Bombyx mori fat body specific expression promoter SP4, cloning method and application thereof

Abstract

The invention discloses a bombyx mori fat body specific expression promoter SP4, a cloning method and application of the bombyx mori fat body specific expression promoter SP4, the nucleotide sequence of the promoter SP4 is shown as SEQ ID NO.1, and the promoter SP4 is derived from a bombyx mori BMSK0001308 gene. Compared with the prior art, the bombyx mori fat body specific expression promoter SP4 and the transgenic recombinant vector thereof are obtained through cloning, and both the promoter and the recombinant vector can achieve specific efficient expression of exogenous genes in bombyx mori fat body tissue; and (2) the promoter and the recombinant vector thereof have extremely high transcription efficiency, and a powerful tool is provided for using the silkworm fat body as a bioreactor.

Description

Technical Field

[0001] The invention belongs to the field of genetic engineering, and relates to a silkworm transgenic expression system, in particular to a silkworm fat body specific expression promoter SP4, a cloning method and an application thereof. Background Art

[0002] The fat body of the silkworm (Bombyx mori) is not only a key tissue with a wide distribution and significant content in the body, but also a core storage depot for nutrition and energy. The efficient protein synthesis mechanism inside the silkworm fat body, especially in the production and release of storage proteins, lipoproteins and vitellogenins, shows a high degree of sex and developmental stage specificity. These proteins are released in a specific pattern and accumulated in the hemolymph, regulating the physiological state of the silkworm. Given the core position of the silkworm fat body in protein synthesis and regulation, it has become an ideal model tissue for exploring the metamorphosis mechanism of the silkworm and the developmental regulation of gene expression. In addition, the excellent protein synthesis and storage capacity of the silkworm fat body indicates its great potential as a new type of bioreactor, which is expected to be used to produce high-value recombinant proteins and open up new application paths in the field of biotechnology.

[0003] In order to realize the application of fat body as bioreactor, the first task is to isolate and identify specific fat body promoters to drive the efficient expression of target genes in a specific time and space. Although there are many studies on the functions of silkworm fat body and its expressed genes, there are few studies on the identification of silkworm fat body specific expression promoters. Deng Dangjun et al. successfully constructed fat body full-stage specific expression vectors such as BmLSP and BmLP3 using the piggyBac system, which provided an important reference for the research of fat body bioreactors.

[0004] Recently, a new silkworm aromatic storage protein gene was discovered through preliminary research. This gene shows a high-level specific expression pattern in the fat body of silkworms. This indicates that the gene promoter has a very strong transcription efficiency. Therefore, relying on the transgenic expression system, the efficient expression of foreign proteins in the fat body of silkworms can be achieved, thereby improving the economic value of silkworms. This discovery provides a new possibility for the production of foreign proteins using the fat body of silkworms. Summary of the invention

[0005] Technical problem to be solved: obtaining a silkworm fat body-specific expression promoter to achieve specific expression of exogenous genes in the silkworm fat body tissue, thereby utilizing the silkworm fat body as a bioreactor; in view of this, the present invention provides a silkworm fat body-specific expression promoter SP4, a cloning method and its application.

[0006]

[0007] Preferably, the specific amplification primers for the promoter SP4 are: upstream primer SP4-F, the sequence of which is SEQ ID NO.2; downstream primer SP4-R, the sequence of which is SEQ ID NO.3. The specific sequences are:

[0008] SP4-F (SEQ ID NO. 2): GCGTCGACGCTTCTCCGGTTACGTACAACT;

[0009] SP4-R (SEQ ID NO. 3): CGCGGATCCGCCCCGTAAAGAGAGTCCAG.

[0010] The above-mentioned method for cloning the silkworm fat body-specific expression promoter SP4 comprises the following steps:

[0011] S1. Combined with the RNA-seq expression data from SilkDB3.0 database, the BMSK0001308 gene with high expression in the fat body of silkworm was screened;

[0012] S2. A 2000 bp fragment upstream of the transcription start site of the BMSK0001308 gene was intercepted from the SilkDB3.0 database, and promoter prediction analysis was performed using the online promoter position prediction software BDGP: Neural Network Promoter Prediction (fruitfly.org). A core promoter region with a score of 0.94 was obtained at 311-361 bp. Primers were designed based on this for PCR amplification, with the upstream primer being SP4-F and the downstream primer being SP4-R; the sequence shown in SEQ ID NO.1 was obtained.

[0013] The vector of the silkworm fat body-specific expression promoter SP4 described above.

[0014] Preferably, the method comprises the following steps:

[0015] S3, the PCR product of S2 is recovered by enzyme digestion and connected with the vector carrying the target gene to construct an intermediate vector; the intermediate vector is digested with AscⅠ, and the fragment containing the specific promoter and the target gene is recovered by electrophoresis separation; the basic backbone vector is digested with AscⅠ, and the linear backbone vector is recovered and dephosphorylated to obtain the linear backbone vector; the fragment containing the specific promoter and the target gene is then connected with the linear backbone vector to obtain the recombinant vector.

[0016] Preferably, the intermediate vector carrying the target gene is SP4-target gene-SV40-1180, and the basic backbone vector is pBac[3×P3-EGFP].

[0017] The above-mentioned application of the silkworm fat body-specific expression promoter SP4 in constructing a silkworm bioreactor.

[0018] Application of the above-mentioned carrier in constructing silkworm bioreactor.

[0019] Beneficial effects: (1) The present invention cloned the silkworm fat body-specific expression promoter SP4 and its transgenic recombinant vector, both of which can achieve specific and efficient expression of exogenous genes in the silkworm fat body tissue; (2) The promoter and its recombinant vector have extremely strong transcription efficiency, providing a powerful tool for using the silkworm fat body as a bioreactor. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 1 is a fluorescence observation diagram of the DsRed transgenic system mediated by promoter SP4 in Example 2, wherein A and B are the results observed under white light, C and D are the results observed under RFP excitation light, A and C are wild-type silkworms, and B and D are transgenic silkworms;

[0021] Figure 2 This is the DsRed tissue expression profile of the SP4 transgenic system in Example 2, where 1 is the midgut, 2 is the ovary, and 3 is the fat body. DETAILED DESCRIPTION

[0022] The following examples further illustrate the content of the present invention, but should not be construed as limiting the present invention. Without departing from the spirit and essence of the present invention, modifications and substitutions made to the method, steps or conditions of the present invention all belong to the scope of the present invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art.

[0023] Example 1

[0024] In this embodiment, the exogenous red fluorescent protein gene DsRed is taken as an example as the target gene, and the specific construction method is as follows:

[0025] 1. Obtaining the silkworm fat body-specific promoter

[0026] (1) According to SilkDB3.0 genome database ( https: / / silkdb.bioinfotoolkits.net / main / species-info / -1) was used to search for the silkworm fat body-specific expression gene BMSK0001308, and the 2000bp fragment upstream of the transcription start site of the gene was intercepted. The non-coding region at the 5' end of the gene was analyzed by the promoter online prediction software BDGP: Neural Network Promoter Prediction (https: / / www.fruitfly.org / seq_tools / promoter.html), and the core promoter region with a score of 0.94 was obtained at 311-361bp. Primers were designed based on this for PCR amplification, with the upstream primer being SP4-F and the downstream primer being SP4-R; the sequence shown in SEQ ID NO.1 was obtained. The primer sequence is:

[0027] SP4-F (SEQ ID NO. 2): GC GTCGAC GCTTCTCCGGTTACGTACAACT, the underlined part is the SalⅠ restriction site;

[0028] SP4-R (SEQ ID NO. 3): CGC GGATCC GCCCCGTAAAGAGAGTCCAG, the underlined part is the BamHⅠ restriction site.

[0029] The above primers were synthesized by Sangon Biotechnology (Shanghai) Co., Ltd.

[0030] (2) The silkworm variety Dazao was used as the test material, and the silkworm genomic DNA was extracted. The genomic DNA was used as a template, and SP4-F and SP4-R were used as the upstream and downstream primers of the SP4 promoter for PCR amplification. The PCR reaction conditions were: 95°C pre-denaturation for 5 min, 95°C denaturation for 40 s, 58°C annealing for 30 s, 72°C extension for 1 min, a total of 30 cycles, and finally 72°C extension for 10 min. The PCR product was identified by 1% agarose gel electrophoresis, and the target fragment SP4 was recovered. The fragment had the nucleotide sequence shown in SEQ ID NO.1.

[0031] 2. Construction of SP4-DsRed-SV40-1180 vector

[0032] The DsRed-SV40-1180 vector plasmid and SP4 were digested with restriction endonucleases SalⅠ and BamHⅠ, respectively. The DsRed-SV40-1180 linear vector and SP4 digested fragment were identified and recovered by agarose gel electrophoresis, respectively. The DsRed-SV40-1180 linear vector and SP4 digested fragment were connected. The ligation reaction was carried out under the action of T4 DNA ligase at 16°C overnight to obtain an intermediate vector of the fat body-specific promoter, referred to as SP4-DsRed-SV40-1180.

[0033] 3. Construction of a recombinant vector with a fat body-specific promoter

[0034] The intermediate vector SP4-DsRed-SV40-1180 of the silkworm fat body period specific promoter was digested with restriction endonuclease AscⅠ, and the target fragment was separated and recovered by agarose gel electrophoresis to obtain the SP4-DsRed-SV40 fragment. At the same time, the pBac[3×P3-EGFP] vector was digested with restriction endonuclease AscⅠ and dephosphorylated to obtain the pBac[3×P3-EGFP] linear vector. The SP4-DsRed-SV40 fragment and the pBac[3×P3-EGFP] linear vector were connected. The ligation reaction was carried out under the action of T4 DNA ligase at 16°C overnight to obtain the transgenic vector pBac[3×P3-EGFP-SP4-DsRed-SV40] of the fat body specific promoter.

[0035] Example 2

[0036] The function of the transgenic vector pBac[3×P3-EGFP-SP4-DsRed-SV40] of the fat body-specific promoter constructed in Example 1 was verified by the following method:

[0037] 1. Transgenic microinjection and screening of positive individuals

[0038] (1) The silkworm eggs of the silkworm variety Dazao were placed in a dark environment at 25°C and 75% humidity for about 10 days until they hatched. The queens were collected and raised in a standard environment until they emerged as moths. After mating for 4 hours, the non-diapause eggs produced by the male and female moths were used for the next injection.

[0039] (2) The extracted SP4 recombinant gene vector plasmid containing the nucleotide sequence shown in SEQ ID NO.1 and the auxiliary plasmid A3 Helper were uniformly mixed in equal amounts; the mixed plasmid was injected into non-diapause silkworm eggs using a microinjector, and the injection port was sealed with non-toxic glue and placed in an environment of 25°C and 75% humidity to accelerate the hatching; the hatched G0 generation silkworms were raised with mulberry leaves under standard conditions until they emerged as moths; the G0 generation silkworms were self-pollinated or back-crossed to obtain a total of 18 moth circles of G1 generation silkworm eggs; the G1 generation embryos were observed using a Leica fluorescence microscope, and 4 positive moth circles were screened and obtained, i.e., the transgenic silkworms in which the fat body-specific promoter drove the red fluorescence expression were obtained, referred to as the SP4 transgenic system.

[0040] 2. Fluorescence Observation and Molecular Detection of Transgenic Systems

[0041] (1) The positive moth circles were reared in single moth circles and subcultured to obtain four SP4 transgenic systems. Two transgenic systems were randomly selected and fluorescence observation was performed at the mature silkworm stage. The results are as follows: Figure 1 As shown, the transgenic system has red fluorescence in the fat body of silkworm, while the fat of wild-type silkworm has no red fluorescence, indicating that the nucleotide sequence shown in SEQ ID NO.1 can successfully mediate the specific expression of the exogenous gene DsRed in the fat body of silkworm.

[0042] (2) The fat body, midgut and ovary tissues of the transgenic silkworm were used to construct the tissue expression profile of the exogenous gene DsRed. According to the DsRed gene sequence, the detection primers were designed. The upstream primer was DsRed-F (SEQ ID NO.4): 5'-GATTCCGAATATCGCGATGGTGCGCTCCTCCAAGAACG-3', and the downstream primer sequence was DsRed-R (SEQ ID NO.5): 5'-CTAGGCGCGCCGTACGCGTATCG-3'. RNA was extracted from the fat body, midgut and ovary tissues of the silkworm, respectively, and reverse transcription was performed using a reverse transcription amplification kit to obtain cDNA from each tissue. The BmGAPDH gene was used as an internal reference. The upstream primer of the internal reference gene was BmGAPDH-F (SEQ ID NO.6): GGTGCTCCGTGCTTCTATTGA, and the downstream primer was BmGAPDH-R (SEQ ID NO.7): CTGCCTCCTTGACCTTTTGCT. RT-PCR detection was performed. The results are as follows. Figure 2 As shown, the expression of DsRed was detected in the fat body of the transgenic silkworm, but not in the midgut and ovary, confirming that SP4 is a fat body-specific promoter.

Claims

1. The silkworm fat body specific expression promoter SP4 is characterized by: The nucleotide sequence of the promoter SP4 is shown in SEQ ID NO.1, which is derived from the silkworm BMSK0001308 gene.

2. The silkworm fat body-specific expression promoter SP4 according to claim 1, characterized in that: The specific amplification primers of the promoter SP4 are: upstream primer SP4-F, the sequence of which is SEQ ID NO.2; downstream primer SP4-R, the sequence of which is SEQ ID NO.

3.

3. The method for cloning the silkworm fat body-specific expression promoter SP4 according to claim 1 or 2, characterized in that: The method comprises the following steps: S1. Combined with the RNA-seq expression data from SilkDB3.0 database, the BMSK0001308 gene with high expression in the fat body of silkworm was screened; S2. A 2000 bp fragment upstream of the transcription start site of the BMSK0001308 gene was intercepted from the SilkDB3.0 database, and promoter prediction analysis was performed using the online promoter position prediction software BDGP: Neural Network Promoter Prediction (fruitfly.org). A core promoter region with a score of 0.94 was obtained at 311-361 bp. Primers were designed based on this for PCR amplification, with the upstream primer being SP4-F and the downstream primer being SP4-R; the sequence shown in SEQ ID NO.1 was obtained.

4. A vector containing the silkworm fat body-specific expression promoter SP4 according to claim 1 or 2.

5. The method for constructing the vector according to claim 4, characterized in that: The method comprises the following steps: S3, the PCR product of S2 is recovered by enzyme digestion and connected with the vector carrying the target gene to construct an intermediate vector; the intermediate vector is digested with AscⅠ, and the fragment containing the specific promoter and the target gene is recovered by electrophoresis separation; the basic backbone vector is digested with AscⅠ, and the linear backbone vector is recovered and dephosphorylated to obtain the linear backbone vector; the fragment containing the specific promoter and the target gene is then connected with the linear backbone vector to obtain the recombinant vector.

6. The construction method according to claim 5, characterized in that: The intermediate vector carrying the target gene is SP4-target gene-SV40-1180, and the basic backbone vector is pBac[3×P3-EGFP].

7. Use of the silkworm fat body-specific expression promoter SP4 according to claim 1 or 2 in constructing a silkworm bioreactor.

8. Use of the carrier according to claim 4 in constructing a silkworm bioreactor.

Images