J=9.5Hz, 2H), 1.08 (dt, J=7.1, 4.4Hz, 3H).

[0497] Preparation Example 8. Preparation of active compounds according to methods other than the representative reaction formula

[0498] (1) Synthesis of BnH12002

[0499] (3R,6S)-1-(2-(4'-Fluoro-[1,1'-biphenyl]-4-yl)acetyl)-6-methylpiperidine-3-carboxylic acid

[0500]

[0501] Step 1: Compound 1 (293 mg, 1.27 mmol) was dissolved in 5 mL of DCM, and oxalyl chloride (163 μL, 1.91 mmol) was added dropwise at 0°C for 5 minutes, followed by the addition of a catalyst and DMF (1 drop). After stirring at room temperature for 6 hours, the mixture was concentrated under reduced pressure to obtain 316 mg of compound 2. The reaction was carried out to the next step without further purification.

[0502] Step 2: Compound 3 (200 mg, 1.27 mmol) was dissolved in 10 mL of DCM, and triethylamine (354 μL, 2.54 mmol) was added at 0°C. Compound 2 (316 mg, 1.27 mmol) was dissolved in 5 mL of DCM, added dropwise at 0°C, and stirred at room temperature for 2 hours. The reaction mixture was post-treated with DCM and water, and 213 mg of compound 4 (yield 45%) was obtained using a column.

[0503] Step 3: Compound 4 (100 mg, 473 μMol) was dissolved in 5 mL of THF / methanol (1:1), and 1N-NaOH (947 μL, 947 μMol) was added, and stirred at room temperature for 12 hours. After the reaction was completed, the pH was adjusted to 3 using 1N-HCl, and the mixture was extracted with ethyl acetate and concentrated under reduced pressure. 75 mg of the target compound 5 (yield: 27%) was obtained from the obtained reaction mixture using prep TLC.

[0504] The identity was confirmed by NMR spectroscopy: 1 H NMR (CDCl3, 400MHz): δ7.22 (1H, m), 7.08 (1H, m), 6.91 (1H, bs), 4.75 (1H, m), 3.86 (1H, m), 3. 71(2H,m), 3.01(1H,m), 2.28(1H,m), 1.91(1H,bs), 1.74(1H,m), 1.58(1H,bs), 1.13(3H,m).

[0505] (2) Synthesis of BnH12003

[0506] (3R,6S)-6-Methyl-1-(2-(4-(pyrimidin-5-yl)phenyl)acetyl)piperidine-3-carboxylic acid

[0507]

[0508] Step 1: Compound 1 (547 mg, 2.54 mmol) was dissolved in 10 mL of DCM, and oxalyl chloride (327 μL, 3.81 mmol) was added dropwise at 0° C. for 5 minutes, followed by the addition of a catalyst and DMF (1 drop). After stirring at room temperature for 6 hours, the mixture was concentrated under reduced pressure to obtain 593 mg of compound 2.

[0509] Step 2: Compound 3 (400 mg, 2.54 mmol) was dissolved in 10 mL of DCM, and triethylamine (708 μL, 5.08 mmol) was added at 0°C. Compound 2 (593 mg, 2.54 mmol) was dissolved in 5 mL of DCM, and added dropwise at 0°C, and stirred at room temperature for 2 hours. The reaction mixture was post-treated with DCM and water, and 347 mg of compound 4 (yield 38%) was obtained using a column.

[0510] Step 3: Compound 4 (300 mg, 846 μMol), compound 5 (104 mg, 846 μMol), Pd(PPh3)4 (49 mg, 43 μMol) and K2CO3 (234 mg, 1.69 mmol) were dissolved in 3 mL toluene / 1 mL ethanol / 1 mL H2O, degassed under nitrogen, and refluxed for 12 hours. After the reaction was completed, EA was used for extraction and the mixture was concentrated under reduced pressure to obtain 38 mg of compound 6 (yield: 13%) by prep TLC.

[0511] Step 4: Compound 6 (38 mg, 107 μMol) was dissolved in 3 mL of THF / methanol (1:1), and 1N-NaOH (430 μL, 430 μMol) was added and stirred at room temperature for 12 hours. After the reaction was completed, the pH was adjusted to 3 using 1N-HCl, extracted with ethyl acetate and concentrated under reduced pressure. 12 mg of the target compound 7 (yield: 45%) was obtained from the obtained reaction mixture using prep TLC.

[0512] The identity was confirmed by NMR spectroscopy: 1 H NMR (CDCl3, 400MHz): δ9.20 (1H, s), 8.97 (2H, m), 7.55 (2H, d, J = 8Hz), 7.42 (2H, d, J = 8Hz), 4.88 (1H, m), 4 .15(1H,m), 3.82(2H,s), 3.01(1H,m), 2.28(1H,m), 1.98(1H,m), 1.80(1H,m), 1.60(2H,m), 1.17(3H,m).

[0513] (3) Synthesis of BnH12057

[0514] (3R,6S)-6-Methyl-1-(2-(4-(oxazol-5-yl)phenyl)acetyl)piperidine-3-carboxylic acid

[0515]

[0516] Step 1: Methyl (3R,6S)-6-methyl-1-(2-(4-(oxazol-5-yl)phenyl)acetyl)piperidine-3-carboxylate (g)

[0517] A solution of compound 1-2-BnH12032 (500 mg, 1.41 mmol), oxazole (97.5 mg, 1.41 mmol) and Bu4NOAc (553 mg, 1.84 mmol) in DMA (4.71 mL) was vigorously stirred, bubbled with N2 gas for 5 minutes, and Pd(Oac)2 (95.1 mg, 0.423 mmol) was added. The mixture was bubbled with N2 gas for 5 minutes and refluxed at 70°C for 17 hours. Then, the mixture was cooled to room temperature and concentrated. The residue was purified by SiO2 column chromatography (n-hexane: EtOAc = 1: 1) to obtain the desired compound (110 mg, 22%) as a brown oil.

[0518] Step 2: Synthesis of compound BnH12057

[0519] To a solution of (3R,6S)-6-methyl-1-(2-(4-(oxazol-5-yl)phenyl)acetyl)piperidine-3-carboxylic acid methyl ester (25.0 mg, 0.073 mmol) in THF (0.252 mL) was added 1N NaOH (0.110 mL, 0.110 mmol). The mixture was stirred at room temperature for 2 hours. The mixture was diluted with H2O (2.00 mL) and washed with DCM (2.00×2). The aqueous layer was acidified to pH 1 to 2 with 1N HCl at 0°C and extracted with EtOAc (3.00 mL). The organic layer was washed with brine (3.00 mL), dried over MgSO4, filtered, and concentrated under reduced pressure to give compound BnH12057 (10.0 mg, 41%) as a white solid.

[0520] 1H NMR (400MHz, Chloroform-d) δ7.93 (s, 1H), 7.62 (d, J=8.1Hz, 2H), 7.37-7.29 (m, 3H), 4.98 (s, 0 .5H), 4.83 (d, J=13.9Hz, 0.5H), 4.15 (d, J=16.6Hz, 0.5H), 3.92 (d, J=13.9Hz, 0.5H), 3.78 (s, 2H ), 3.16 (t, J=12.9Hz, 0.5H), 2.79 (t, J=12.9Hz, 0.5H), 2.40 (s, 0.5H), 2.16 (d, J=7.3Hz, 0.5H), 1.94 (d, J=14.3Hz, 1H), 1.80 (q, J=12.2, 11.3Hz, 1H), 1.67-1.44 (m, 2H), 1.14 (d, J=6.9Hz, 3H).

[0521] (4) Synthesis of compound BnH12067 (anhydrous form)

[0522] (3S,6R)-6-Methyl-1-(2-(4-(pyrazin-2-yl)phenyl)acetyl)piperidine-3-carboxylic acid

[0523]

[0524] Step 1: Sodium 2-(4-(pyrazin-2-yl)phenyl)acetate (BnH12067-2)

[0525] A solution of 2-(4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl)acetic acid (6-1-BnH12064-1, 100 mg, 0.382 mmol), 2-bromopyrazine (66.3 mg, 0.420 mmol) and Na2CO3 (121 mg, 1.15 mmol) in MeCN / H2O (2:1, 4.76 mL) was vigorously stirred, bubbled with N2 gas for 5 minutes, and Pd(dppf)Cl2 (27.9 mg, 0.038 mmol) was added. The mixture was bubbled with N2 gas for 5 minutes and refluxed at 90°C for 3 hours. Then, the mixture was cooled to room temperature. The mixture was diluted with H2O (10.0 mL) and washed with DCM (5.00 mL×3). The aqueous layer was concentrated under reduced pressure to give the desired compound (90.0 mg, quantitative) as a yellow solid. The desired compound was used without further purification.

[0526] Step 2: (3S,6R)-6-methyl-1-(2-(4-(pyrazin-2-yl)phenyl)acetyl)piperidine-3-carboxylic acid methyl ester (BnH12067-1)

[0527] To a solution of sodium 2-(4-(pyrazin-2-yl)phenyl)acetate (BnH12067-2, 90 mg, 0.381 mmol) in DMF (1.27 mL) was added (3R, 6S)-rel-6-methyl-3-piperidinecarboxylic acid methyl ester (anhydrous form) (62.9 mg, 0.400 mmol), DIPEA (0.100 mL, 0.572 mmol), HOBt (61.8 mg, 0.457 mmol) and EDC·HCl (71.0 mg, 0.457 mmol). The mixture was stirred at room temperature for 6 hours. The mixture was diluted with EtOAc (2.00 mL) and washed with saturated NH4Cl aqueous solution (2.00 mL) and brine (2.00 mL). The organic layer was dried over MgSO4, filtered and concentrated under reduced pressure. The residue was purified by SiO2 column chromatography (5% MeOH in DCM) to give the desired compound (67.0 mg, 50%) as a brown oil.

[0528] Step 3: Synthesis of compound BnH12067

[0529] To a solution of (3S,6R)-6-methyl-1-(2-(4-(pyrazin-2-yl)phenyl)acetyl)piperidine-3-carboxylic acid methyl ester (67.0 mg, 0.190 mmol) in THF (1.00 mL) was added 1N NaOH (0.284 mL, 0.284 mmol). The mixture was stirred at room temperature for 2 hours. The mixture was diluted with H2O (2.00 mL) and washed twice with DCM (2.00 mL×2). The aqueous layer was acidified to pH 1 to 2 with 1N HCl at 0°C and extracted with EtOAc (2.00 mL). The organic layer was washed with brine (3.00 mL), dried over MgSO4, filtered, and concentrated under reduced pressure to give an off-white solid compound BnH12067 (49.9 mg, 88%).

[0530] 1H NMR (400MHz, DMSO-d6) δ9.25 (s, 1H), 8.71 (t, J = 2.0Hz, 1H), 8.60 (d, J = 2.5Hz, 1H), 8.10 (d, J = 7.9Hz, 2H) , 7.39 (dd, J=18.5, 7.9Hz, 2H), 4.75 (s, 0.5H), 4.55 (d, J=13.7Hz, 0.5H), 4.28 (s, 0.5H), 3.92 (d, J=13.8 Hz, 0.5H), 3.88-3.73 (m, 2H), 3.04 (t, J=12.9Hz, 0.5H), 2.62 (t, J=12.8Hz, 0.5H), 2.19 (ddt, J=11.7, 8. 0, 4.0Hz, 1H), 1.79 (d, J=11.9Hz, 1H), 1.66 (d, J=13.7Hz, 1H), 1.52 (s, 2H), 1.07 (dd, J=9.2, 7.0Hz, 3H).

[0531] (5) Synthesis of compound BnH12095

[0532] (3R,6S)-6-Methyl-1-(2-(3-(pyrimidin-5-yl)phenyl)acetyl)piperidine-3-carboxylic acid

[0533]

[0534] Step 1: Synthesis of compound BnH12095

[0535] A solution of (3R,6S)-1-(2-(3-bromophenyl)acetyl)-6-methylpiperidine-3-carboxylic acid methyl ester (8-1, 170 mg, 0.424 mmol), 5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)pyrimidine (87.3 mg, 0.424 mmol) and Na2CO3 (89.8 mg, 0.847 mmol) in MeCN / H2O (2:1, 5.46 mL) was vigorously stirred and bubbled with N2 gas for 5 minutes. Pd(dppf)Cl2 (31.0 mg, 0.042 mmol) was added to the mixture. The mixture was bubbled with N2 gas for 5 minutes and refluxed at 90°C for 3 hours. The reaction mixture was cooled to room temperature and 1N NaOH (0.847 mL, 0.847 mmol) was added. The mixture was stirred at room temperature for 17 hours. The mixture was diluted with H2O (5.00 mL) and washed with EtOAc (5.00 mL×3). 1N NaOH was added to the aqueous layer to adjust the pH value to pH 2 to 3, and the mixture was extracted with EtOAc (5.00 mL×3). The combined organic layers were dried over MgSO4, filtered, and concentrated under reduced pressure. The residue was purified by SiO2 column chromatography (3 to 5% MeOH in DCM) to give compound BnH12095 (95.0 mg, 66%) as an off-white solid.

[0536] 1 H NMR (400MHz, DMSO-d6) δ12.40 (s, 1H), 9.20 (s, 1H), 9.12 (d, J = 8.6Hz, 2H), 7.68 (d, J = 9.7Hz, 2H), 7.49 (t, J =7.7Hz, 1H), 7.33 (dd, J = 15.5, 7.7Hz, 1H), 4.74 (s, 0.5H), 4.61-4.49d, J = 13.6Hz, 0.5H), 4.33 (s, 0.5H), 3 .98 (d, J=13.6Hz, 0.5H), 3.91-3.74 (m, 2H), 3.06 (t, J=12.9Hz, 0.5H), 2.62 (t, J=12.7Hz, 0.5H), 2.15 (dd, J=25.2, 12.4Hz, 1H), 1.76 (s, 1H), 1.66 (dq, J=12.1, 6.6Hz, 1H), 1.54 (d, J=9.8Hz, 2H), 1.14-1.03 (m, 3H).

[0537] (6) Synthesis of compound BnH12097

[0538] 6-Ethyl-1-(2-(4-(pyrimidin-5-yl)phenyl)acetyl)piperidine-3-carboxylic acid

[0539]

[0540] Step 1: Ethyl 1-(2-(4-bromophenyl)acetyl)-6-ethylpiperidine-3-carboxylate (BnH12097-1)

[0541] To a solution of 2-(4-bromophenyl)acetic acid (700 mg, 3.26 mmol) in DMF (9.00 mL) were added ethyl 6-ethylpiperidine-3-carboxylate (p, 633 mg, 3.42 mmol), DIPEA (1.70 mL, 9.77 mmol), HOBt (528 mg, 3.91 mmol) and EDC·HCl (749 mg, 3.91 mmol). The mixture was stirred at room temperature for 17. The reaction mixture was diluted with EtOAc (25.0 mL) and washed with saturated NH4Cl aqueous solution (25.0 mL) and brine (25.0 mL). The organic layer was dried over Na2SO4, filtered, and concentrated under reduced pressure. The residue was purified by SiO2 column chromatography (n-hexane: EtOAc = 1:0 to 2:1) to obtain the desired compound (302 mg, 36%, two steps) as a yellow oil.

[0542] Step 2: Synthesis of compound BnH12097

[0543] A solution of 1-(2-(4-bromophenyl)acetyl)-6-ethylpiperidine-3-carboxylic acid ethyl ester (150 mg, 0.392 mmol), 5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)pyrimidine (80.9 mg, 0.392 mmol) and Na2CO3 (83.2 mg, 0.785 mmol) in MeCN:H2O (2:1, 4.80 mL) was vigorously stirred, bubbled with N2 gas for 5 minutes, and Pd(dppf)Cl2 (28.7 mg, 0.039 mmol) was added. The mixture was bubbled with N2 gas for 5 minutes and refluxed at 90°C for 3 hours. After stirring, the mixture was cooled to room temperature, and 1N NaOH (0.970 mL, 0.970 mmol) was added and stirred at 50°C for 17 hours. The reaction mixture was diluted with H2O (5.00 mL) and washed twice with DCM (5.00 mL×2). The aqueous layer was acidified to pH 1 to 2 with 1N HCl at 0°C and extracted with EtOAc (5.00 mL). The organic layer was dried over Na2SO4, filtered, and concentrated under reduced pressure. The residue was purified by SiO2 column chromatography (DCM: MeOH = 1: 0 to 4: 1) to obtain a light brown solid compound BnH12097 (35.3 mg, 26%).

[0544] 1H NMR (400MHz, DMSO-d6) δ9.18-9.14 (m, 3H), 7.77 (d, J=7.8Hz, 2H), 7.39 (dd, J=14.3, 7.9Hz, 2H), 4.58-4.54 (m, 1H), 3.99-3 .71 (m, 3.5H), 2.96 (t, J=12.9Hz, 0.5H), 2.19-2.09 (m, 1H), 1.79 (s, 1H), 1.65-1.39 (m, 5H), 0.77 (dt, J=14.0, 7.3Hz, 3H).

[0545] (7) Synthesis of compound BnH12098

[0546] 6-Isopropyl-1-(2-(4-(pyrimidin-5-yl)phenyl)acetyl)piperidine-3-carboxylic acid

[0547]

[0548] Step 1: Synthesis of ethyl 1-(2-(4-bromophenyl)acetyl)-6-isopropylpiperidine-3-carboxylate (BnH12098-1)

[0549] To a solution of 2-(4-bromophenyl)acetic acid (620 mg, 2.91 mmol) in DMF (9.69 mL) were added ethyl 6-isopropylpiperidine-3-carboxylate (s, 608 mg, 3.05 mmol), DIPEA (1.52 mL, 8.72 mmol), HOBt (471 mg, 3.49 mmol) and EDC·HCl (542 mg, 3.49 mmol). The mixture was stirred at room temperature for 17 hours. The reaction mixture was diluted with EtOAc (20.0 mL) and washed with saturated NH4Cl aqueous solution (20.0 mL) and brine (20.0 mL). The organic layer was dried over MgSO4, filtered, and concentrated under reduced pressure. The residue was purified by SiO2 column chromatography (n-hexane: EtOAc = 3:1 to 2:1) to obtain the desired compound (618 mg, 54%, two steps) as a yellow oil.

[0550] Step 2: Synthesis of compound BnH12098

[0551] A solution of 1-(2-(4-bromophenyl)acetyl)-6-isopropylpiperidine-3-carboxylic acid ethyl ester (300 mg, 0.748 mmol), 5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)pyrimidine (154 mg, 0.748 mmol) and Na2CO3 (158 mg, 1.50 mmol) in MeCN:H2O (2:1, 9.64 mL) was vigorously stirred, bubbled with N2 gas for 5 minutes, and Pd(dppf)Cl2 (54.7 mg, 0.075 mmol) was added. The mixture was bubbled with N2 gas for 5 minutes and refluxed at 90°C for 2 hours. After stirring, the mixture was cooled to room temperature, and 1N NaOH (1.50mL, 1.50mmol) was added, and the reaction mixture was diluted with H2O (5.00mL) and washed twice with DCM (5.00mL×2) at 0°C. The aqueous layer was acidified to pH 1 to 2 with 1N HCl at 0°C and extracted with EtOAc (10.0mL). The organic layer was dried over MgSO4, filtered, and concentrated under reduced pressure. The residue was purified by SiO2 column chromatography (5 to 10% MeOH in DCM) to give BnH12098 (90mg, 33%) as an off-white solid.

[0552] 1 H NMR (400MHz, DMSO-d6) δ12.39 (s, 1H), 9.20-9.12 (m, 3H), 7.78 (d, J=7.9Hz, 2H), 7.40 (dd, J=10.7, 7.9 Hz, 2H), 4.62-4.54 (m, 0.5H), 4.25-4.13 (m, 0.5H), 3.97 (dd, J=14.9, 4.1Hz, 0.5H), 3.93-3.68 (m, 2H), 3.60 (d, J=10.2Hz, 0.5H), 2.96 (t, J=13.0Hz, 1H), 2.29-1.96 (m, 2H), 1.82 (d, J=14.5Hz, 1.5H), 1.70-1 .55 (m, 1H), 1.32 (dt, J=28.1, 13.4Hz, 1H), 0.92 (dd, J=17.3, 6.5Hz, 3H), 0.75 (dd, J=25.8, 6.6Hz, 3H).

[0553] The following biological assays were performed using the compounds obtained in the above preparation examples.

[0554] Example

[0555] Example 1. Cell culture and maintenance

[0556] Human undifferentiated neuroblastoma cell line SH-SY5Y and human embryonic kidney cell line (HEK)-293T were purchased from the Korean Cell Line Bank (Korea) and Takara (Japan), respectively. The cells were cultured in HyClone's Minimal Essential Medium (MEM) and Dulbecco's Modified Eagle Medium (DMEM) supplemented with 10% (v / v) fetal bovine serum (FBS), penicillin (100U / mL) and streptomycin (100mg / mL), respectively. The cells were maintained at 37°C, a humidified atmosphere of 95% air and 5% CO2. The cells were passaged up to 10 times. The cells were dissociated using 0.05% trypsin-EDTA solution and seeded into new culture dishes for maintenance.

[0557] On the one hand, primary cortical neuron cells were dissociated from the cerebral cortex of 18-day-old fetal rats, incubated in a prep medium (composition (mM): NaCl 107.5, NaH2PO4 1, NaHCO3 33.5, glucose 11, HEPS1%, penicillin-streptomycin 1%) containing 0.25% trypsin and DNase1dl for 30 minutes, dissociated into single cells and plated. Primary cortical neuron cells were grown in Neurobasal medium supplemented with 1% (v / v) B27, 1% penicillin (100U / mL), streptomycin (100mg / mL) and 1% glutamine (Glutamax). Cells were maintained at 37°C in a humidified atmosphere of 95% air and 5% CO2. The efficacy of the drug was evaluated after 14 days of culture of primary cortical neuron cells.

[0558] Example 2. Cytotoxicity Experiment

[0559] In order to investigate the cytotoxicity of the compounds described in this specification in human cell lines, SH-SY5Y and 293T cells were used. Approximately 8,000 cells (293T cells) and 15,000 cells (SH-SY5Y cells) were plated in each well of a 96-well plate (SPL Life Sciences Co., Ltd., Pocheon, South Korea). After incubation at 37 ° C for 24 hours in a humidified atmosphere containing 5% CO2, the culture medium was replaced with a series of experimental compounds diluted in the corresponding culture medium. The total incubation time was 24 hours, and each assay was repeated six times. Finally, 10 μL of CCK-8 reagent (Dojindo Laboratories, Rockville, Maryland, USA) was added to each well, and after incubation at 37 ° C for 3 minutes, a multifunctional microplate reader (Tecan Infinite M200 Pro) was used to measure the OD at 450nm. These measured values ​​were compared with those of the control group and expressed as a percentage of the control group to calculate cell viability. IC was calculated using SPSS software 50 To do this, the absorbance of the blank wells containing only growth medium was subtracted from the value of the wells containing cells. The background (vehicle) reading was set as 100% viability, and the percent viability of each experimental solution was then calculated.

[0560] Cell survival rate (%) = [(As-Ab) / (Ac-Ab)] × 100

[0561] Data are presented as mean and standard error of the mean (SEM). Statistical analysis was performed using one-way analysis of variance (ANOVA) and Tukey post hoc test (GraphPad Prism 5 software package, version 5.02, GraphPad Software Inc. USA). p<0.05 was considered significant.

[0562] Example 3. Determination of expression level of BDNF and / or GluN2B

[0563] Example 3.1. RT-PCR

[0564] RT-PCR was used to determine the amount of BDNF and GluN2B in response to the compounds of the invention. 293T cells were dissociated using 0.05% trypsin-EDTA solution and seeded in 24-well or 6-well plates for RNA work. After incubation for 24 hours at 37°C in a humidified atmosphere with 5% CO2, the culture medium was replaced with a culture medium containing a series of concentrations of the experimental compound diluted in DMEM without FBS. Time lapse experiments were performed. The same amount of DMSO was used as a negative control group.

[0565] After compound treatment, RNA was isolated from cells. After removing the growth medium, 1 × 10 5 Up to 10 7 For each cell, add 0.3 to 0.4 mL of TRIzol TM Add directly to the culture dish to lyse the cells. After incubation at 4°C for 10 minutes, centrifuge the sample at 12,000 × g for 10 minutes at 4°C. The total RNA precipitates to form a white gel-like pellet at the bottom of the tube. After discarding the supernatant, place the pellet in 1 mL of TRIzol for each 1 mL of lysis solution. TM Resuspend in 1 mL of 75% ethanol. After briefly vortexing the sample, centrifuge the sample at 7500 × g for 5 min at 4 °C. Discard the supernatant with a micropipette and vacuum or air dry for 5 to 10 min. Resuspend the pellet in 20 to 50 μL of RNase-free water. TM μDrop TM The RNA concentration was determined by measuring the A230 / 260 and A260 ratios.

[0566] On ice, combine the experimental RNA (up to 1 μg in 4 μl) and 1 μl (100 pmo1) of oligo dT primer in nuclease-free water for a final volume of 5 μl for each RT reaction. After sealing each RNA tube, place the tube at 70°C (in a PCR machine) for 5 minutes. After removing the tube, immediately cool the tube in ice water for at least 5 minutes. Centrifuge each tube in a microcentrifuge for 10 seconds to collect the condensate and maintain the original volume. Keep the tubes sealed and on ice until the reverse transcription reaction mixture is added. The preparation of the reverse transcription reaction mixture is as follows.

[0567] DW 4.9ul 5x RT buffer 4ul <![CDATA[25mM MgCl2]]> 1.6ul (final 2.6mM) 10mM dNTP (2.5mM each) 3ul (final concentration of each dNTP: 0.5mM) RNasin (40u / ul) 0.5ul (final 20u) RT 1ul total 15ul / tube

[0568] Reverse transcription was carried out using Improm-II reverse transcriptase (A3803) (Promega) and recombinant RNasin ribonuclease inhibitor (Recombinant RNasin Ribonuclease Inhibitor) (N2515) (Promega) according to the manufacturer's instructions. 15 μ l of the reverse transcription reaction mixture was added to each reaction tube on ice, and the reaction tube was returned to the PCR instrument. PCR conditions were as follows:

[0569] 25°C, 5 minutes (annealing) → 42°C, 60 minutes (extension) → 70°C, 15 minutes (inactivation at RT) → maintain at 4°C

[0570] PCR products were analyzed by agarose gel electrophoresis. A housekeeping gene (ACTIN) was used as a PCR control. Repeat experiments were performed with samples to confirm the validity of the observed changes in RNA levels. The primer sequences used were as follows:

[0571] h-GluN2B-positive CTTCCATTTACCCTGGCCTCA h-GluN2B-reverse CATTGCCTCTAGCTCCCTTG h-BDNF-positive CATCCGAGGACAAGGTGGCTTG h-BDNF-reverse GCCGAACTTTCTGGTCCTCATC h-ActinB-Forward CACCAACTGGGACGACAT h-ActinB-Reverse ACAGCCTGGATAGCAACG

[0572] Example 3.2. Western blotting

[0573] The amount of GluN2B reacting with the compound of the present invention was determined by Western blotting. Fetal cerebral cortex was removed from mice at 17 days of gestation, dissociated into single cells, cultured for 13 days, and treated with BnH drug for 24 hours. Protein lysate was prepared from drug-treated cells using RIPA protein lysis buffer containing protease and phosphatase inhibitors. Protein concentration was determined using BCA protein detection kit (Pierce Biotechnology) with bovine serum albumin as standard. Equal amounts of protein (20 μg per lane) were dissociated from 90V SDS-polyacrylamide gel by 2 hours of electrophoresis, and then transferred from SDS-polyacrylamide gel to PVDF membrane at a voltage of 100V for 1 hour, and primary reaction was performed with GluN2B antibody (ab65783, Abcam) for 1 day at 4°C, washed 3 times with 1×PBT every 10 minutes, and secondary reaction was performed with anti-mouse antibody (sc-2357, SantaCruz) for 1 hour, and washed three times with 1×PBT every 10 minutes. Western blotting was performed by the method described above to confirm GluN2B protein expression. Each blot was subsequently re-probed with an anti-β-actin antibody (sc-47778, Sant a Cruz). The housekeeping protein β-actin was detected as a normalization control.

[0574] As a result, as shown in Table 6, changes in the protein expression of GluN2B were confirmed in various BnH12 series compounds.

[0575] Data analysis

[0576] The solvent control was set to 1, and the increase or decrease of the BnH12 series was confirmed (N for each group should be 3 or more).

[0577] Example 4. Synaptic function experiment

[0578] Example 4.1. Os Pump Implantation

[0579] 8-week-old male C57BL / 6J mice were anesthetized with isoflurane during surgery. Then, mice were placed in a stereotaxic frame (RWD Life Science, China). A sagittal incision was made to the scalp at the midline from the eye level to the occipital protuberance to expose the parietal and frontal bones. A small hole (burr hole) was drilled after exposing the skull. The injection cannula was placed at the following coordinates: (mice: bregma -3.30, lateral -1.50y and ventral 0.7mm). A sterile saline solution (+ / - compound of the present invention) was infused at a constant flow rate of 0.5 μL / h through the injection cannula using a mini-Os pump (DURECT Corporation ALZETOsmotic Pumps, California, USA). Implantation was performed in the 4th layer of the ipsilateral barrel cortex. In order to estimate the diffusion degree of the injected compound in the 4th layer of the barrel cortex during the pump injection process, methylene blue was first injected to dye the diffusion area. On average, methylene blue diffused to 2000.0 μm from the injection site (the total area of ​​the barrel cortex region is approximately 1500 μm).Based on this analysis, the barrel cortex area was recorded.

[0580] Example 4.2. Oral administration of compounds

[0581] BnH12003 was dissolved in DMSO:PEG400:normal saline (5:55:40) and used at a dose of 25 mg / kg (200 μl / animal). As a control group, DMSO:PEG400:normal saline (5:55:40) was administered. The compound was administered once a day from day 10 to day 31 of the 8-week-old mice for a total of 22 administrations.

[0582] Example 4.3. Intraperitoneal injection of compounds

[0583] The compound was diluted to 25 mg / kg using DMSO:PEG400:normal saline (5:55:40). The compound was injected intraperitoneally at 10 am every day (the intraperitoneal injection volume was ), for about 11 to 12 days. The control group was also administered with a solvent control (DMSO:PEG400:normal saline (5:55:40)) by intraperitoneal injection in the same manner. Five mice were used for each of the compound administration group and the control group.

[0584] Example 4.4. Preparation of thalamocortical (TC) or hippocampal slices

[0585] To prepare TC or hippocampal slices, 9- to 10-week-old male C57BL / 6J mice were anesthetized with isoflurane. Then, the brain was rapidly cooled by cardiac perfusion with ice-cold artificial cerebrospinal fluid (sucrose aCSF). The brain was removed and placed in ice-cold sucrose aCSF. A coronal section (paracoronal) was prepared at a 10° angle on a ramp at a 50° angle to the midline. Then, the slices were incubated in aCSF at 35°C for 30 minutes for recovery. Then, before being placed in the experimental recording chamber, the slices were incubated in aCSF at room temperature (23 to 25°C) for 1 to 4 hours. Standard aCSF contains saturated 95% O2 / 5% CO2. The mouse brain was removed and cut into 400um at a 50° angle (mice at a 55° angle) and attached to the vibrating microtome plate in a way that the cut portion was at the bottom. Incubate the brain slices in aCSF solution at 35 °C for 30 min or in aCSF solution at room temperature for 1 h.

[0586] Composition of sucrose-based aCSF

[0587]

[0588] Recording the composition of aCSF (room temperature: RT)

[0589]

[0590] Example 4.5. Electrophysiological experiments in barrel cortex

[0591] All electrophysiological experiments were performed at 27 to 29 °C. For electrophysiological experiments, electrodes with a resistance of 3.5 to 4.2 mΩ were used, and stimulation was applied to the ventral posteromedial nucleus (VPM) using concentric bipolar electrodes (FHC, Bowdoin, ME, USA). The somatosensory cortex was confirmed by the presence of barrels under 4× magnification and differential interference contrast (DIC) optics and the ability to evoke short and constant latency field excitatory postsynaptic potentials (fEPSPs) by VPM stimulation. Whole-cell voltage-clamp recordings were performed from stellate cells (SC) in layer IV of the somatosensory barrel cortex using infrared illumination and differential interference contrast (DIC) optics. The composition of the whole-cell recording solution is shown below:

[0592] Whole-cell recording internal solution

[0593]

[0594] Whole-cell recordings were performed using a Multiclamp 700A (Molecular devices, Sunnyvale, CA, USA) with a digitization frequency of 10 kHz and a filter frequency of 2 kHz. Input resistance and series resistance were monitored during recordings as previously described (Isaac, Crair, Nicoll, & Malenka, 1997, Silent synapses during development of thalamocortical inputs, DOI: 10.1016 / s0896-6273(00)80267-6). TC EPS were evoked by VB stimulation at 0.1 Hz and were considered monosynapses if they showed a short and constant latency that did not change with increasing stimulus intensity, as described previously (refer to [Feldman, Nicoll, Malenka, & Isaac, 1998, Synaptic plasticity at thalamocortical synapses in developing rat somatosensorycortex: LTP, LTD, and silent synapses, https: / / doi.org / 10.1002 / (SICI)1097-4695(199910)41:1<92::AID-NEU12>3.0.CO;2U; Isaac et al., 1997, Silent Synapses during Development of Thalamocortical Inputs, https: / / doi.org / 10.1016 / S0896-6273(00)80267-6]).

[0595] For the minimum stimulation protocol (efficacy), the VB thalamus stimulation intensity was adjusted to find the lowest intensity that triggered a mixture of synaptic responses and failures. The failure rate was calculated by the number of failures / total number of attempts. The efficacy was calculated by the average EPSC peak amplitude excluding failures (reference [Chittajallu and Isaac, 2010, Emergence of cortical inhibition by coordinated sensory-driven plasticity at distinct synaptic loci, DOI: 10.1038 / nn.2639]; reference [Isaac et al., 1997, Silent Sy napses during Development of Thalamocortical Inputs, https: / / doi.org / 10.1016 / S08966273(00)80267-6]; reference [Stevens & Wang, 1995, Facilitation and depression at single central synapses, DOI: 10.1016 / 08966273(95)90223-6]).

[0596] As previously reported, the criteria for single axon stimulation were all or no synaptic events and no change in the mean EPSC amplitude induced by a small increase in stimulation intensity (referents [Chittajallu and Isaac, 2010, Emergence of cortical inhibition by coordinated sensory-driven plasticity at distinct synaptic loci, DOI: 10.1038 / nn.2639]; [Gil et al., 1999, Effect of Thalamocortical and Intracortical Synaptic Connections: Quantum, Innervation, and Reliability, https: / / doi.org / 10.1016 / S0896-6273(00)80788-6]). The assay parameters were as follows:

[0597] Measurement parameters

[0598]

[0599] Excitatory postsynaptic potentials (EPSCs) were recorded by the whole-cell patch clamp method using a patch clamp amplifier (Molecular Devices, USA). The measuring electrode was a borosilicate glass capillary with a resistance of 3.5MΩ to 4.2MΩ when the electrode was filled with solution. The intracavitary brain slice was placed on an upright microscope and fixed with an anchor to record the flow of aCSF solution at a rate of 5 to 10mL / min under gravity. The electrodes of the stimulator were placed at the connection between the thalamic fibers and the S1 barrel cortex (layer 4) area, and the cells in this area were found and recorded. After the whole-cell patch, the membrane voltage was fixed at -70mV (to measure the AMPA current), stimulation was applied to determine the EPSC, and the stimulator was operated to find the minimum stimulation intensity at which the current on / off became 50%. The amplitude was measured by recording and current trajectories for 3 minutes and 20 seconds or 8 minutes and 20 seconds (a total of 20 or 50 trajectories). For efficacy, EPSC magnitude was set to 50 to 100 pA at -70 mV, and 5 traces were measured at 0 mV.

[0600] Example 4.6. Electrophysiological Experiments of Hippocampus

[0601] Using an extracellular glass pipette (3.5MΩ) filled with aCSF, field recording was performed with concentric bipolar electrodes located in the stratiform layer of the CA1 region. Specifically, fEPSP was induced by Schaffer collateral (SC) / commissural fibers using concentric bipolar electrodes placed 200 to 300 μm from the recording pipette. Stimulation was performed by bipolar electrodes (FHC, Bowden, Maine, USA) configured in Schaffer collateral-CA1 (SC). The SC circuit was visualized using a 4× magnification and differential interference contrast (DIC) microscope, and the ability to induce short and constant latency field excitatory postsynaptic potentials (fEPSP) at CA1 synapses was confirmed by SC input stimulation. In all fEPSP experiments, the experimental stimulus (30 μA) was determined before starting all experiments, and an experimental pulse stimulus intensity of 50% of the maximum fEPSP was used. Baseline synaptic responses were recorded for 30 minutes, and then long-term potentiation (LTP) was induced by high-frequency stimulation (HFS, 100 Hz, 4 trains, 1 s duration, 20 s interval between trains). Recordings were made every 10 seconds for 1 hour using a multiclamp 700A amplifier (Molecular Devices, San Jose, CA, USA) and pClamp10.0 software (Molecular Devise, San Jose, CA, USA), with a digitization frequency of 10 kHz and a filter frequency of 2 kHz using Digi data 1440. The measurement parameters were as follows:

[0602] Measurement parameters

[0603]

[0604] Excitatory postsynaptic potentials (EPSCs) were recorded by whole-cell patch clamp using a patch clamp amplifier (Molecular Devices, USA). The electrodes used for measurement were borosilicate glass capillaries with a resistance of 3.5 MΩ to 4.2 MΩ when the electrode was filled with solution. The intracavitary brain slices were placed on an upright microscope and fixed with anchors to record the flow of aCSF solution at a rate of 5 to 10 mL / min under gravity. The electrodes of the stimulator were placed in the SC region, and the connection sites in the CA1 region were found and recorded. As the intensity of stimulation increased, the point was recorded until the fEPSP no longer increased or a pop spike appeared (I / O curve). The baseline synaptic response was recorded for 20 minutes, and then long-term potentiation (LTP) was induced by high-frequency stimulation (HFS, 100 Hz, 4 times of culture, duration 1 s, culture interval 20 s / TBS; 100 Hz, 10 times of culture, duration 50 ms, culture interval 200 ms). Next, the recording was performed for 60 minutes (LTP).

[0605] Example 4.7. Data Analysis

[0606] For efficacy analysis, the Clampfit program (Axon Instruments) was used. The baseline was set by specifying intervals between 0 and 100 ms. Traces were averaged by selecting "On" currents occurring between 110 and 200 ms. Averaged traces were examined for negative current amplitudes (pA).

[0607] Analyze GABA / AMPA ratios using Clampfit. For AMPA currents, set the baseline by specifying intervals between 0 and 100 ms. Average the data traces from 110 to 200 ms. Confirm the negative current amplitude (pA) of the average trace. For GABA currents, set the baseline by specifying intervals between 0 and 100 ms. Average the data traces from 110 to 300 ms. Confirm the positive current amplitude (pA) of the average trace.

[0608] I / O curves were calculated using Clampfit. The baseline was set by specifying an interval between 0 and 6 ms. The average of the recorded traces (5 each) from the same stimulus was calculated. The amplitude of the fiber volley and the 20%z to 80% rise slope of the fEPSP were analyzed. For LTP, the baseline was set by specifying an interval between 0 and 6 ms. The 20%z to 80% rise slope of the fEPSP before and after HFS (or TBS) induced LTP was analyzed.

[0609] Example 4.8. Statistical analysis

[0610] All data are presented as mean ± SEM, and n represents the number of cells used in each experiment. Typically, one slice was used per animal; one recording was performed per slice. The means of the two groups were compared using an unpaired t-test, and one-way ANOVA was used for more than three groups. A p value < 0.05 was considered statistically significant. These statistical analyses were performed using Prism 9.0 (GraphPad Prism 9.1.2, GraphPad Software Inc. USA).

[0611] Dose response curves were plotted using Graphpad, Prism 9 according to the manufacturer's instructions.

[0612] Example 4.9. Western Blot

[0613] To prepare thalamocortical (TC) slices, 9- to 10-week-old male C57BL / 6J mice were anesthetized with isoflurane. The brain was then rapidly cooled by cardiac perfusion with ice-cold artificial cerebrospinal fluid (sucrose aCSF). The brain was removed and placed in ice-cold sucrose aCSF. Paracoronal sections were prepared at a 10° angle on a slope at a 50° angle to the midline. The slices were then incubated in aCSF at 35°C for 30 minutes for recovery.

[0614] The slices were then incubated in aCSF at room temperature (23 to 25° C.) for 1 to 4 hours before being placed in the recording chamber for the experiment. Standard aCSF contains saturated 95% O2 / 5% CO2.

[0615] Composition of sucrose-based aCSF

[0616]

[0617] Record the composition of aCSF (room temperature: RT)

[0618]

[0619] All electrophysiological experiments were performed at 27 to 29°C. Flowing blood from a sucrose-based aCSF solution (4°C) was perfused into rodents (mice) by gravity. The brain of the rodent (mice) was removed and cut into 400um at a 50° angle (55° for mice), and attached to the vibrating slicer disk with the cut section at the bottom. The brain slices were incubated in aCSF solution at 35°C for 30 minutes, or incubated in aCSF solution at room temperature for 1 hour. Mouse cortical tissue was prepared according to the above protocol, then homogenized and lysed to extract protein. Protein lysates were prepared from tissues using NP40 (FNN0021, Invitrogen) protein lysis buffer containing protease and phosphatase inhibitors according to the manufacturer's instructions. Protein concentration was determined using a BCA protein assay kit (Pierce Biotechnology) with bovine serum albumin as the standard. Equal amounts of protein (20 μg per lane) were electrophoretically dissociated from 8% or 12% SDS-polyacrylamide gels and then blotted onto PVDF membranes (GE Healthcare). In order to block nonspecific binding, the membrane was incubated in 5% skim milk powder in PBST (150 mM NaCl, 50 mM Tris, pH 7.4, 0.05% Tween 20) for 1 hour at room temperature. Anti-HDAC4 (SAB4300413, Sigma-Aldrich), anti-BDNF (ANT-010, Alomone Las), anti-NMDAR2B (ab65783, abcam plc) antibodies were incubated overnight in 2% blocking solution at 4 ° C. After incubation with the antibody and rinsing several times in PBST, the membrane was incubated with a secondary antibody (sc-2357, Santa Cruz) coupled to mouse anti-rabbit IgG-HRP for 1 hour. Each blot was subsequently re-probed with an anti-β-actin antibody (sc-47778, Santa Cruz). The housekeeping protein β-actin was detected as a normalization control. The antibodies used in the methods described in this specification are as follows:

[0620]

[0621] Example 5. Therapeutic efficacy in PTSD

[0622] Example 5.1. Animal Acquisition and Management

[0623] Animals were obtained from DBL. Animals were obtained 7 days before the start of the experiment. Twenty male S rats of approximately 7 weeks of age were used. Animals were kept under conventional environmental conditions in a colony room with a 12 / 12 h light-dark cycle, with free access to food and water. Rats were acclimated to the new cages over 7 days. All experiments were performed on animals. All experiments were performed in accordance with the Guide for the Care and Use of Laboratory Animals, and efforts were made to minimize the suffering of the animals. Body weight was measured every 3 days starting from day 7.

[0624] Example 5.2. Rat Modeling of PTSD

[0625] The protocol consisted of exposure to two foot shocks with no chance of escape.

[0626] Context A (Day -1)

[0627] Body weight was measured 3 hours before the experiment. The experimental room temperature was maintained at 22°C. To acclimate the animals, they were placed in a dark experimental room for 10 minutes. The animals were placed individually in the first room. After 2 minutes, the door separating the two compartments was opened, and the animals were allowed to move freely on both sides. After 5 minutes, 15 foot shocks of 1 mA / 2 seconds were applied at random time intervals (90 to 270 seconds). After the experiment, the animals were placed in the box for 1 minute and then moved to the group room.

[0628] Scenario B (Day 0)

[0629] Body weight was measured 3 hours before the experiment. The laboratory temperature was maintained at 22°C. To acclimate the animals, they were placed in a dark laboratory space for 10 minutes. The animals were placed in the first compartment with sandpaper attached. At this time, the door was kept closed so that the animals could not reach the second compartment. After 10 minutes, the animals were given 3 foot shocks of 2 mA / sec. After the experiment, the animals were placed in the box for 1 minute and then moved to the group room.

[0630] Compound injection

[0631] The compound was diluted to 25 mg / kg using DMSO:PEG400:normal saline (5:55:40). Starting from the 7th day, the compound was injected intraperitoneally at 10 am every day (the intraperitoneal injection volume was 200 μl) for 24 consecutive days. The control group was also administered by intraperitoneal injection using a solvent control (DMSO:PEG400:normal saline (5:55:40)) in the same manner.

[0632] Rigidity test

[0633] For the freezing check, 7 days after the initial foot shock protocol, the rats were placed in the first compartment of the apparatus with sandpaper for 5 minutes (without foot shock), and freezing behavior was recorded using the shuta void_v1803 program (Panlab, Spain) according to the manufacturer's instructions. At this time, the door remained closed, as in situation B. Freezing is defined as a state in which the rat has no skeletal muscle movement. Animals with a freezing time of less than 240 seconds were excluded. Excluded animals were killed using CO2.

[0634] Data analysis

[0635] To confirm the activity of all animals, a camera was placed in front of the transparent acrylic plate of the electronic box. Starting from day 7, the freezing status of all groups was confirmed every three days. Each animal was filmed for 5 minutes. The freezing time of each animal was confirmed based on the video. The freezing time on day 7 was set as 100%, and then the freezing time of each day was converted into a percentage.

[0636] Example 6. Therapeutic efficacy in AD

[0637] Example 6.1. Animal Acquisition and Management

[0638] APP / PS1 mice are an animal model of Alzheimer's disease and were obtained from Taconic Bioscience. Animals were obtained 7 days before the start of the experiment. Twenty male mice of approximately 15 months of age were used. The animals were kept under regular environmental conditions in a colony room with a 12 / 12 hour light and dark cycle, with free access to food and water. The mice adapted to the new cages within 7 days. All experiments were performed on animals. All experiments were performed in accordance with the Guide for the Care and Use of Laboratory Animals, and efforts were made to minimize the suffering of the animals. Body weight was measured every 3 days starting from the 7th day.

[0639] Example 7. Selection of BnH12003

[0640] Example 7.1. In vitro cytotoxicity

[0641] The cytotoxicity of the compounds was assessed by treating cells with BnH12003 and determining cell survival.

[0642] The cell viability was measured in human cell lines 293T and SH-SY5Y after treatment with BnH12003 (0, 0.1, 1, 10, 100 μM). No significant changes in cell viability were observed in any concentration range, confirming the cytotoxic safety of BnH12003 ( Figure 1a and Figure 1b ).

[0643] Example 7.2. Analysis of efficacy of enhancing synaptic plasticity in vitro

[0644] After administration of BnH12003, potency and GABA / AMPA ratios were measured in the barrel cortex to confirm compound efficacy.

[0645] To this end, 8-week-old C57BL / 6J mice were divided into a control group (solvent control administration group) and an experimental group (BnH12003 administration group) with 5 mice in each group. After Alzet Os pump injection surgery, BnH12003 was directly injected into the barrel cortex layer 4 at a total dose of 3 μM using an Os pump for 2 weeks ( Figure 2a and Figure 2b ).

[0646] When compound BnH12003 was administered, the balance of excitation / inhibition was maintained as confirmed by measuring the GABA / AMPAb ratio in the barrel cortex (layer 4) of mice ( Figure 3a ), while the excitatory TC synaptic potency (TC potency) increased significantly ( Figure 3b ), it can be seen that BnH12003 enhances synaptic plasticity, thereby showing the effect of improving cognitive ability. On the one hand, 8-week-old C57BL / 6J mice were divided into a control group (solvent control administration group) and an experimental group (BnH12003 administration group) with 5 mice in each group, and intraperitoneally injected with a dose of 25 mg / kg once a day for about 11 to 12 days. As a result, the administration of BnH12003 maintained the balance of excitation / inhibition and was able to increase the TC synaptic efficacy in the sensory cortex ( Figure 4a and Figure 4b ).

[0647] Example 7.3. Analysis of the proteolytic efficacy of HDAC4

[0648] The BnH12 series of the present invention was synthesized by targeting HDAC4 compounds, and attempts were made to determine whether BnH12003 degrades HDAC4 at the protein level. The HDAC4 protein level based on the presence or absence of BnH12003 treatment was determined from the dissociated barrel cortex of the mice in Example 7.2. As a result, the HDAC4 protein level was reduced by 60% to 80% in all experimental groups of mice compared to the control group of mice ( Figure 5). This result suggests that BnH12003 regulates HD AC4 protein levels, enhances synaptic plasticity, and thus improves cognitive function.

[0649] Example 7.4. Analysis of the efficacy of post-traumatic stress disorder treatment using animal models of post-traumatic stress disorder

[0650] Since the HDAC4 gene has been studied to be closely related to the brain's fear response, an attempt was made to use an animal model of post-traumatic stress disorder (PTSD) to observe the therapeutic efficacy of administering BnH12003.

[0651] To this end, SD rodents (rats) (300g) were adapted for 3 days, placed in a chamber for 5 minutes before entering the experiment and photographed for the rigidity test of experimental rats. In a chamber surrounded by coarse sandpaper, electrical stimulation was randomly applied to the soles of the feet, and electrical stimulation was performed 15 times at intervals of 90 to 270 seconds, with an intensity of 1mA and a duration of 2 seconds. On the second day, electrical stimulation was applied to the soles of the feet every 3 seconds, 3 times per second, with an intensity of 2mA and a duration of 2 seconds in a chamber surrounded by coarse sandpaper. PTSD rodents (rats) were selected by confirming the rigidity time on the 7th day. The selected rodents (rats) were divided into control groups and experiments according to 12 in each group, and 1μM BnH12003 was administered to the cerebral ventricles of rodents (rats) using an Os pump. On the 10th day after the rodent (rats) PTSD model was started, the control group was intraperitoneally refracted with saline, and the experimental group was intraperitoneally injected with BnH12003 (25mg / kg), and the rigidity time was confirmed at intervals of 3 days. The freezing time was confirmed 8 times in total, and the percentage (%) of freezing time reduction was calculated on the 7th day after the establishment of the PTSD rodent (rat) model.

[0652] As a result, the freezing time of the experimental group administered with BnH12003 was significantly reduced compared with the control group ( Figure 6 ), when BnH12003 was administered to rats with traumatic memory (fear memory), it was confirmed that the traumatic memory (fear memory) was reduced or disappeared. Therefore, it was confirmed that the use of the compound of the present invention improves the learning effect of eliminating traumatic memory (fear memory) or new memory (no longer dangerous place).

[0653] Example 7.5. Analysis of the efficacy of enhancing synaptic plasticity in vitro in an Alzheimer's animal model

[0654] After administering BnH12003 to APP / PS1 mice (Taconic Bioscience), an animal model of Alzheimer's disease, the efficacy of the compound on Alzheimer's disease was confirmed by measuring the potency and GABA / AMPA ratio in the hippocampus, and in particular, the effects of BnH12003 alone and in combination with Solanezumab were compared. To this end, BnH12003 and Solanezumab (Creative Biolabs, USA) were administered to the hippocampus at doses of 3 μM and 200 μg, respectively, by intracerebroventricular injection of an Os pump, and the changes in the I / O curve of the field excitatory postsynaptic potential (EPSP) in the CA1 region of the Schiff collateral circuit in the hippocampus were observed to confirm that the in vivo administration of BnH12003 increased the synaptic efficacy ( Figure 7a ). In addition, by measuring the synaptic long-term potentiation (LTP) of EPSP in the CA1 region of the Schiff collateral circuit in the hippocampus, it was confirmed that LTP of the excitatory SC pathway was also significantly increased ( Figure 7b ).

[0655] Since the increase in I / O curve and LTP indicates enhanced synaptic plasticity, it can be seen from these results that the combined administration of BnH12003 and sulanzumab enhances the SC pathway synaptic efficacy in the hippocampus, indicating that BnH12003 is effective in the treatment of Alzheimer's disease. In this case, the combined administration of BnH12003 and sulanzumab is more effective than the administration of BnH12003 and sulanzumab alone.

[0656] In one aspect, after administration of BnH12003 to APP / PS1 mice, the efficacy of the compound on Alzheimer's disease was determined by measuring the potency and GABA / AMPA ratio in the barrel cortex, particularly comparing the effects of BnH12003 alone and in combination with sulantuzumab.

[0657] When BnH12003 was administered to APP / PS1 mice, in vivo administration of BnH12003 maintained the balance of excitation / inhibition as confirmed by measurement of the GABA / AMPA ratio ( Figure 8a ), the excitatory TC synaptic potency (TC potency) increases ( Figure 8b ). Since the increase in TC efficacy indicates enhanced synaptic plasticity, it can be seen from these results that the administration of the BnH12003 compound increases the efficacy of TC synapses in the sensory cortex while maintaining the balance of excitation / inhibition, which indicates that BnH1200 is effective in treating Alzheimer's disease. In this case, the combined administration of BnH12003 and Sulanzhumab showed a more obvious and excellent effect than the separate administration of BnH12003 and Sulanzhumab.

[0658] Example 8. Surface plasmon resonance identification

[0659] The compounds of the present invention were selected based on their ability to interact with HDAC4. To perform the experiments, surface plasmon resonance identification was used. The samples were prepared as follows and loaded onto a Biacore T200.

[0660]

[0661] Samples were fixed under the following conditions: Protein stock was diluted with 10 mM sodium acetate. 1 M ethanolamine (pH 8.5) was used as blocking agent.

[0662] Chip number Ligand concentration Fixation buffer Fixed level #2 HDAC4 50ug / mL Sodium acetate, pH 5.0 11489.5RU

[0663] Fig. 9 The binding kinetics of BnH12003 to HDAC4 are shown.

[0664] Example 9. Effect of compounds on HDAC catalytic activity

[0665] Compounds were resuspended in DMSO at 100 mM and serially diluted 3-fold starting from 100 μM for HDACs 1-9 and 11 to give a 10-IC 50 As reference compounds, trichostatin A (TSA) and TMP269 were serially diluted 3-fold starting from 10 μM or 1 μM to obtain a 10-dose IC 50 Conduct experiments.

[0666] A 10 μM fluorescent peptide of p53 residues 379-382 (RHKK(Ac)AMC) was used as a substrate for HDACs 1, 2, 3, and 6. A 50 μM fluorescent HDAC class 2a substrate (trifluoroacetyl lysine) was used as a substrate for HDACs 4, 5, 7, 9, and 11. A 100 μM fluorescent peptide of p53 residues 379-382 (RHK(Ac)K(Ac)AMC) was used as a substrate for HDAC8.

[0667] IC was calculated using the GraphPad Prism 4 program based on the sigmoidal dose-response equation. 50 The curve was fitted by inputting the blank (DMSO) concentration as 1.00E-12 M. The curve was fitted for the compound data set with enzyme activity less than 65% at the highest concentration of the experimental compound.

[0668] The experiment was performed in duplicate. BnH12003 did not show any inhibitory effect on the catalytic activity of HDACs 1 to 9 and 11.

[0669] Example 10. Effects on BDNF and GluN2B expression and thalamocortical EPSC potency

[0670] When HDAC4 protein expression was inhibited by transfection with lentiviral HDAC4 shRNA, the expression of BDNF and GluN2B in SH-SY5Y cells was significantly increased ( Fig.10a and Fig.10b Similarly, BnH12003 (1 μM) enhanced BDNF and GluN2B expression in SH-SY 5Y cells after 6 and 24 h of administration ( Fig.11a and Fig.11b Bn H12003 significantly inhibited HDAC4 protein expression in the barrel cortex of mice by oral administration and intraperitoneal injection, and this inhibitory effect lasted for at least 10 days ( Fig.12a and Figure 12b ).

[0671] Example 11. In vitro cytotoxicity of various BnH12 series compounds

[0672] The cytotoxicity of the compounds was evaluated by treating cells with various BnH12 series compounds and measuring cell viability using the experimental procedures described in Example 2. As a result, almost all compounds achieved cell viability of more than 85% at a concentration of 10uM, and also achieved cell viability of more than 80% when the concentration was increased to 100uM.

[0673] [Table 4]

[0674]

[0675]

[0676]

[0677] In the 293T cell line, the results of measuring cell viability based on compound concentration (10 or 100 μM) showed that most compounds did not show significant changes in cell viability in both concentration ranges.

[0678] Example 12. Confirmation of the efficacy of various BnH12 series compounds

[0679] Using the experimental procedure described in Example 3, it was determined whether various BnH12 series compounds increase GluN2B expression, and the results are shown in Table 5. These in vitro experimental results are expressed as relative values ​​to the group not treated with the compound (solvent control), and the effect of the group not treated with the compound was set to 1.

[0680] [Table 5]

[0681]

[0682]

[0683] As can be seen from Table 5, the representative compounds of the present invention showed excellent effects compared with the solvent control. In particular, BnH12003, BnH12046, BnH12057, BnH12067, BnH12091, BnH12092, BnH12095, BnH12097 and BnH12098 showed excellent effects compared with other compounds.

Claims

1. A compound represented by formula (1), a stereoisomer thereof or a pharmaceutically acceptable salt thereof, characterized in that: Among them, R 1 is an aryl or heteroaryl group, or is combined with an adjacent phenyl group to form a saturated or partially saturated heterocyclic ring, wherein one or more hydrogen atoms in the aryl, heteroaryl or heterocyclic ring are not substituted, or are replaced by halogen atoms, C 1-6 Alkyl, C 3-12 Cycloalkyl, C 1-6 Alkoxy, aryl, heteroaryl, amino or nitro substituted, the substituent is unsubstituted or substituted with one or more halogen atoms or C 1-6 Alkyl substitution, R 2 For hydrogen, C 1-6 Alkyl or aryl, R 3 is hydrogen, carboxyl, N-hydroxycarboxamide or carboxamide, the hydrogen in the group can be replaced by C 1-6 Alkyl substitution, n is 0 or 1, m is 0 to 6.

2. The compound according to claim 1, its stereoisomer or a pharmaceutically acceptable salt thereof, characterized in that: R 1 It is phenyl, pyridyl, pyridazinyl, pyrimidinyl, pyrazinyl, furyl, thienyl, pyrrolyl, imidazolyl or oxazolyl, or is combined with an adjacent phenyl group to form quinoxalinyl or dihydrobenzodioxy.

3. The compound according to claim 2, its stereoisomer or a pharmaceutically acceptable salt thereof, characterized in that: R 1 One or more hydrogen atoms in the carbon atoms are replaced by halogen atoms, one or more halogen atoms are replaced by halogen atoms, or unsubstituted C 1-6 Alkyl or C 3-12 Cycloalkyl, C 1-6 Alkoxy, phenyl, pyridyl, pyridazinyl, pyrimidinyl, substituted with one or more C 1-6 The alkyl group may be substituted or unsubstituted with amino or nitro.

4. The compound according to claim 1, its stereoisomer or a pharmaceutically acceptable salt thereof, characterized in that: R 1 It is phenyl, biphenyl, pyridin-4-yl, pyridin-3-yl, pyridin-2-yl, methylpyridin-3-yl, 6-methoxy-pyridin-3-yl, 6-cyclopropyl-pyridin-3-yl, trifluoromethylpyridin-3-yl, phenylpyridin-3-yl, pyridazin-4-yl, pyridazin-3-yl, pyridazin-2-yl, pyrimidin-2-yl, pyrimidin-4-yl, pyrimidin-5-yl, methylpyrimidin-5-yl, 5-fluoropyrimidin-2-yl, 2-(trifluoromethyl)pyrimidin-5-yl, 2-cyclopropylpyrimidin-5-yl, pyrazin-2-yl, thiophen-2-yl, furan-2-yl, oxazol-2-yl, 3-nitrophenyl, 4-nitrophenyl, 3-aminophenyl, 4-aminophenyl or 4-diethylaminophenyl.

5. The compound according to claim 1, its stereoisomer or a pharmaceutically acceptable salt thereof, characterized in that: R 2 H or C 1-6 alkyl.

6. The compound according to claim 1, its stereoisomer or a pharmaceutically acceptable salt thereof, characterized in that: R 3 It is H, carboxyl, methylcarboxyl, ethylcarboxyl, N-hydroxycarboxamide or carboxamide.

7. The compound according to claim 1, its stereoisomer or a pharmaceutically acceptable salt thereof, characterized in that: The stereoisomers are optical isomers.

8. The compound according to claim 1, its stereoisomer or a pharmaceutically acceptable salt thereof, characterized in that: The stereoisomer is a (3R, 6S)-optical isomer.

9. The compound according to claim 1, its stereoisomer or a pharmaceutically acceptable salt thereof, characterized in that: The compound is selected from the following compounds, 10. The compound according to claim 9, its stereoisomer or a pharmaceutically acceptable salt thereof, characterized in that: The compound is selected from BnH12003, BnH12017, BnH12045, BnH12046, BnH12047, Bn The group consisting of BnH12048, BnH12051, BnH12053, BnH12057, BnH12058, BnH12064, BnH12066, BnH12067, BnH12071, BnH12072, BnH12078, BnH12085, BnH12086, BnH12088, BnH12089, BnH12090, BnH12091, BnH12092, BnH12093, BnH12095, BnH12097 and BnH12098.

11. The compound according to claim 1, its stereoisomer or a pharmaceutically acceptable salt thereof, characterized in that: The compounds are inhibitors of HDAC.

12. The compound according to claim 11, its stereoisomer or a pharmaceutically acceptable salt thereof, characterized in that: The HDAC is HDAC4.

13. The compound according to claim 1, its stereoisomer or a pharmaceutically acceptable salt thereof, characterized in that: The compounds enhance synaptic plasticity.

14. A pharmaceutical composition, characterized in that The active ingredient comprises the compound according to any one of claims 1 to 13, a stereoisomer thereof, or a pharmaceutically acceptable salt thereof.

15. The pharmaceutical composition according to claim 14, characterized in that The composition is used for preventing or treating neurotic disorders or neurodegenerative disorders.

16. The pharmaceutical composition according to claim 14, characterized in that The compound, a stereoisomer thereof, or a pharmaceutically acceptable salt thereof is delivered to the brain at a concentration of about 0.1 to about 3 μM.

17. The pharmaceutical composition according to claim 15, characterized in that The disorder is Alzheimer's disease.

18. The pharmaceutical composition according to claim 15, characterized in that The disorder is PTSD.

19. The pharmaceutical composition according to claim 14, characterized in that A second therapeutic agent is also included.

20. The pharmaceutical composition according to claim 19, characterized in that The second therapeutic agent is sulantuzumab.

21. A method for preventing or treating a neurotic disorder or a neurodegenerative disorder, characterized in that: The method comprises administering the compound, stereoisomer or pharmaceutically acceptable salt thereof according to any one of claims 1 to 13 to an individual in need of preventing or treating a neurotic disorder or a neurodegenerative disorder.

Images