Lhfpl5 gene enhancer and use thereof

Abstract

The present invention discloses an Lhfpl5 gene enhancer and its uses, belonging to the field of genetic engineering. The invention discovered the Lhfpl5 gene enhancer, which can significantly enhance the expression of the Lhfpl5 gene itself or other genes in the inner and outer hair cells of the inner ear. Leveraging its ability to specifically enhance gene expression in inner and outer hair cells, the enhancer can be used for gene therapy for deafness. Furthermore, the enhancer can be incorporated into recombinant DNA or vectors containing the Lhfpl5 gene enhancer for research on gene expression regulation, with promising application prospects.

Description

Technical Field

[0001] The present invention relates to the field of genetic engineering, and in particular to an Lhfpl5 gene enhancer and uses thereof. Background Art

[0002] Enhancers are typical cis-regulatory elements in the genome, located upstream, downstream, or within the gene's transcription start site, and can be located hundreds of thousands of base pairs away, or even spanning hundreds of thousands of base pairs. Their core function is to enhance the transcriptional activity of target genes by binding to proteins such as transcription factors. They play a key role in the spatiotemporal regulation of gene expression, specifically expressing specific genes at specific times and spaces to ensure normal cell differentiation, organ development, and physiological function. During development, different cell types need to express different genes, and enhancers can precisely regulate the spatiotemporal expression of these genes. The characteristics of enhancers make them potentially valuable for application in cell and gene therapy.

[0003] The LHFPL5 (Lipoma HMGIC Fusion Partner-Like 5) gene, located on human chromosome 6q14.1, encodes a four-transmembrane protein. This protein is primarily expressed in the inner and outer hair cells of the inner ear, helping them sense the mechanical vibrations of sound waves and convert them into electrical signals. It also works in conjunction with TMC1, another key protein in the auditory mechanochannel, to ensure the proper function of ion channels. Loss or mutations in LHFPL5 may lead to loss of channel function, leading to sensorineural hearing loss. For hearing loss caused by LHFPL5 gene mutations, gene replacement or repair can be used to restore normal gene function and thereby restore hearing. Studies in mouse models have shown that cochlear injection of a vector carrying a normal Lhfpl5 gene can partially restore hearing, but nonspecific expression of the normal Lhfpl5 gene may be harmful to the host.

[0004] Enhancers in the Lhfpl5 gene regulate its activation in specific developmental stages or cell types, ensuring that the gene is expressed at the appropriate time and location, preventing nonspecific expression from harming the host. However, research and application of the Lhfpl5 gene enhancer have yet to be reported. Summary of the Invention

[0005] To solve the above problems, the present invention provides an Lhfpl5 gene enhancer, the nucleotide sequence of which is shown in SEQ ID No. 1.

[0006] The present invention also provides a recombinant vector, which is a plasmid containing an enhancer and a target gene as shown in the nucleotide sequence of SEQ ID No. 1.

[0007] Furthermore, the target gene includes the Lhfpl5 gene and / or the reporter gene EGFP.

[0008] Furthermore, the plasmid includes a pWHERE vector plasmid vector.

[0009] The present invention also provides a use of the aforementioned enhancer and the aforementioned recombinant vector in preparing a reagent for promoting the specific expression of a target gene in inner and outer hair cells of the cochlea.

[0010] Furthermore, the target gene includes the Lhfpl5 gene and / or the reporter gene EGFP.

[0011] The present invention also provides the aforementioned enhancer and use of the aforementioned recombinant vector in preparing a drug for treating deafness.

[0012] The present invention also provides a method for promoting the specific expression of a target gene in inner and outer hair cells of the cochlea for non-therapeutic purposes, comprising introducing the aforementioned enhancer or the aforementioned recombinant vector into an organism.

[0013] Furthermore, the method includes injecting the recombinant vector into animal fertilized eggs.

[0014] The present invention also provides the use of the transgenic animals obtained by the above method in the study of gene expression regulation.

[0015] Compared with the prior art, the present invention has the following significant effects:

[0016] The present invention studied and analyzed the physical and functional units of the Lhfpl5 gene and, based on genomic location, identified the enhancer shown in SEQ ID No. 1 as the Lhfpl5 gene enhancer. This enhancer can significantly enhance the expression of the Lhfpl5 gene itself or other genes in the inner and outer hair cells of the inner ear. Its ability to specifically enhance gene expression in inner and outer hair cells of the inner ear could be used for gene therapy for deafness. Furthermore, it can be incorporated into recombinant DNA or vectors containing the Lhfpl5 gene enhancer for research into gene expression regulation, and has promising applications.

[0017] Obviously, based on the above contents of the present invention, according to common technical knowledge and customary means in this field, without departing from the above basic technical ideas of the present invention, other various forms of modifications, replacements or changes can be made.

[0018] The following further describes the above content of the present invention in detail through specific embodiments in the form of examples. However, this should not be construed as limiting the scope of the above subject matter of the present invention to the following examples. All technologies implemented based on the above content of the present invention fall within the scope of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 Schematic diagram of the vector structure after Lhfpl5 enhancer and EGFP were cloned into the pWHERE plasmid;

[0020] Figure 2 Comparison of fluorescence effects in the mouse inner ear using different enhancers; Group A showed no fluorescence signal of the empty vector-EGFP in the mouse cochlea; Group B showed fluorescence signal of the Lhfpl5 gene enhancer-EGFP in the mouse cochlea (top: whole inner ear cochlear basilar membrane; middle: magnified view; bottom: side view). DETAILED DESCRIPTION

[0021] The raw materials, reagents and equipment used in the specific embodiments of the present invention are all known products and can be purchased commercially.

[0022] Example 1 Cloning and Activity Analysis of the Lhfpl5 Gene Enhancer Sequence

[0023] 1. Acquisition and localization of the Lhfpl5 gene enhancer

[0024] The Lhfpl5 gene (NCBI accession number LOCUS NC_000083) is specifically expressed in hair cells of the inner ear of animals and is inactive in other cell types of the inner ear. To this end, previous research and analysis of the physical and functional units of the Lhfpl5 gene revealed an enhancer that enables Lhfpl5 gene expression specifically in the inner ear. The nucleotide sequence is shown in SEQ ID No. 1:

[0025] GCAGACCCGATTCTCAGTCTGACACCCCGGCCACTCACCTGGCCTGAGTTCTCCCC

[0026] AGAGGTCTGTTTCCAAGCCTTAGTGGGCAGGAGGGGACAACAGGCCATGATGATCA

[0027] TATCAGGAAGAGGCAGTGGAGATTGAGTCCAAAGAGTAGTGAGATGGCTGTGCTTG

[0028] CCAGCTGTTCTTCCACCGCAGGGCTCGGGATGATGTGGAGACACACCATCCTTTCTT

[0029] AGAGCTTTCTGCCCACCTCCAGCATCATCCAATAGGTGTGCTTGCTGAGCAGGCAAT

[0030] AGAAATGAGACCTGGGTGGAGGAACACCAGGCCATTTGAGCCAGACGCTATTCTGGG

[0031] TCACAGAGCCGGTAGCAGAGATGGCTAAGTGCCATCCCATGAAGCATTTATGTGGAG

[0032] CAAAGAAAAAGGTGGTGCCATGTTCCACTCTGTGTCAGGGAGGAGAGGGCTGAAC

[0033] AGGTGTTTCTCATAGCCATCAACTGGGGGATTCATGTGTCAGCTCAAAAATTTCCAC

[0034] AAAGCCAGAGGATGGGGGTAGGAGAAGAGAACTGATGCCCCTGCAAAGGTGGCGG

[0035] CACTCAGATGGAGCTCAGGGTGCAGGCTGAGCATGGGCTCAGTTGTTTTCCCTGAG

[0036] TCTTGGTAACCTCCTGCCTTAGTGAGACTGTATTATTATCCAAATTCCCATACATGAAG

[0037] GAGCCTAGACAACAGGCATTTCTTC

[0038] According to genomic location, the enhancer shown in SEQ ID No. 1 is located in the intron of the Lhfpl5 gene, and it is determined that the enhancer is the Lhfpl5 gene enhancer.

[0039] 2. Verification of Enhanced Target Gene Expression

[0040] 1. Method

[0041] (1) The Hsp68 promoter (vector PCR4-Hsp68::lacZ-H11 from Addgene, Plasmid #139099) sequence was cloned upstream of the reporter gene EGFP, and the activity of the enhancer was tested by detecting the expression of the EGFP gene. The pWHERE vector, EGFP gene, and Hsp68 promoter sequence were connected by Qingke Biotechnology Co., Ltd. The successfully connected vector was named pWHERE-promoter vector, in which the nucleotide sequence of the reporter gene EGFP (SEQ ID No. 2) is: ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGA GCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGAT CCGCCACAACATCGAGGACGGCAGTGCAGCTCGCCGACCACTACCAGCAGAACCCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTAA

[0042] (2) DNA was extracted from the inner ear tissue of mice and the Lhfpl5 gene enhancer sequence (shown in SEQ ID No. 1, sequence length 703 bp) was amplified;

[0043] The primer pairs used for PCR amplification of the Lhfpl5 gene enhancer region are as follows:

[0044] Lhfpl5-F: 5'-CGCGGATCCGCAGACCCGATTCTCAGTCT-3' (SEQ ID No. 3) Lhfpl5-R: 5'-CCGCTCGAGCCTGTTGTCTAGGCTCCTTCA-3' (SEQ ID No. 4).

[0045] (3) The enhancer sequence was transferred into the pWHERE-promoter vector using the BamHI and XhoI restriction sites. The constructed plasmid is shown in Figure 1 .

[0046] (4) Prepare linearized transgenic DNA: Use the restriction endonuclease PacI to cut the plasmid and linearize the exogenous DNA from the vector. Then purify the exogenous DNA to remove impurities and enzymes. Finally, dissolve the purified DNA in TE buffer and adjust the concentration to 1-2 ng / μL. Store at 4°C until use.

[0047] (5) Obtaining fertilized mouse eggs: Select healthy, age-appropriate female mice (usually 3-4 weeks old) and perform superovulation. 12-14 hours after superovulation, mate these female mice with healthy, sexually mature male mice. The next morning, dissect the female mice and collect the fertilized eggs from their oviducts.

[0048] (6) Microinjection of exogenous DNA: The collected fertilized eggs are placed in a culture medium containing HEPES buffer, and the DNA solution is injected directly into the fertilized eggs using a microinjection needle. After the injection is completed, the fertilized eggs are transferred to a culture dish containing an appropriate culture medium and continue to incubate. They are implanted into the oviduct of a pseudopregnant mouse. Usually, 10-20 fertilized eggs are implanted into each mouse. After the transplantation is completed, the mouse is raised alone and its pregnancy status is observed. At the same time, a control is set up, that is, exogenous DNA linearized with the pWHERE-promoter vector without the Lhfpl5 gene enhancer sequence is microinjected in the same way as a control.

[0049] (7) Identification of transgenic mice: After successful embryo transplantation, wait for the required period to take out the mouse embryo for testing. Cut off the head of the mouse embryo, open the skull, remove the brain tissue, expose the temporal bone and remove the cochlea. After the cochlea is removed, move it into a culture dish containing pre-cooled 1XPBS; under a dissecting microscope, use a sharp needle to pick open the bone wall of the volute at the apex of the cochlea, and then peel the volute along the gap between the spiral ligament and the volute until the complete spiral ligament is fully exposed; then use a sharp needle or tweezers to separate and remove the entire spiral ligament, and immediately transfer it to a 2ml centrifuge tube containing 4% paraformaldehyde and fix it at 4℃ for 30 minutes. After 30 minutes, remove the spiral ligament under a dissecting microscope, and spread the entire cochlear basement membrane flatly on a slide, add DAPI and seal the slide. Finally, under a fluorescence microscope, select the DAPI fluorescence channel to observe the nuclear signal of the basement membrane, the 488nm laser excitation channel to observe the EGFP signal, and take pictures of the entire complete basement membrane, the top, middle and base of the basement membrane.

[0050] 2. Results

[0051] according to Figure 2 It can be seen that in embryos injected with Lhfpl5 gene enhancer-EGFP, the inner and outer hair cells of the cochlea showed green fluorescence ( Figure 2 B) In embryos injected with exogenous genes without the Lhfpl5 gene enhancer sequence, there is no fluorescent signal in the inner and outer hair cells of the cochlea ( Figure 2 A) This indicates that the EGFP gene can be specifically expressed in inner and outer hair cells under the action of the Lhfpl5 enhancer, but cannot be specifically expressed in inner and outer hair cells without the action of the Lhfpl5 gene enhancer.

[0052] The experimental results show that the Lhfpl5 gene enhancer can specifically enhance the expression of the EGFP gene in inner and outer hair cells, which is consistent with the expression characteristics of Lhfpl5 in existing literature, verifying that the enhancer is the Lhfpl5 gene enhancer.

[0053] In summary, the present invention identifies the enhancer shown in SEQ ID No. 1 as the Lhfpl5 gene enhancer. This enhancer can significantly enhance the expression of the Lhfpl5 gene itself or other genes in the inner and outer hair cells of the inner ear. Utilizing its ability to specifically enhance gene expression in the inner and outer hair cells of the inner ear, it can be used for gene therapy for deafness. It can also be integrated into recombinant DNA, vectors, or other biomaterials containing the Lhfpl5 gene enhancer for research on gene expression regulation, and has good application prospects.

Claims

1. An Lhfpl5 gene enhancer, characterized in that: The nucleotide sequence of the enhancer is shown in SEQ ID No.

1.

2. A recombinant vector, characterized in that: The plasmid contains an enhancer and a target gene as shown in the nucleotide sequence of SEQ ID No.

1.

3. The recombinant vector according to claim 2, characterized in that: The target gene is the Lhfpl5 gene and / or the reporter gene EGFP.

4. The recombinant vector according to claim 2 or 3, characterized in that: The plasmid is a pWHERE vector plasmid vector.

5. Use of the recombinant vector according to claim 2 in the preparation of a medicament for treating deafness, characterized in that: The target gene is the Lhfpl5 gene.

Images