Gene SlSGR1 and SlLCY-B1 capable of bidirectionally regulating lycopene content in plant and application of gene SlSGR1 and SlLCY-B1

Abstract

The invention provides genes SlSGR1 and SlLCY-B1 for bidirectionally regulating and controlling the content of lycopene in plants and application of the genes SlSGR1 and SlLCY-B1, and relates to the technical field of biology, in particular to application of SlSGR1 protein or related biological materials of the SlSGR1 protein and SlLCY-B1 protein or related biological materials of the SlLCY-B1 protein in regulating and controlling the content of lycopene in the plants. The SlSGR1 protein and the SlLCY-B1 protein are regulated and controlled to be inactivated through gene editing, the SlPSS1 activity is improved to promote synthesis, and the SlLCY-B1 is inactivated to prevent metabolism. The SlPSI1 and the SlLCY1 interact with each other through PDS, ZDS and CRTISO, so that the content of lycopene is increased. Experiments prove that expression and gene editing of the SlPSI1 and the SlLCY-B1 in fruits do not affect functions of other genes of the family in parts such as stems and leaves. And a new way is created for establishing efficient and safe high-lycopene germplasm.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, in particular to genes SlSGR1 and SlLCY-B1 for bidirectionally regulating the lycopene content in plants and applications thereof. Background Art

[0002] Lycopene is a functional natural pigment with the strongest antioxidant capacity among various carotenoids. It can help human cells avoid damage by oxygen free radicals and protect biological membranes. It plays an important role in improving human immunity, delaying cell aging and preventing cancer. The human body cannot synthesize lycopene on its own and can only be taken in through diet. Lycopene has been widely used in food, beverages, health products, cosmetics and other fields, and has huge market demand.

[0003] Improving lycopene content has been a hot topic in tomato quality breeding at home and abroad in recent years. Some progress has been made in improving tomato quality using conventional breeding methods, but the required cycle is long and is easily restricted by undesirable gene linkage and interspecific reproductive isolation. In recent years, with the development of molecular biology and molecular genetics, a deeper understanding of the synthesis and metabolic pathways of plant lycopene and its related enzymes has been achieved.

[0004] The lycopene content of the processing tomato varieties currently grown is generally 8-12 mg / 100g. The creation of high lycopene germplasm or varieties is of great significance for the cultivation and processing of processing tomatoes and the extension of their processing industry chain. Increasing the lycopene content can be achieved by increasing synthesis or reducing metabolism. Phytoene synthase PSY1 is the first rate-limiting enzyme in the lycopene synthesis pathway, catalyzing the polymerization of two GGPP molecules into phytoene. Increasing the activity of PSY1 is beneficial to the synthesis of lycopene. The SlSGR1 protein of tomatoes can inhibit the activity of SlPSY1 and reduce the synthesis of lycopene; silencing the tomato SlSGR1 gene can increase the activity of SlPSY1. Lycopene metabolites, such as α-carotene, β-carotene and abscisic acid, are involved in the growth and stress response of tomatoes. Completely blocking lycopene metabolism may have an adverse effect on the normal physiological activities of the plant. SlLCY-B activates lycopene to enter the α- or β-metabolism pathway and is a key enzyme in lycopene metabolism, encoded by a gene family. SlLCY-B1 is located on chromosome 4 and is expressed in the fruit; SlLCY-B2 is located on chromosome 2 and is specifically expressed in green tissues. The synthesis of lycopene is controlled by multiple genes, some of which are encoded by gene families. The expression of each family member, such as the expression site, expression time, and expression level, is different, and the expression product often has multiple functions. It is a great challenge to regulate the synthesis of lycopene only in the fruit without affecting the expression pattern in other parts and maintaining the normal growth and development of the plant.

[0005] As a new gene manipulation technology, gene editing has been studied more on model plants such as Arabidopsis and corn, but relatively less on processing tomatoes. It is rare to edit genes that regulate different traits simultaneously.

[0006] In view of this, the present invention is proposed. Summary of the invention

[0007] One of the objectives of the present invention is to provide an application of SlSGR1 protein or related biological materials of the SlSGR1 protein and SlLCY-B1 protein or related biological materials of the SlLCY-B1 protein in regulating the lycopene content in plants, so as to solve the technical problem that the prior art lacks related proteins that can bidirectionally regulate and increase the lycopene content in plants.

[0008] A second object of the present invention is to provide a method for bidirectionally regulating the lycopene content in plants.

[0009] The third object of the present invention is to provide application of the above method in preparing products for regulating the lycopene content in plants.

[0010] In order to achieve the above-mentioned purpose of the present invention, the following technical solutions are particularly adopted:

[0011] In a first aspect, the present invention provides the following uses of (a) to (d) in regulating the lycopene content in plants:

[0012] (a) SlSGR1 protein;

[0013] (b) biological materials related to SlSGR1 protein;

[0014] (c) S1LCY-B1 protein;

[0015] (d) biological materials related to S1LCY-B1 protein;

[0016] The nucleotide sequence of the SlSGR1 protein is shown in SEQ ID NO:23, and the nucleotide sequence of the SlLCY-B1 protein is shown in SEQ ID NO:24.

[0017] Furthermore, the expression level and / or activity of the SlSGR1 protein and the SlLCY-B1 protein in the plant is reduced, and the lycopene content of the tomato is increased.

[0018] Furthermore, the biological material related to the SlSGR1 protein is a nucleic acid molecule capable of inhibiting or reducing the expression of the gene encoding the SlSGR1 protein, or an expression cassette, a recombinant vector, a recombinant microorganism or a transgenic cell line containing the nucleic acid molecule;

[0019] The biological material related to the S1LCY-B1 protein is a nucleic acid molecule capable of inhibiting or reducing the expression of the gene encoding the S1LCY-B1 protein, or an expression cassette, a recombinant vector, a recombinant microorganism or a transgenic cell line containing the nucleic acid molecule.

[0020] In a second aspect, the present invention provides a method for bidirectionally regulating the lycopene content in plants, comprising simultaneously inhibiting or reducing the expression level and / or activity of SlSGR1 protein and SlLCY-B1 protein to increase the lycopene content in plants; the nucleotide sequence of the SlSGR1 protein is shown in SEQ ID NO:23, and the nucleotide sequence of the SlLCY-B1 protein is shown in SEQ ID NO:24.

[0021] Furthermore, it includes introducing substances that inhibit or reduce the expression of genes encoding SlSGR1 protein and SlLCY-B1 protein into plants.

[0022] Furthermore, the substance that inhibits or reduces the expression of the gene encoding SlSGR1 protein and SlLCY-B1 protein includes a nucleic acid molecule that inhibits or reduces the expression of the gene encoding SlSGR1 protein and a nucleic acid molecule that inhibits or reduces the expression of the gene encoding SlLCY-B1 protein, or an expression cassette, a recombinant vector, a recombinant microorganism or a transgenic cell line containing the nucleic acid molecule.

[0023] Further, the nucleic acid molecule that inhibits or reduces the expression of the SlSGR1 protein encoding gene is a CRISPR / Cas9 editing tool that targets the SlSGR1 protein encoding gene;

[0024] The nucleic acid molecule that inhibits or reduces the expression of the S1LCY-B1 protein encoding gene is a CRISPR / Cas9 editing tool that targets the S1LCY-B1 protein encoding gene.

[0025] Furthermore, the target sequence targeting the SlSGR1 protein encoding gene is shown in SEQ ID NO: 1 and SEQ ID NO: 2;

[0026] The target sequence of the gRNA targeting the S1LCY-B1 protein encoding gene is shown in SEQ ID NO:3 and SEQ ID NO:4.

[0027] In a third aspect, the present invention provides application of the above method in preparing a product for regulating the lycopene content in plants.

[0028] Furthermore, the plant is tomato.

[0029] The present invention provides an application of the SlSGR1 protein or a biological material related to the SlSGR1 protein and the SlLCY-B1 protein or a biological material related to the SlLCY-B1 protein in regulating the lycopene content in plants. The SlSGR1 protein and the SlLCY-B1 protein are inactivated by gene editing, the activity of SlPSY1 is increased to promote synthesis, and the inactivation of SlLCY-B1 prevents metabolism. The protein interaction network is analyzed using the STRING online tool, and the results show that PSY1 can interact with phytoene dehydrogenase PDS, ζ-carotene dehydrogenase ZDS and carotenoid isomerase CRTISO, and phytoene dehydrogenase PDS, ζ-carotene dehydrogenase ZDS and carotenoid isomerase CRTISO are also interacting proteins of SlLCY1, so SlPSY1 and SlLCY1 interact through PDS, ZDS and CRTISO to increase the lycopene content. Experiments have shown that SlPSY1 and SlLCY-B1 are expressed in fruits, and gene editing does not affect the functions of other genes in the family in stems and leaves, etc. This is a new way to create efficient, safe and high-lycopene germplasm. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] In order to more clearly illustrate the specific implementation methods of the present invention or the technical solutions in the prior art, the drawings required for use in the specific implementation methods or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some implementation methods of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0031] Figure 1 A coordinate diagram of the coding region of the sgRNA target site of SlSGR1 provided in Example 1 of the present invention;

[0032] Figure 2 A coordinate diagram of the coding region of the sgRNA target site of S1LCY-B1 provided in Example 1 of the present invention;

[0033] Figure 3 A map of the double gene plant expression vector provided in Example 2 of the present invention;

[0034] Figure 4 The electrophoresis diagram of the PCR amplification product of the T0 generation regenerated positive plant provided in Example 3 of the present invention;

[0035] Figure 5 A diagram showing mutation types of the double-gene-edited high-lycopene mutant plant provided in Example 4 of the present invention;

[0036] Figure 6 A diagram showing mutation types of the S1LCY-B1 single gene edited plant provided in Example 4 of the present invention;

[0037] Figure 7 A diagram showing mutation types of SlSGR1 single gene-edited plants provided in Example 4 of the present invention;

[0038] Figure 8 This is a comparison chart of the appearance of fruits of different gene-edited plants provided in Example 4 of the present invention. DETAILED DESCRIPTION

[0039] Unless otherwise defined herein, scientific and technical terms used in conjunction with the present invention shall have the meanings commonly understood by those of ordinary skill in the art. The meaning and scope of the terms should be clear, however, in the case of any potential ambiguity, the definitions provided herein take precedence over any dictionary or external definitions. In this application, unless otherwise stated, the use of "or" means "and / or". In addition, the use of the term "including" and other forms is non-limiting.

[0040] The methods and techniques of the present invention are generally performed according to conventional methods well known in the art and as described in various general and more specific references that are cited and discussed throughout the present specification unless otherwise indicated.

[0041] In one aspect, the present invention provides the following uses of (a) to (d) in regulating the lycopene content in plants:

[0042] (a) SlSGR1 protein;

[0043] (b) biological materials related to SlSGR1 protein;

[0044] (c) S1LCY-B1 protein;

[0045] (d) biological materials related to S1LCY-B1 protein;

[0046] The nucleotide sequence of the SlSGR1 protein is shown in SEQ ID NO:23, and the nucleotide sequence of the SlLCY-B1 protein is shown in SEQ ID NO:24.

[0047] The present invention inactivates the regulating SlSGR1 protein and SlLCY-B1 protein through gene editing, improves the activity of SlPSY1 to promote synthesis, and inactivates SlLCY-B1 to prevent metabolism. The protein interaction network was analyzed using the STRING online tool. The results showed that SlPSY1 can interact with phytoene dehydrogenase PDS, ζ-carotene dehydrogenase ZDS and carotenoid isomerase CRTISO, and phytoene dehydrogenase PDS, ζ-carotene dehydrogenase ZDS and carotenoid isomerase CRTISO are also interacting proteins of SlLCY1. Therefore, SlPSY1 and SlLCY1 interact through PDS, ZDS and CRTISO to increase the content of lycopene. Experiments have shown that SlPSY1 and SlLCY-B1 are expressed in fruits, and gene editing does not affect the functions of other genes in the family in stems, leaves and other parts. It is a new way to create efficient and safe high-lycopene germplasm.

[0048] In some specific embodiments, the expression amount and / or activity of the S1SGR1 protein and the S1LCY-B1 protein in the plant is reduced, and the lycopene content of the tomato is increased. The S1SGR1 protein and the S1LCY-B1 protein are inactivated, and the activity of S1PSY1 is increased. S1PSY1 is the first rate-limiting enzyme in the lycopene synthesis pathway, which is beneficial to the synthesis of lycopene. The inactivation of S1LCY-B1 does not affect the function of S1LCY-B2, which will inhibit the metabolism of lycopene in the fruit and facilitate the accumulation of lycopene. At the same time, it does not affect the normal generation of lycopene metabolites in other parts.

[0049] In some specific embodiments, the related biological material of the SlSGR1 protein is a nucleic acid molecule capable of inhibiting or reducing the expression of the gene encoding the SlSGR1 protein, or an expression cassette, recombinant vector, recombinant microorganism or transgenic cell line containing the nucleic acid molecule; the related biological material of the SlLCY-B1 protein is a nucleic acid molecule capable of inhibiting or reducing the expression of the gene encoding the SlLCY-B1 protein, or an expression cassette, recombinant vector, recombinant microorganism or transgenic cell line containing the nucleic acid molecule.

[0050] Wherein, expression cassette refers to DNA capable of expressing the above-mentioned protein in host cells, and the DNA may include not only a promoter for initiating transcription of protein-coding genes, but also a terminator for terminating transcription of protein-coding genes. Further, the expression cassette may also include an enhancer sequence. Promoters that can be used in the present invention include, but are not limited to, constitutive promoters, tissue, organ and development-specific promoters, and inducible promoters. Existing plant expression vectors can be used to construct a recombinant expression vector containing the above-mentioned protein-coding gene expression cassette. The recombinant microorganism may specifically be yeast, bacteria, algae and fungi.

[0051] According to another aspect of the present invention, a method for bidirectionally regulating the lycopene content in plants is provided, comprising simultaneously inhibiting or reducing the expression level and / or activity of SlSGR1 protein and SlLCY-B1 protein to increase the lycopene content in plants; the nucleotide sequence of the SlSGR1 protein is shown in SEQ ID NO:23, and the nucleotide sequence of the SlLCY-B1 protein is shown in SEQ ID NO:24.

[0052] Wherein, the inhibition or reduction of the expression amount and / or activity of S1SGR1 protein and S1LCY-B1 protein can be achieved by gene knockout or gene silencing. Gene knockout refers to the phenomenon of inactivating a specific target gene by homologous recombination, that is, inactivating a specific target gene by changing the DNA sequence. Gene silencing refers to the phenomenon of not expressing or under-expressing a gene without damaging the original DNA. Gene silencing is based on the premise of not changing the DNA sequence to make the gene not expressed or under-expressed.

[0053] The CRISPR-Cas9 system was used to inactivate SlSGR1 and SlLCY-B1, thereby bidirectionally regulating lycopene content, providing a new approach for improving tomato germplasm and increasing economic benefits.

[0054] In some specific embodiments, it includes introducing into the plant a substance that inhibits or reduces the expression of genes encoding S1SGR1 protein and S1LCY-B1 protein.

[0055] In some specific embodiments, the substance that inhibits or reduces the expression of the gene encoding the SlSGR1 protein and the SlLCY-B1 protein includes a nucleic acid molecule that inhibits or reduces the expression of the gene encoding the SlSGR1 protein and a nucleic acid molecule that inhibits or reduces the expression of the gene encoding the SlLCY-B1 protein, or an expression cassette, a recombinant vector, a recombinant microorganism or a transgenic cell line containing the nucleic acid molecule.

[0056] In some specific embodiments, the nucleic acid molecule that inhibits or reduces the expression of the SlSGR1 protein-encoding gene is a CRISPR / Cas9 editing tool targeting the SlSGR1 protein-encoding gene; the nucleic acid molecule that inhibits or reduces the expression of the SlLCY-B1 protein-encoding gene is a CRISPR / Cas9 editing tool targeting the SlLCY-B1 protein-encoding gene.

[0057] The CRISPR-Cas9 system was used to inactivate SlSGR1 and SlLCY-B1. The inactivation of SlSGR1 increased the activity of SlPSY1 and promoted synthesis, while the inactivation of SlLCY-B1 prevented metabolism, thus bidirectionally regulating the lycopene content. Taking advantage of the separation of gene integration sites and editing sites, self-pollination was used to remove T-DNA and avoid transgenic safety issues.

[0058] In some specific embodiments, the target sequence targeting the SlSGR1 protein encoding gene is shown in SEQ ID NO: 1 and SEQ ID NO: 2;

[0059] The target sequence of the gRNA targeting the LCY-B1 protein encoding gene is shown in SEQ ID NO:3 and SEQ ID NO:4.

[0060] According to another aspect of the present invention, there is also provided application of the above method in preparing a product for regulating the lycopene content in plants.

[0061] In some specific embodiments, the plant is tomato.

[0062] The technical solution of the present invention will be clearly and completely described below in conjunction with the embodiments. Obviously, the described embodiments are part of the embodiments of the present invention, rather than all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0063] Example 1 Design and synthesis of sgRNA for specific targeting in CRISPR / Cas9 specific knockout of S1SGR1 and S1LCY-B1 genes in processing tomatoes.

[0064] 1. Design of sgRNA targeting SlSGR1 and SlLCY-B1 genes in processing tomatoes

[0065] The sgRNAs of SlSGR1 and SlLCY-B1 were designed using an online tool. The specific steps are as follows:

[0066] ① Log in to the GenBank website, search for and download the SGR1 and LCY-B1 gene sequences, whose nucleotide sequences are shown in SEQ ID NO: 23 and SEQ ID NO: 24.

[0067] ② Open the target prediction website (https: / / crispr.dbcls.jp / ), use the online target site design tool "CRISPRdirect", enter the gene sequence in the text box, select the tomato species, and you can get all the target sites of the gene sequence. Consider the scoring results, GC content, specificity of the target site and the distance between the two target sites, and finally select a group of target sites for targeting.

[0068] ③The 19nt oligonucleotide sgRNA core sequence was designed according to the GG(N)19NGG sequence.

[0069] The sgRNA target site sequences 1 and 2 of SlSGR1 are located on chromosome 8 of the tomato genome, on the first exon of the coding region, with the coding region coordinates (195-213 and 222-240), as shown in Figure 1 shown.

[0070] SlSGR1 sgRNA target site sequence 1 is: 5′-ACTTTGACTACTTCTCTAG-3′ (SEQ ID NO: 1);

[0071] The SlSGR1 gRNA target site sequence 2 is: 5'-TCTAAGCTCAACAATGAAC-3' (SEQ ID NO: 2).

[0072] The sgRNA target site sequences 3 and 4 of SlLCY-B1 are located on chromosome 6 of the tomato genome, with coding region coordinates of (279-297 and 411-429), as shown in Figure 2 shown.

[0073] SlLCY-B1 sgRNA target site sequence 3 is: 5′-TGCAGGACTTGCTGTTGCA-3′ (SEQ ID NO: 3);

[0074] SlLCY-B1 sgRNA target site sequence 4 is: 5'-AGATTGTCTAGATGCTACC-3' (SEQ ID NO: 4).

[0075] 2. Construction of sgRNA oligonucleotides

[0076] According to the selected sgRNA core sequence, the sense strand primer and antisense strand primer were designed, and the sequences containing the nuclease AarI recognition site were added to the 5' end of the two primers.

[0077] The added sequence at the 5' end of the SlSGR1 positive chain primer is ATATATGGTCTCGTTTG (SEQ ID NO: 5) to complement the sticky end of the vector plasmid; the sequence of editing sites 195 to 213 ACTTTGACTACTTCTCTAG (SEQ ID NO: 1) is added to the 3' end of the SEQ ID NO: 5 sequence, and GTTTTAGAGCTAGAAATAGC (SEQ ID NO: 6) is added to the 3' end of the SEQ ID NO: 1 sequence; the added sequence at the 5' end of the SlSGR1 antisense chain primer is ATATCACCTGCACACAAAC (SEQ ID NO: 7), the reverse complementary sequence of editing sites 222 to 240 GTTCATTGTTGAGCTTAGA (SEQ ID NO: 8) is added to the 3' end of the SEQ ID NO: 7 sequence, and CAAACTACACTGTTAGATTC (SEQ ID NO: 9) is added to the 3' end of the SEQ ID NO: 8 sequence.

[0078] The added sequence at the 5' end of the SlLCY-B1 positive chain primer is ATATATGGTCTCGTTTG (SEQ ID NO: 5) to complement the sticky end of the vector plasmid; the sequence TGCAGGACTTGCTGTTGCA (SEQ ID NO: 3) of the editing site 279-297 is added to the 3' end of the SEQ ID NO: 5 sequence, and GTTTTAGAGCTAGAAATAGC (SEQ ID NO: 6) is added to the 3' end of the SEQ ID NO: 3 sequence; the added sequence at the 5' end of the SlLCY-B1 antisense chain primer is ATATCACCTGCACACAAAC (SEQ ID NO: 7), and the reverse complementary sequence GGTAGCATCTAGACAATCT (SEQ ID NO: 10) of the editing site 411-429 is added to the 3' end of the SEQ ID NO: 7 sequence, and CAAACTACACTGTTAGATTC (SEQ ID NO: 9) is added to the 3' end of the SEQ ID NO: 10 sequence.

[0079] The final positive chain primer and antisense chain primer are shown in Table 1.

[0080] Table 1

[0081]

[0082] Example 2 Construction of plant expression vector

[0083] 1. Construction of SlSGR1 plant expression vector

[0084] Using pCBC_DT1T2_tomatoU6 as a template, primers P2 and P4 were designed on the template, and the specific sequences are shown in Table 1. The above primers were combined in the form of P1+P2 and P3+P4 to amplify sgRNA with pCBC_DT1T2_tomatoU6 as a template, and the gel was cut and recovered. At the same time, the PTX041 vector was cut with BsaI, and the vector skeleton was cut and recovered. Then 30ng of the amplified recovery fragment and 100ng of the linear vector were added for cutting and connecting, and all the connection products were transformed into E.coli (kanamycin selection). After transformation, a single clone was picked for bacterial liquid PCR and sequencing verification to obtain the correct loading vector; the tomato genetic transformation method mediated by Agrobacterium (AGL1)-the leaf disc method was used for transformation, and the successfully constructed CRISPR / CAS9 vector was transformed into the cotyledon leaves of the processing tomato, and rooted transgenic seedlings were obtained after tissue culture and kanamycin antibiotic screening.

[0085] 2. Construction of SlLCY-B1 plant expression vector

[0086] Using the primers shown in Table 1, the combination of P5+P2 and P3+P6 was used to amplify sgRNA with pCBC_DT1T2_tomatoU6 as a template, and the PTX041 vector was cut with BsaI, and the vector skeleton was recovered by gel cutting. Then 30ng of the amplified recovery fragment and 100ng of the linear vector were added for cutting and ligation, and all the ligation products were transformed into E.coli (kanamycin selection). After transformation, a single clone was picked for bacterial liquid PCR and sequencing verification to obtain the correct loading vector; the tomato genetic transformation method mediated by Agrobacterium (AGL1) - leaf disc method was used for transformation, and the successfully constructed CRISPR / CAS9 vector was transformed into the cotyledon leaves of the processing tomato, and rooted transgenic seedlings were obtained after tissue culture and kanamycin antibiotic screening.

[0087] 3. Construction of double gene plant expression vector

[0088] Use the primers shown in Table 1 in the form of P1+P2, P3+P4, P5+P6, and use pCBC_DT1T2_tomatoU6 as a template to amplify sgRNA (fragment sizes are 582bp, 578bp, and 597bp, respectively) and cut the gel for recovery. At the same time, use BsaI to cut the PTX041 vector and cut the gel for recovery of the vector backbone. Then add 30ng of the amplified recovery fragment and 100ng of the linear vector for cutting and ligation, and all the ligation products are transformed into E.coli (kanamycin selection). Figure 3As shown, after transformation, a single clone was picked for bacterial liquid PCR and sequencing verification to obtain the correctly loaded vector; the tomato genetic transformation method mediated by Agrobacterium (AGL1) - the leaf disc method was used for transformation, and the successfully constructed CRISPR / CAS9 vector was transformed into the cotyledon leaves of the processing tomato. After tissue culture and kanamycin antibiotic screening, rooted transgenic seedlings were obtained.

[0089] Example 3 Genetic transformation of tomato and acquisition of T0 generation gene-edited plants

[0090] The processing tomato seeds used in this embodiment are the processing tomato variety Xiyuhong No. 8 bred by the Sixth Division Agricultural Science Institute.

[0091] 1. Obtaining sterile seedlings

[0092] Treat the prepared tomato seeds with 75% alcohol for 30 seconds, rinse twice with sterile water, add 10% bleach, shake on a shaker for 1 hour, take out the seeds, rinse 5 times with double distilled water, place in a 4°C refrigerator for 12 hours, inoculate into 1 / 2MS culture medium (without sucrose) and culture for 6 days to obtain sterile seedlings.

[0093] 2. Preparation of bacterial solution

[0094] The three constructed gene editing plant expression vector glycerol bacteria were streaked on YEB solid medium (5 g / L yeast extract, 5 g / L peptone, 5 g / L beef extract, 0.5 g / L magnesium sulfate heptahydrate and 1 g / L sucrose) containing 50 mg / L rifampicin and 100 mg / L kanamycin. After culturing at 28°C for two days, a single clone was picked and inoculated into 5 ml YEB liquid medium containing 50 mg / L rifampicin and 100 mg / L kanamycin. The culture was carried out at 28°C and 220 rpm overnight. The next day, 120 μL of the shaken bacterial solution was taken and added to 50 mL liquid YEB medium (containing 50 mg / L rifampicin and 100 mg / L kanamycin) and shaken until the bacterial solution concentration reached OD 600 = 0.7, centrifuge at 5000 rpm for 10 min to collect the bacteria, resuspend the collected bacteria in MSO liquid culture medium and then use it.

[0095] 3. Obtaining T0 generation regenerated plants

[0096] The sterile cultured tomato cotyledons were cut and pre-cultured on the pre-culture medium for 1 day (dark condition), and then placed on the OD 600 = 0.7 Agrobacterium suspension for 15 min, then use filter paper to absorb excess bacterial liquid and place in pre-culture medium for co-cultivation at 28°C for 2 days (dark condition).

[0097] The formula of the pre-culture medium is: MS+zeatin (1 mg / L)+indoleacetic acid (1 mg / L).

[0098] The co-cultivated cotyledons were placed on a differentiation medium for differentiation screening of adventitious buds. When the resistant regenerated buds screened out grew to 2 cm in height, they were transferred to a rooting medium. The culture conditions were: temperature 25±1°C, photoperiod 16h / d and light intensity 12000lx. The plants were cultured until roots formed to obtain T0 generation regenerated plants.

[0099] The screening method for resistant regenerated shoots is: MS+zeatin (2 mg / L)+indoleacetic acid (1 mg / L)+kanamycin (100 mg / L)+timentin (300 mg / L).

[0100] The formula of rooting medium is: MS + indoleacetic acid (1 mg / L) + kanamycin (100 mg / L) + timentin (3001 mg / L).

[0101] The T0 generation regenerated plants were numbered 1 to 22. 0.2 g of tender leaves were taken from each plant to extract the total genomic DNA. PCR amplification was performed using specific primers Cas9-F and Cas9-R, and the plant editing expression vector plasmid was used as a positive control. Figure 4 As shown, except for No. 1, No. 3 and No. 10, the other plants amplified a band of 841bp consistent with the positive control, and the wild tomato strain (WT) did not amplify the target band, preliminarily indicating that the Cas9 gene had been transformed into the recipient cells.

[0102] Cas9-F:CACTATCCTTCGCAAGACCC (SEQ ID NO:17);

[0103] Cas9-R:GAGATTCCCGAACAAGCCG (SEQ ID NO:18).

[0104] 4. Obtaining T0 generation gene-edited plants

[0105] The obtained T0 generation regenerated plants were numbered, and 0.2 g of young leaves were taken from each plant to extract genomic DNA, which was then amplified by PCR using the SlLCY-B1 gene target site primers (SlLCY-1+SlLCY-2) and the SlSGR1 gene target site free primers (SlSGR-1+SlSGR-2).

[0106] The PCR amplification system was as follows: 1 μL of genomic DNA, 10 μL of Premix Taq DNA polymerase Mix, 0.8 μL of each of the front and back primers, and double distilled water to 20 μL.

[0107] The PCR amplification conditions were: 94℃5min; 94℃30s; 58℃30s; 72℃30s; 35 cycles; 72℃5min.

[0108] The size of the PCR product was obtained by 1.0% agarose gel electrophoresis. The corresponding PCR product was then recovered and transformed into Escherichia coli DH5α for sequencing. The sequencing results showed that 3 double-gene edited plants and 3 single-gene edited plants were successfully obtained. Among the 3 single-gene edited plants, 2 were single-gene mutants of SlLCY-B1, indicating that the gene editing was successful and T0 generation gene-edited plants that controlled lycopene synthesis and metabolism were obtained.

[0109] SlLCY-1: ATGGATACTTTGTTGAAAACCCC (SEQ ID NO: 19);

[0110] SlLCY-2: GAGCACCACCGTTGCCTGAATAG (SEQ ID NO: 20);

[0111] SlSGR-1: TGAGCCAAACGGGCTCTTAAATA (SEQ ID NO: 21);

[0112] SlSGR-2: GAGAGTTTCTGATAGACCTCGAC (SEQ ID NO: 22).

[0113] Example 4 Obtaining gene-edited high-lycopene mutant plants

[0114] 1. Double gene editing high lycopene mutant plants

[0115] The T0 generation S1SGR1 and S1LCY-B1 double gene-edited plants obtained in Example 3 were numbered GE1, GE2, and GE3, respectively. After self-pollination, GE1, GE2, and GE3 were harvested and planted. The method in step 3 of Example 3 was used to screen out mutant plants without T-DNA sequences from the planted plants. Figure 5The mutation types shown are as follows: 2 nucleotides (-GG) are deleted at 284-285 of the SlLCY-B1 gene editing site, 21 nucleotides (GAGCTGTGGTGCGCGTGTACA) are deleted at 421-451, 1 nucleotide (+T) is inserted at 212 of the SlSGR1 gene editing site, and 8 nucleotides (-AGCTCAAC) are deleted at 227-234 (GE1); 1 nucleotide (A) is inserted at 284 of the SlLCY-B1 gene editing site, 4 bases (ATGC) are deleted at 423-426, and 1 nucleotide (-C) is deleted at 210 of the SlSGR1 gene editing site (GE2); 1 nucleotide (A) is inserted at 284 of the SlLCY-B1 gene editing site, and 11 nucleotides (ACTACTTCTCT) are deleted at 200-210 of the SlSGR1 gene editing site (GE3).

[0116] The seeds were collected to obtain a new processing tomato germplasm with high lycopene content. The seeds were sown in a greenhouse and the lycopene content in the fully ripened fruits was measured. The control was a wild-type tomato plant. The measurement method used high-performance liquid chromatography. The results showed that the lycopene content of the double-gene edited tomato plants could reach 732.6μg / g, while that of the wild-type tomato plants was 627.1μg / g.

[0117] 2. Single gene editing of high lycopene mutant plants

[0118] After self-pollination of the T0 generation S1LCY-B1 single gene edited plants GE4 and GE5 obtained in Example 3, the self-pollinated seeds were harvested for planting, and the method in step 3 of Example 3 was applied to screen out mutant plants without T-DNA sequences from the planted plants, such as Figure 6 The mutation types shown were a deletion of 4 nucleotides (-GGAC) (GE4) at the editing sites 284-285 of the SlLCY-B1 gene, and a deletion of 7 nucleotides (-GGACTTG) (GE5) at the editing sites 284-288 of the SlLCY-B1 gene. The determination method used high performance liquid chromatography, and the results showed that the lycopene content of single gene edited tomato plants could reach 687.56 μg / g, while that of wild-type tomato plants was 627.1 μg / g.

[0119] After self-pollination of the T0 generation S1SGR1 single gene edited plants GE4 and GE5 obtained in Example 3, the self-pollinated seeds were harvested for planting, and the method in step 3 of Example 3 was applied to screen out mutant plants without T-DNA sequences from the planted plants, such as Figure 7The mutation type was shown to be an insertion of one nucleotide (+T) at the 212th position of the SlSGR1 gene editing site and a deletion of eight nucleotides (-AGCTCAAC) (GE6) at positions 227-234. The determination method used high performance liquid chromatography, and the results showed that the lycopene content of the single gene edited tomato plants could reach 695.23 μg / g, while that of the wild-type tomato plants was 627.1 μg / g.

[0120] 3. Comparison of the appearance of tomato plant fruits, such as Figure 8 As shown, A is the fruit of wild-type tomato plants, B is the tomato fruit of SlLCY-B1 single gene edited plants, C is the tomato fruit of SlSGR1 single gene edited plants, and D is the tomato fruit of SlSGR1 and SlLCY-B1 double gene edited plants. It can be seen that although the knockout of SlSGR1 alone also effectively increased the lycopene content, due to the impact on the degradation of fruit chlorophyll, the flesh and peel both appeared rusty, thus affecting its commercial quality; knocking out SlSGR1 and SlLCY-B1 at the same time, due to the large accumulation of lycopene, the fruit is dark red, and compared with the control, the lycopene content is increased without affecting its appearance.

[0121] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or replace some or all of the technical features therein with equivalents. However, these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. The use of the following (a) to (d) in regulating the lycopene content in plants: (a) SlSGR1 protein; (b) biological materials related to SlSGR1 protein; (c) S1LCY-B1 protein; (d) biological materials related to S1LCY-B1 protein; The nucleotide sequence of the SlSGR1 protein is shown in SEQ ID NO:23, and the nucleotide sequence of the SlLCY-B1 protein is shown in SEQ ID NO:

24.

2. The use according to claim 1, characterized in that: The expression amount and / or activity of the S1SGR1 protein and the S1LCY-B1 protein in the plant is reduced, and the lycopene content of the tomato is increased.

3. The use according to claim 2, characterized in that: The biological material related to the SlSGR1 protein is a nucleic acid molecule capable of inhibiting or reducing the expression of the gene encoding the SlSGR1 protein, or an expression cassette, a recombinant vector, a recombinant microorganism or a transgenic cell line containing the nucleic acid molecule; The biological material related to the S1LCY-B1 protein is a nucleic acid molecule capable of inhibiting or reducing the expression of the gene encoding the S1LCY-B1 protein, or an expression cassette, a recombinant vector, a recombinant microorganism or a transgenic cell line containing the nucleic acid molecule.

4. A method for bidirectionally regulating the lycopene content in plants, characterized in that: The method comprises simultaneously inhibiting or reducing the expression amount and / or activity of SlSGR1 protein and SlLCY-B1 protein, thereby increasing the lycopene content in the plant; The nucleotide sequence of the SlSGR1 protein is shown in SEQ ID NO:23, and the nucleotide sequence of the SlLCY-B1 protein is shown in SEQ ID NO:

24.

5. The method according to claim 4, characterized in that The method comprises introducing substances into plants that inhibit or reduce the expression of genes encoding SlSGR1 protein and SlLCY-B1 protein.

6. The method according to claim 5, characterized in that The substances that inhibit or reduce the expression of genes encoding SlSGR1 protein and SlLCY-B1 protein include nucleic acid molecules that inhibit or reduce the expression of genes encoding SlSGR1 protein and nucleic acid molecules that inhibit or reduce the expression of genes encoding SlLCY-B1 protein, or expression cassettes, recombinant vectors, recombinant microorganisms or transgenic cell lines containing the nucleic acid molecules.

7. The method according to claim 6, characterized in that The nucleic acid molecule that inhibits or reduces the expression of the SlSGR1 protein encoding gene is a CRISPR / Cas9 editing tool that targets the SlSGR1 protein encoding gene; The nucleic acid molecule that inhibits or reduces the expression of the S1LCY-B1 protein encoding gene is a CRISPR / Cas9 editing tool that targets the S1LCY-B1 protein encoding gene.

8. The method according to claim 7, characterized in that The target sequence targeting the SlSGR1 protein encoding gene is shown in SEQ ID NO: 1 and SEQ ID NO: 2; The target sequence of the gRNA targeting the S1LCY-B1 protein encoding gene is shown in SEQ ID NO:3 and SEQ ID NO:

4.

9. Use of the method according to any one of claims 4 to 8 in preparing a product for regulating the lycopene content in plants.

10. The use according to claim 9, characterized in that: The plant is tomato.

Images