Method for sensitively detecting complete miRNA

Abstract

The invention belongs to the technical field of nucleic acid detection, and relates to a method for sensitively detecting complete miRNA, which comprises the following steps: adding an RNA probe chain and two DNA auxiliary chains, hybridizing the two DNA auxiliary chains with the probe chain and the complete target miRNA to form two Nick structures, closing the Nick under the action of ligase to form closed circular RNA, and detecting the complete miRNA. And finally, generating a signal through the steps of rolling ring reverse transcription and constant-temperature index amplification. The incomplete miRNA without partial nucleotide at the tail end can form a Gap structure after hybridization and is difficult to connect or cannot be connected, and after an amplification step, a signal is finally difficult to generate or cannot be generated. The method is used for accurately detecting the complete target miRNA, the detection limit of the complete target miRNA can reach 100 fM, and even if only 1nt deletion exists in the target miRNA, a false positive result cannot be caused.

Description

Technical Field

[0001] The present invention belongs to the technical field of nucleic acid detection, and specifically relates to a method for sensitively detecting intact miRNA. The method is based on specific RNA cyclization and combined with rolling circle reverse transcription and constant temperature exponential amplification, and is used for sensitively detecting intact miRNA. Background Art

[0002] MicroRNA (miRNA) is a type of short-chain non-coding RNA consisting of 19-24 nucleotides, which can regulate protein expression after transcription, participate in a variety of metabolic processes, and achieve cross-border regulation. MiRNA can also participate in the regulation of a variety of human diseases, and therefore, is also considered a promising biomarker for clinical diagnosis and treatment. However, since enzymes that can hydrolyze RNA are ubiquitous in nature, once miRNA is hydrolyzed, it will affect its function. Therefore, it is crucial for miRNA to remain intact (no nucleotides are missing at the end of miRNA) for it to function.

[0003] As the "gold standard" for miRNA detection, the RT-qPCR method still has the problem of being unable to determine whether the target is complete. If there is a 1-2nt base deletion at the end of the target miRNA, it can still complement the protruding sticky end of the probe chain, and the primer will be extended under the action of reverse transcriptase, and a signal will be generated through the PCR process, causing a false positive problem.

[0004] With the development of isothermal amplification technology, technologies such as rolling circle amplification (RCA) and loop-mediated isothermal amplification (LAMP) have gradually been integrated into miRNA detection technology. These methods have improved the sensitivity of miRNA detection on the one hand, and have the advantages of strong specificity and simple operation on the other hand. At present, the methods for detecting miRNA based on the principle of isothermal amplification mainly include three types: one is to add a circular DNA probe complementary to the target miRNA, use the probe chain as a template, and use the target miRNA as a primer to initiate the rolling circle amplification reaction. However, if there is a 1-2nt deletion at the 3′ or 5′ end of the target miRNA, it can still be complementary to the probe chain and act as a primer to initiate the amplification reaction and generate a signal. The second type uses a single-stranded DNA as a probe chain and the target miRNA as an auxiliary chain. It is complementary to both ends of the probe chain. After hybridization, the two form a Nick structure, and the Nick is closed under the action of the ligase to form a circular DNA. Rolling circle amplification is performed using the circular DNA as a template and the target miRNA as a primer. This type of method has the same problem, that is, for target miRNAs with 1-2nt missing at the end, they can still hybridize with the probe chain to form circular DNA, and use this as a template for amplification reaction to generate fluorescent signals. The third type is to add two DNA probe chains, and the target miRNA serves as an auxiliary chain, hybridizing with the two probe chains to form a Nick structure. The Nick is blocked under the action of ligase, and the single-stranded DNA formed by the connection of the two probe chains can be used as a template for LAMP amplification. After adding primers, the LAMP amplification reaction is carried out. Similarly, if the 3′ or 5′ end of the target miRNA lacks 1-2nt nucleotides, it can still hybridize with the probe chain to form a Nick structure. After being blocked by the ligase, the subsequent amplification reaction is carried out and a signal is generated, which causes a false positive problem.

[0005] In summary, the existing detection methods all have the problem of being unable to distinguish whether the target miRNA is intact. Therefore, it is urgent to establish a method that can sensitively detect intact miRNA. Summary of the invention

[0006] In view of the problem that existing detection methods cannot distinguish whether the target miRNA is intact, the present invention proposes a method for sensitively detecting intact miRNA. The detection method utilizes the property that the efficiency of ligase connecting gap (Gap) structure is significantly lower than that of ligating nick (Nick) structure, thereby achieving highly sensitive and quantitative detection of intact miRNA, and has the advantages of strong specificity, low detection limit and wide linear range.

[0007] The technical solution of the present invention is:

[0008] The present invention provides a method for sensitively detecting intact miRNA. The detection principle of the method is as follows: Figure 1As shown. By adding an RNA probe chain (Probe) and two DNA auxiliary chains (Splint-a and Splint-b), the two Splints hybridize with the Probe and the complete target miRNA to form two Nick structures; the Nick is closed under the action of the ligase to form a closed circular RNA; finally, the signal is generated through the rolling circle reverse transcription and constant temperature exponential amplification steps. However, the incomplete miRNA lacking some nucleotides at the end will form a Gap structure after hybridization, which is difficult or impossible to connect. After the amplification step, it is difficult to generate a signal or cannot generate a signal.

[0009] The present invention provides a method for sensitively detecting intact miRNA, comprising the following steps:

[0010] (1) Design a probe chain (Probe), which is an RNA with a length of 25-60 nt. According to the sequence information of the target miRNA and the probe chain, design two DNA auxiliary chains (Splint-a and Splint-b), which are 14-20 nt in length and complementary to the probe chain and the target miRNA chain by 7-13 nt respectively;

[0011] Design a pair of primers F / F′, the length of primer F / F′ is 18-23 nt DNA, wherein primer F contains 18-23 nt sequence complementary to the target miRNA, and primer F′ contains 18-23 nt sequence identical to the target miRNA; prevent nonspecific amplification caused by Probe self-circularization during amplification;

[0012] (2) Two DNA auxiliary chains (Splint-a, Splint-b), Probe and miRNA are mixed with ligase buffer solution, reacted at 80-90°C for 3-5 minutes, then cooled to 20-25°C at a rate of 0.1°C / s and maintained for 5-20 minutes for annealing, and then ligase is added; Splint-a, Splint-b, Probe and the complete target miRNA are hybridized after annealing to form two Nick structures, and the Nick is closed under the action of ligase to form a circular RNA; for incomplete miRNAs whose ends are partially hydrolyzed, it is difficult or impossible to connect them into a circular structure (a gap structure is formed after hybridization with Splint-a, Splint-b and Probe).

[0013] (3) adding RNase R to the reaction system of step (2) to perform an enzyme digestion reaction at 25-37° C. for 10-30 min to remove the linear RNA and obtain circular RNA;

[0014] (4) adding reverse transcriptase to the reaction system of step (3), using circular RNA as a template and one or two DNA auxiliary chains added in step (2) as primers for amplification, maintaining at 42-50° C. for 30-120 min, and performing rolling circle reverse transcription reaction (RT-RCA), wherein the product generated by the reaction is a long repetitive single-stranded DNA;

[0015] (5) Add Bst 2.0 DNA polymerase, primer F / F′ and fluorescent dye to the reaction system of step (4), place in a qPCR instrument at 55-65° C. for 60-120 min; use the long repetitive single-stranded DNA generated in step (4) as a template and F / F′ as a primer to perform a constant temperature exponential amplification reaction and detect the fluorescent signal.

[0016] Furthermore, in step (1), the GC content of the probe chain is greater than 20%; preferably, the GC content of the probe chain is 30-70%.

[0017] Furthermore, the length of the DNA Splint is 14-20 nt. When the GC content of the probe chain and the target miRNA is 50-70%, the corresponding length of the DNA auxiliary chain is 14-18 nt; when the GC content of the probe chain and the target miRNA is 30-50%, the corresponding length of the DNA auxiliary chain is 18-20 nt.

[0018] Furthermore, there are three complementary conditions between the primers F and F' designed in step (1), wherein they can be completely complementary; there can also be a 1-5 nt overhang at the 3' end and a continuous 13-22 nt complementation at the 5' end; there can also be a 1-5 nt overhang at the 5' end and a continuous 13-22 nt complementation at the 3' end. The complementarity between primers F and F' can avoid false positive results caused by the primers mispairing with non-template nucleic acids in the system.

[0019] Furthermore, in step (2), the concentration of the probe chain is 20-200 nM, and the concentration of the two Splint chains is 40-1000 nM.

[0020] Furthermore, in step (2), the ligase is DNA ligase or T4 RNA ligase 2, the concentration of the ligase is 0.01-1.0 U / μL, and the ligation conditions are: 25-50° C. for 5-120 min;

[0021] The final concentration of the ligase buffer solution is 0.05-2 times the standard concentration.

[0022] Furthermore, in the ligation reaction of step (2), the incomplete miRNA whose end is partially hydrolyzed forms a gap structure after hybridization with the probe chain and the two DNA auxiliary chains, which is difficult or impossible to connect into a closed ring structure under the action of the ligase.

[0023] Furthermore, in step (3), the concentration of RNase R is 0.1-1.0 U / μL.

[0024] RNase R buffer solution is also added to the enzyme digestion reaction system in step (3), and the final concentration of the RNase R buffer solution is 0.05-2 times the standard concentration.

[0025] Furthermore, the concentration of the reverse transcriptase in step (4) is 1.0-10 U / μL.

[0026] Furthermore, in step (5), the concentrations of primers F and F' are 0.1-5.0 μM; and the concentration of Bst 2.0 DNA polymerase is 0.1-1.0 U / μL.

[0027] Beneficial effects of the present invention:

[0028] (1) The detection method provided by the present invention utilizes specific RNA cyclization combined with RT-RCA and constant temperature exponential amplification to distinguish between complete and incomplete target miRNAs, and accurately detects complete target miRNAs based on the characteristic that the efficiency of ligase ligating gap structures is significantly lower than that of incision structures;

[0029] This method is used to accurately detect complete target miRNA. The detection limit for complete target miRNA can reach 100fM, and even if the target miRNA only has a 1nt deletion, it will not cause a false positive result.

[0030] (2) The universal RNA probe chain designed by the present invention does not need to be specifically designed for different target sequences, which greatly reduces the detection cost.

[0031] (3) The two DNA Splint chains added during the cyclization process of the present invention do not need to be removed after cyclization and can be used as primers to initiate RT-RCA reaction.

[0032] (4) The present invention can achieve exponential amplification at a constant temperature without the need for the thermal cycling process of traditional PCR. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 Schematic diagram for sensitive detection of intact miRNA;

[0034] Figure 2 This is the amplification curve of the target miR159 detected by Probe-25;

[0035] Figure 3 This is the standard curve for detecting the target miR159 using Probe-25;

[0036] Figure 4This is the result of using Probe-25 to detect the non-intact target miR159;

[0037] Figure 5 To detect the amplification results of target miR159 using T4 Dnl circularization;

[0038] Figure 6 The results of detecting the non-intact target miR159 using T4 Dnl circularization;

[0039] Figure 7 To detect the amplification results of the target miR159 using 14nt Splint circularization;

[0040] Figure 8 This is the amplification curve of the target miR159 detected by Probe-36;

[0041] Fig. 9 This is the amplification curve of the target miR159 detected by Probe-60;

[0042] Fig.10 This is the amplification curve of the target miR20 a detected by Probe-25;

[0043] Fig.11 This is the standard curve for detecting the target miR20 a using Probe-25;

[0044] Fig.12 This is the amplification curve of the target miR155 detected using Probe-25. DETAILED DESCRIPTION

[0045] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0046] In order to further understand the present invention, the present invention will be further described in conjunction with the accompanying drawings and embodiments.

[0047] Unless otherwise specified, the drugs and reagents used in the embodiments of the present invention are purchased from regular channels.

[0048] The miRNA chain and Probe chain used in the following examples were purchased from Suzhou Jinweizhi Biotechnology Co., Ltd. and were artificially synthesized; Splint chain and primer F / F′ were purchased from Shenggong Biotechnology Co., Ltd.; T4 Rnl2 and 10×T4 Rnl2 buffer were purchased from Jisai Biotechnology Co., Ltd.; RNase R and 10×RNase Rbuffer were purchased from Jisai Biotechnology Co., Ltd.; reverse transcriptase M-MLV and 5×M-MLVbuffer were purchased from Jisai Biotechnology Co., Ltd.; dNTPs were purchased from Wuhan Aibotek Biotechnology Co., Ltd.; fluorescent dye SYBR Green Ι was purchased from Beijing Solaibao Biotechnology Co., Ltd.; Bst2.0 DNA Polymerase was purchased from NEB Biotechnology Co., Ltd. qPCR experiments were performed in the PikoReal real-time PCR system (Thermo Scientific, Finland).

[0049] Example 1

[0050] This example verifies the sensitivity of detecting miR159 when the probe is 25 nt. The specific steps are as follows:

[0051] 1) Raw materials:

[0052] miR159 (5′→3′): UUUGGAUUGAAGGGAGCUCUA (length 21 nt)

[0053] Probe-25 (5′→3′): UAACAAUAACAAUCAGCCAAAACAA (length 25 nt)

[0054] F-159 (5′→3′): TGGATTGAAGGGAGCTCTA (length 19 nt)

[0055] F′-159 (5′→3′): AGAGCTCCCTTCAATCCAA (length 19 nt)

[0056] Splint-20a-159-25 (5′→3′): GTTATTGTTATAGAGCTCCC (length 20 nt)

[0057] Splint-20b-159-25 (5′→3′): TCAATCCAAATTGTTTTGGC (length 20 nt)

[0058] 2) Connect into a ring

[0059] Control group (without target miR159): The final concentration of Probe was 20nM, the final concentration of Splint-20a-159-25 was 100nM, the final concentration of Splint-20b-159-25 was 100nM, and the final concentration of T4 Rnl2 buffer was 1×. The reaction was carried out at 85℃ for 5min, and then the temperature was lowered to 25℃ at a rate of 0.1℃ / s and maintained for 10min for annealing. Then, T4 Rnl2 was added at a final concentration of 0.01U / μL and 1U / μL of RNase inhibitor, and the total volume was 10μL. The rest was supplemented with water, and after ligation at 45℃ for 30min, T4 Rnl2 was inactivated at 85℃ for 5min.

[0060] Experimental group (adding target miR159): the final concentrations of miR159 were 10nM, 1nM, 0.1nM, 10pM, 1pM and 0.1pM, respectively, the final concentrations of Probe were 20nM, the final concentrations of Splint-20a-159-25 were 100nM, the final concentrations of Splint-20b-159-25 were 100nM, the final concentration of T4 Rnl2 buffer was 1×, reacted at 85℃ for 5min, then cooled to 25℃ at a rate of 0.1℃ / s and kept for 10min for annealing. Then, T4 Rnl2 was added at a final concentration of 0.01U / μL and 1U / μL of RNase inhibitor, the total volume was 10μL, and the rest was made up with water. After ligation at 45℃ for 30min, T4 Rnl2 was inactivated at 85℃ for 5min.

[0061] 3) RNase R digestion to remove linear RNA

[0062] Take 8 μL from the ligation reaction system, add RNase R buffer to a final concentration of 1×, RNase R to a final concentration of 0.2 U / μL, and the total volume is 10 μL. Make up the rest with water. After reacting at 37°C for 10 minutes, inactivate RNase R at 75°C for 10 minutes.

[0063] 4) RT-RCA amplification reaction

[0064] Take 2 μL from the enzyme digestion reaction system, add dNTPs to a final concentration of 500 μM, M-MLV buffer to a final concentration of 1×, M-MLV to a final concentration of 2 U / μL, RNase inhibitor to a final concentration of 1 U / μL, and a total volume of 10 μL. Make up the rest with water. After amplification at 42°C for 1 hour, inactivate M-MLV at 85°C for 5 minutes.

[0065] 5) Constant temperature exponential amplification reaction

[0066] Take 2 μL from the RT-RCA reaction system, add 0.2 U / μL Bst 2.0 DNA Polymerase, 1× Isothermal Amplification Buffer, the final concentration of dNTPs is 500 μM, the final concentration of primer F-159 / F′-159 is 1 μM, the final concentration of fluorescent dye SYBR Green Ι is 1×, the total volume is 10 μL, the rest is made up with water, and react at 60°C for 90 min.

[0067] The results are as follows Figure 2 and Figure 3 As shown: When the length of the Probe is 25 nt, the detection limit for detecting the target miR159 can reach 0.1 pM, and there is a good linear relationship in the range of 0.1 pM to 10 nM.

[0068] Example 2

[0069] This example verifies the feasibility of this method for detecting complete target miRNA when using Probe-25 for cyclization. The specific steps are as follows:

[0070] raw material:

[0071] miR159 (5′→3′): UUUGGAUUGAAGGGAGCUCUA (length 21 nt)

[0072] miR159-3′-1 (5′→3′): UUUGGAUUGAAGGGAGCUCU (length 20 nt)

[0073] miR159-5′-1 (5′→3′): UUGGAUUGAAGGGAGCUCUA (length 20 nt)

[0074] Probe-25 (5′→3′): UAACAAUAACAAUCAGCCAAAACAA (length 25 nt)

[0075] F-159 (5′→3′): TGGATTGAAGGGAGCTCTA (length 19 nt)

[0076] F′-159 (5′→3′): AGAGCTCCCTTCAATCCAA (length 19 nt)

[0077] Splint-20a-159-25 (5′→3′): GTTATTGTTATAGAGCTCCC (length 20 nt)

[0078] Splint-20b-159-25 (5′→3′): TCAATCCAAATTGTTTTGGC (length 20 nt)

[0079] 2) Connect into a ring

[0080] Control group (without target miR159): The final concentration of Probe-25 was 20nM, the final concentration of Splint-20a-159 was 100nM, the final concentration of Splint-20b-159 was 100nM, and the final concentration of T4 Rnl2 buffer was 1×. The reaction was carried out at 85℃ for 5min, and then the temperature was lowered to 25℃ at a rate of 0.1℃ / s and maintained for 10min for annealing. Then, T4 Rnl2 was added at a final concentration of 0.01U / μL and 1U / μL of RNase inhibitor, and the total volume was 10μL. The rest was supplemented with water, and after ligation at 45℃ for 30min, T4 Rnl2 was inactivated at 85℃ for 5min.

[0081] Experimental group (adding target miR159): the final concentrations of miR159, miR159 mutant with 1 base missing at the 5′ end (miR159-5′-1), and miR159 mutant with 1 base missing at the 3′ end (miR159-3′-1) were all 1 nM, the final concentrations of Probe-25 were 20 nM, the final concentrations of Splint-20a-159 were 100 nM, and the final concentrations of Splint-20b-159 were 100 nM. The final concentration of T4Rnl2buffer was 1×, and the reaction was carried out at 85°C for 5 min, and then the temperature was lowered to 25°C at a rate of 0.1°C / s and maintained for 10 min for annealing. Then, T4 Rnl2 with a final concentration of 0.01 U / μL and 1 U / μL of RNase inhibitor were added, and the total volume was 10 μL, and the rest was made up with water. After ligation at 45°C for 30 min, T4 Rnl2 was inactivated at 85°C for 5 min.

[0082] 3) RNase R digestion to remove linear RNA

[0083] Take 8 μL from the ligation reaction system, add RNase R buffer to a final concentration of 1×, RNase R to a final concentration of 0.2 U / μL, and the total volume is 10 μL. Make up the rest with water. After reacting at 37°C for 10 minutes, inactivate RNase R at 75°C for 10 minutes.

[0084] 4) RT-RCA amplification reaction

[0085] Take 2 μL from the RNase R digestion system, add dNTPs to a final concentration of 500 μM, M-MLV buffer to a final concentration of 1×, M-MLV to a final concentration of 2 U / μL, RNase inhibitor to a final concentration of 1 U / μL, and a total volume of 10 μL. Make up the rest with water. After amplification at 42°C for 1 hour, inactivate M-MLV at 85°C for 5 minutes.

[0086] 5) Constant temperature exponential amplification reaction

[0087] Take 2 μL from the RT-RCA reaction system, add 0.2 U / μL Bst 2.0 DNA Polymerase, 1× Isothermal Amplification Buffer, the final concentration of dNTPs is 500 μM, the final concentration of primer F-159 / F′-159 is 1 μM, the final concentration of fluorescent dye SYBR Green Ι is 1×, the total volume is 10 μL, the rest is made up with water, and react at 60°C for 90 min.

[0088] The experimental results are shown in Figure 4 :When there is a 1nt deletion at the 3′ or 5′ end of the target miR159, there is no significant difference in the amplification curve between the blank group and the target miR159, while the intact target miR159 can produce fluorescence onset in about 25 minutes. This shows that when Probe-25 is used to cyclize the target, even if there is a 1nt deletion at the 3′ or 5′ end of the target miR159, it will not cause a false positive problem.

[0089] Example 3

[0090] This example verifies the feasibility of detecting the target miRNA159 when the ligase is T4 DNA ligase (T4 Dnl), and the specific steps are as follows:

[0091] 1) Raw materials:

[0092] miR159 (5′→3′): UUUGGAUUGAAGGGAGCUCUA (length 21 nt)

[0093] Probe-25 (5′→3′): UAACAAUAACAAUCAGCCAAAACAA (length 25 nt)

[0094] F-159 (5′→3′): TGGATTGAAGGGAGCTCTA (length 19 nt)

[0095] F′-159 (5′→3′): AGAGCTCCCTTCAATCCAA (length 19 nt)

[0096] Splint-20a-159-25 (5′→3′): GTTATTGTTATAGAGCTCCC (length 20 nt)

[0097] Splint-20b-159-25 (5′→3′): TCAATCCAAATTGTTTTGGC (length 20 nt)

[0098] 2) Connect into a ring

[0099] Control group (without target miR159): The final concentration of Probe was 20nM, the final concentration of Splint-20a-159-25 was 100nM, the final concentration of Splint-20b-159-25 was 100nM, and the final concentration of T4 Dnl buffer was 1×. The reaction was carried out at 85℃ for 5min, and then the temperature was lowered to 25℃ at a rate of 0.1℃ / s and maintained for 10min for annealing. Then, T4 Dnl with a final concentration of 0.25U / μL and 1U / μL of RNase inhibitor were added to a total volume of 10μL, and the rest was supplemented with water. After ligation at 25℃ for 30min, T4 Dnl was inactivated at 85℃ for 5min.

[0100] Experimental group (adding target miR159): the final concentrations of miR159 were 10nM, 1nM, 0.1nM and 10pM, respectively, the final concentrations of Probe were 20nM, the final concentrations of Splint-20a-159-25 were 100nM, the final concentrations of Splint-20b-159-25 were 100nM, the final concentration of T4 Dnl buffer was 1×, reacted at 85℃ for 5min, then cooled to 25℃ at a rate of 0.1℃ / s and kept for 10min for annealing. Then, T4 Dnl with a final concentration of 0.25U / μL and 1U / μL of RNase inhibitor were added, the total volume was 10μL, and the rest was made up with water. After ligation at 25℃ for 30min, T4 Dnl was inactivated at 85℃ for 5min.

[0101] 3) RNase R digestion to remove linear RNA

[0102] Take 8 μL from the ligation reaction system, add RNase R buffer to a final concentration of 1×, RNase R to a final concentration of 0.2 U / μL, and the total volume is 10 μL. Make up the rest with water. After reacting at 37°C for 10 minutes, inactivate RNase R at 75°C for 10 minutes.

[0103] 4) RT-RCA amplification reaction

[0104] Take 2 μL from the system after RNase R digestion, add dNTPs to a final concentration of 500 μM, reverse transcriptase M-MLV buffer to a final concentration of 1×, reverse transcriptase M-MLV to a final concentration of 2 U / μL, and RNase inhibitor to a final concentration of 1 U / μL, the total volume is 10 μL, and the rest is made up with water. After amplification at 42°C for 1 hour, inactivate M-MLV at 85°C for 5 minutes.

[0105] 5) Constant temperature exponential amplification reaction

[0106] Take 2 μL from the RT-RCA amplification reaction system, add 0.2 U / μL Bst 2.0 DNA Polymerase, 1× Isothermal Amplification Buffer, the final concentration of dNTPs is 500 μM, the final concentration of primer F-159 / F′-159 is 1 μM, the final concentration of fluorescent dye SYBR Green Ι is 1×, the total volume is 10 μL, the rest is made up with water, and react at 60°C for 90 min.

[0107] The results are as follows Figure 5 The results showed that when T4 Dnl was selected as the ligase, the Probe and the target miRNA could still be cyclized with the assistance of two DNA Splints, and the target miRNA could be detected. At this time, the detection limit of this method could reach 10pM.

[0108] Example 4

[0109] This example verifies the feasibility of the method for detecting complete target miRNA when the ligase is T4 DNA ligase (T4 Dnl), and the specific steps are as follows:

[0110] 1) Raw materials:

[0111] miR159 (5′→3′): UUUGGAUUGAAGGGAGCUCUA (length 21 nt)

[0112] miR159-3′-1 (5′→3′): UUUGGAUUGAAGGGAGCUCU (length 20 nt)

[0113] miR159-5′-1 (5′→3′): UUGGAUUGAAGGGAGCUCUA (length 20 nt)

[0114] Probe-25 (5′→3′): UAACAAUAACAAUCAGCCAAAACAA (length 25 nt)

[0115] F-159 (5′→3′): TGGATTGAAGGGAGCTCTA (length 19 nt)

[0116] F′-159 (5′→3′): AGAGCTCCCTTCAATCCAA (length 19 nt)

[0117] Splint-20a-159-25 (5′→3′): GTTATTGTTATAGAGCTCCC (length 20 nt)

[0118] Splint-20b-159-25 (5′→3′): TCAATCCAAATTGTTTTGGC (length 20 nt)

[0119] 2) Connect into a ring

[0120] Control group (without target miR159): The final concentration of Probe is 20nM, the final concentration of Splint-20a-159 is 100nM, the final concentration of Splint-20b-159 is 100nM, and the final concentration of T4 Dnl buffer is 1×. React at 85℃ for 5min, then cool to 25℃ at a rate of 0.1℃ / s and keep for 10min for annealing. Then add T4 Dnl with a final concentration of 0.25U / μL and 1U / μL RNase inhibitor, the total volume is 10μL, and the rest is made up with water. After ligation at 25℃ for 30min, inactivate T4 Dnl at 85℃ for 5min.

[0121] Experimental group (adding target miR159): The final concentrations of target miR159, miR159 mutant with 1 base missing at the 5′ end (miR159-5′-1), and miR159 mutant with 1 base missing at the 3′ end (miR159-3′-1) were all 1 nM, the final concentrations of Probe were 20 nM, the final concentrations of Splint-20a-159 were 100 nM, the final concentrations of Splint-20b-159 were 100 nM, and the final concentration of T4 Dnlbuffer was 1×. The reaction was carried out at 85°C for 5 min, and then the temperature was lowered to 25°C at a rate of 0.1°C / s and maintained for 10 min for annealing. Then, T4 Dnl with a final concentration of 0.25 U / μL and 1 U / μL of RNase inhibitor were added, and the total volume was 10 μL, and the rest was made up with water. After ligation at 25°C for 30 min, T4 Dnl was inactivated at 85°C for 5 min.

[0122] 3) RNase R digestion to remove linear RNA

[0123] Take 8 μL from the ligation reaction system, add RNase R buffer to a final concentration of 1×, RNase R to a final concentration of 0.2 U / μL, and the total volume is 10 μL. Make up the rest with water. After reacting at 37°C for 10 minutes, inactivate RNase R at 75°C for 10 minutes.

[0124] 4) RT-RCA amplification reaction

[0125] Take 2 μL from the system after RNase R digestion, add dNTPs to a final concentration of 500 μM, reverse transcriptase M-MLV buffer to a final concentration of 1×, reverse transcriptase M-MLV to a final concentration of 2 U / μL, and RNase inhibitor to a final concentration of 1 U / μL, the total volume is 10 μL, and the rest is made up with water. After amplification at 42°C for 1 hour, inactivate M-MLV at 85°C for 5 minutes.

[0126] 5) Constant temperature exponential amplification reaction

[0127] Take 2 μL from the RT-RCA amplification reaction system, add 0.2 U / μL Bst 2.0 DNA Polymerase, 1× Isothermal Amplification Buffer, the final concentration of dNTPs is 500 μM, the final concentration of primer F-159 / F′-159 is 1 μM, the final concentration of fluorescent dye SYBR Green Ι is 1×, the total volume is 10 μL, the rest is made up with water, and react at 60°C for 90 min.

[0128] The results are as follows Figure 6 The results showed that within 90 minutes, only the intact target miR159 produced a fluorescent signal, while no signal was produced when miR159 had a 1nt deletion (miR159-5′-1 and miR159-3′-1). Therefore, when the ligase is T4Dnl, the integrity of the target miRNA can also be detected.

[0129] Example 5

[0130] This example verifies the sensitivity of detecting the target miR159 when cyclization is performed using the 14nt Splint. The specific steps are as follows:

[0131] 1) Raw materials:

[0132] miR159 (5′→3′): UUUGGAUUGAAGGGAGCUCUA (length 21 nt)

[0133] Probe-25 (5′→3′): UAACAAUAACAAUCAGCCAAAACAA (length 25 nt)

[0134] F-159 (5′→3′): TGGATTGAAGGGAGCTCTA (length 19 nt)

[0135] F′-159 (5′→3′): AGAGCTCCCTTCAATCCAA (length 19 nt)

[0136] Splint-14a-159-25 (5′→3′): ATTGTTATAGAGCT (length 14 nt)

[0137] Splint-14b-159-25 (5′→3′): ATCCAAATTGTTTT (length 14 nt)

[0138] 2) Connect into a ring

[0139] Control group (without target miR159): The final concentration of Probe was 20nM, the final concentration of Splint-14a-159-25 was 100nM, the final concentration of Splint-14b-159-25 was 100nM, and the final concentration of T4 Rnl2 buffer was 1×. The reaction was carried out at 85℃ for 5min, and then the temperature was lowered to 25℃ at a rate of 0.1℃ / s and maintained for 10min for annealing. Then, T4 Rnl2 was added at a final concentration of 0.01U / μL and 1U / μL of RNase inhibitor, and the total volume was 10μL. The rest was supplemented with water, and after ligation at 45℃ for 30min, T4 Rnl2 was inactivated at 85℃ for 5min.

[0140] Experimental group (adding target miR159): the final concentrations of miR159 were 10nM, 1nM and 0.1nM, respectively, the final concentrations of Probe were 20nM, the final concentrations of Splint-14a-159-25 were 100nM, the final concentrations of Splint-14b-159-25 were 100nM, the final concentration of T4Rnl2 buffer was 1×, reacted at 85℃ for 5min, then cooled to 25℃ at a rate of 0.1℃ / s and kept for 10min for annealing. Then, T4 Rnl2 was added at a final concentration of 0.01U / μL and 1U / μL of RNase inhibitor, the total volume was 10μL, and the rest was made up with water. After ligation at 45℃ for 30min, T4 Rnl2 was inactivated at 85℃ for 5min.

[0141] 3) RNase R digestion to remove linear RNA

[0142] Take 8 μL from the ligation reaction system, add RNase R buffer to a final concentration of 1×, RNase R to a final concentration of 0.2 U / μL, and the total volume is 10 μL. Make up the rest with water. After reacting at 37°C for 10 minutes, inactivate RNase R at 75°C for 10 minutes.

[0143] 4) RT-RCA amplification reaction

[0144] Take 2 μL from the system after RNase R digestion, add dNTPs to a final concentration of 500 μM, reverse transcriptase M-MLV buffer to a final concentration of 1×, reverse transcriptase M-MLV to a final concentration of 2 U / μL, and RNase inhibitor to a final concentration of 1 U / μL, the total volume is 10 μL, and the rest is made up with water. After amplification at 42°C for 1 hour, inactivate M-MLV at 85°C for 5 minutes.

[0145] 5) Constant temperature exponential amplification reaction

[0146] Take 2 μL from the RT-RCA amplification reaction system, add 0.2 U / μL Bst 2.0 DNA Polymerase, 1× Isothermal Amplification Buffer, the final concentration of dNTPs is 500 μM, the final concentration of primer F-159 / F′-159 is 1 μM, the final concentration of fluorescent dye SYBR Green Ι is 1×, the total volume is 10 μL, the rest is made up with water, and react at 60°C for 90 min.

[0147] The results are as follows Figure 7 The results show that when the cyclization is performed with the help of a Splint with a length of 14 nt, the target miRNA can still be detected, and the detection limit of this method can reach 0.1 nM.

[0148] Example 6

[0149] This example verifies the results of using this method to detect the target miR159 when the probe chain length is 36 nt. The specific steps are as follows:

[0150] 1) Raw materials:

[0151] miR159 (5′→3′): UUUGGAUUGAAGGGAGCUCUA (length 21 nt)

[0152] Probe-36(5′→3′):CAAAGAACCCCAACCCGCCCUACCCAAACGCAAACA (length 36nt)

[0153] F-159 (5′→3′): TGGATTGAAGGGAGCTCTA (length 19 nt)

[0154] F′-159 (5′→3′): AGAGCTCCCTTCAATCCAA (length 19 nt)

[0155] Splint-20a-159-36 (5′→3′): TCAATCCAAATGTTTGCGTT (length 20 nt)

[0156] Splint-20b-159-36 (5′→3′): GGGTTCTTTGTAGAGCTCCC (length 20 nt)

[0157] 2) Connect into a ring

[0158] Control group (without target miR159): The final concentration of Probe-36 was 20nM, the final concentration of Splint-20a-159-36 was 100nM, the final concentration of Splint-20b-159-36 was 100nM, the final concentration of T4 Rnl2 was 0.01U / μL, the final concentration of T4 Rnl2buffer was 1×, reacted at 85℃ for 5min, then cooled to 25℃ at a rate of 0.1℃ / s and kept for 10min for annealing. Then, T4 Rnl2 was added at a final concentration of 0.01U / μL and 1U / μL of RNase inhibitor, the total volume was 10μL, the rest was supplemented with water, connected at 45℃ for 30min, and T4 Rnl2 was inactivated at 85℃ for 5min.

[0159] Experimental group (adding target miR159): the final concentrations of miR159 were 10nM, 1nM, 0.1nM, respectively, the final concentrations of Probe-36 were 20nM, the final concentrations of Splint-20a-159-36 were 100nM, the final concentrations of Splint-20b-159-36 were 100nM, the final concentrations of T4 Rnl2 were 0.01U / μL, the final concentration of T4 Rnl2 buffer was 1×, reacted at 85℃ for 5min, then cooled to 25℃ at a rate of 0.1℃ / s and kept for 10min for annealing. Then, T4 Rnl2 was added at a final concentration of 0.01U / μL and 1U / μL of RNase inhibitor, the total volume was 10μL, and the rest was supplemented with water. After ligation at 45℃ for 30min, T4Rnl2 was inactivated at 85℃ for 5min.

[0160] 3) RNase R digestion to remove linear RNA

[0161] Take 8 μL from the ligation system, add RNase R buffer to a final concentration of 1×, RNase R to a final concentration of 0.2 U / μL, and the total volume is 10 μL. Make up the rest with water. After reacting at 37°C for 10 minutes, inactivate RNase R at 75°C for 10 minutes.

[0162] 4) RT-RCA amplification reaction

[0163] Take 2 μL from the enzyme digestion system, add dNTPs to a final concentration of 500 μM, M-MLV buffer to a final concentration of 1×, M-MLV to a final concentration of 2 U / μL, RNase inhibitor to a final concentration of 1 U / μL, and a total volume of 10 μL. Make up the rest with water. After amplification at 42°C for 1 hour, inactivate M-MLV at 85°C for 5 minutes.

[0164] 5) Constant temperature exponential amplification reaction

[0165] Take 2 μL from the RT-RCA amplification system, add 0.2 U / μL Bst 2.0 DNA Polymerase, 1× Isothermal Amplification Buffer, the final concentration of dNTPs is 500 μM, the final concentration of primer F-159 / F′-159 is 1 μM, the final concentration of fluorescent dye SYBR Green Ι is 1×, the total volume is 10 μL, the rest is made up with water, and react at 60°C for 90 min.

[0166] The results are as follows Figure 8 As shown: When the probe chain is extended to 36 nt, this method can still be used to detect the target miR159, and the detection limit can reach 0.1 nM.

[0167] Example 7

[0168] This example verifies the sensitivity of detecting the target miR159 when the Probe length is 60 nt. The specific steps are as follows:

[0169] 1) Raw materials:

[0170] miR159 (5′→3′): UUUGGAUUGAAGGGAGCUCUA (length 21 nt)

[0171] Probe-60(5′→3′):UAACAAUAACAAUCAGCCAAAACAAUCAUAUAUGCAUUGAACUAUAUCUACACCGUUACU (length 60nt)

[0172] F-159 (5′→3′): TGGATTGAAGGGAGCTCTA (length 19 nt)

[0173] F′-159 (5′→3′): AGAGCTCCCTTCAATCCAA (length 19 nt)

[0174] Splint-20a-159-60 (5′→3′): TCAATCCAAAAGTAACGGTG (length 20 nt)

[0175] Splint-20b-159-60 (5′→3′): GTTATTGTTATTACCCTCGAGAT (length 20 nt)

[0176] 2) Connect into a ring

[0177] Control group (without target miR159): The final concentration of Probe was 20nM, the final concentration of Splint-20a-159-60 was 100nM, the final concentration of Splint-20b-159-60 was 100nM, and the final concentration of T4 Rnl2 buffer was 1×. The reaction was carried out at 85℃ for 5min, and then the temperature was lowered to 25℃ at a rate of 0.1℃ / s and maintained for 10min for annealing. Then, T4 Rnl2 was added at a final concentration of 0.01U / μL and 1U / μL of RNase inhibitor, and the total volume was 10μL. The rest was supplemented with water, and after ligation at 45℃ for 30min, T4 Rnl2 was inactivated at 85℃ for 5min.

[0178] Experimental group (adding target miR159): the final concentrations of miR159 were 10nM, 1nM, 0.1nM, 10pM, 1pM and 0.1pM, respectively, the final concentrations of Probe-60 were 20nM, the final concentrations of Splint-20a-159-60 were 100nM, the final concentrations of Splint-20b-159-60 were 100nM, the final concentration of T4 Rnl2 buffer was 1×, reacted at 85℃ for 5min, then cooled to 25℃ at a rate of 0.1℃ / s and kept for 10min for annealing. Then, T4 Rnl2 was added at a final concentration of 0.01U / μL and 1U / μL of RNase inhibitor, the total volume was 10μL, and the rest was made up with water. After ligation at 45℃ for 1h, T4 Rnl2 was inactivated at 85℃ for 5min.

[0179] 3) RNase R digestion to remove linear RNA

[0180] Take 8 μL from the ligation reaction system, add RNase R buffer with a final concentration of 1×, the final concentration of RNase R is 0.2U / μL, the total volume is 10 μL, and the rest is made up with water. After reacting at 37℃ for 10 minutes, inactivate RNase R at 75℃ for 10 minutes.

[0181] 4) RT-RCA amplification reaction

[0182] Take 2 μL from the system after RNase R digestion, add dNTPs to a final concentration of 500 μM, reverse transcriptase M-MLV buffer to a final concentration of 1×, reverse transcriptase M-MLV to a final concentration of 2 U / μL, and RNase inhibitor to a final concentration of 1 U / μL, the total volume is 10 μL, and the rest is made up with water. After amplification at 42°C for 1 hour, inactivate M-MLV at 85°C for 5 minutes.

[0183] 5) Constant temperature exponential amplification reaction

[0184] Take 2 μL from the RT-RCA amplification reaction system, add 0.2 U / μL Bst 2.0 DNA Polymerase, 1× Isothermal Amplification Buffer, the final concentration of dNTPs is 500 μM, the final concentration of primer F-159 / F′-159 is 1 μM, the final concentration of fluorescent dye SYBR Green Ι is 1×, the total volume is 10 μL, the rest is made up with water, and react at 60°C for 90 min.

[0185] The results are as follows Fig. 9 As shown: When the length of the Probe is 60 nt, sensitive detection of the target miR159 can be achieved, and the detection limit can reach about 100 fM.

[0186] Example 8

[0187] This example verifies the feasibility of detecting the target miR20 a with a probe length of 25 nt. The specific steps are as follows:

[0188] 1) Raw materials:

[0189] miR20 a (5′→3′): UAAAGUGCUUAUAGUGCAGGUAG (length 23 nt)

[0190] Probe-25 (5′→3′): UAACAAUAACAAUCAGCCAAAACAA (length 25 nt)

[0191] F-20a (5′→3′): AAGTGCTTATAGTGCAGG (length 18 nt)

[0192] F′-20a (5′→3′): CCTGCACTATAAGCACTT (length 18 nt)

[0193] Splint-a-20a-25 (5′→3′): GTTATTGTTACTACCTGCAC (length 20 nt)

[0194] Splint-b-20a-25 (5′→3′): AAGCACTTTATTGTTTTGGC (length 20 nt)

[0195] 2) Connect into a ring

[0196] Control group (without target miR20 a): The final concentration of Probe-25 was 20nM, the final concentration of Splint-a-20a-25 was 100nM, the final concentration of Splint-b-20a-25 was 100nM, and the final concentration of T4 Rnl2 buffer was 1×. The reaction was carried out at 80℃ for 5min, and then the temperature was lowered to 20℃ at a rate of 0.1℃ / s and maintained for 20min for annealing. Then, T4 Rnl2 was added at a final concentration of 0.01U / μL and 1U / μL of RNase inhibitor, with a total volume of 10μL. The rest was supplemented with water, and after ligation at 45℃ for 30min, T4 Rnl2 was inactivated at 85℃ for 5min.

[0197] Experimental group (adding target miR20 a): The final concentrations of miR20 a were 10nM, 1nM, 0.1nM, 10pM and 1pM, respectively, the final concentrations of Probe-25 were 20nM, Splint-a-20a-25 were 100nM, Splint-b-20a-25 were 100nM, and the final concentration of T4 Rnl2 buffer was 1×. The reaction was carried out at 80℃ for 5min, and then the temperature was lowered to 20℃ at a rate of 0.1℃ / s and kept for 20min for annealing. Then, T4 Rnl2 was added at a final concentration of 0.01U / μL and 1U / μL of RNase inhibitor, with a total volume of 10μL, and the rest was supplemented with water. After ligation at 45℃ for 30min, T4 Rnl2 was inactivated at 85℃ for 5min.

[0198] 3) RNase R digestion to remove linear RNA

[0199] Take 8 μL from the ligation reaction system, add RNase R buffer to a final concentration of 1×, RNase R to a final concentration of 0.2 U / μL, and the total volume is 10 μL. Make up the rest with water. After reacting at 37°C for 10 minutes, inactivate RNase R at 75°C for 10 minutes.

[0200] 4) RT-RCA amplification reaction

[0201] Take 2 μL from the enzyme digestion reaction system, add dNTPs to a final concentration of 500 μM, M-MLV buffer to a final concentration of 1×, M-MLV to a final concentration of 2 U / μL, RNase inhibitor to a final concentration of 1 U / μL, and a total volume of 10 μL. Make up the rest with water. After amplification at 42°C for 1 hour, inactivate M-MLV at 85°C for 5 minutes.

[0202] 5) Constant temperature exponential amplification reaction

[0203] Take 2 μL from the RT-RCA reaction system, add 0.2 U / μL Bst 2.0 DNA Polymerase, 1× Isothermal Amplification Buffer, the final concentration of dNTPs is 500 μM, the final concentration of primer F-159 / F′-159 is 1 μM, the final concentration of fluorescent dye SYBR Green Ι is 1×, the total volume is 10 μL, the rest is made up with water, and react at 60°C for 90 min.

[0204] The results are as follows Fig.10 and Fig.11 As shown: Using the probe chain Probe-25, high-sensitivity detection of the target miR20 a can be achieved, and its detection limit can reach 1pM, and there is a good linear relationship in the range of 1pM to 10nM.

[0205] Example 9

[0206] This example verifies the feasibility of detecting the target miR155 with a probe length of 25 nt. The specific steps are as follows:

[0207] 1) Raw materials:

[0208] miR155 (5′→3′): UUAAUGCUAAUCGUGAUAGGGGU (length 23 nt)

[0209] Probe-25 (5′→3′): UAACAAUAACAAUCAGCCAAAACAA (length 25 nt)

[0210] F-155 (5′→3′): TAATGCTAATCGTGATAGG (length 19 nt)

[0211] F′-155 (5′→3′): CTATCACGATTAGCATTAA (length 19 nt)

[0212] Splint-a-155-25 (5′→3′): TTAGCATTAATTGTTTTGGC (length 20 nt)

[0213] Splint-b-155-25 (5′→3′): GTTATTGTTAACCCCTATCA (length 20 nt)

[0214] 2) Connect into a ring

[0215] Control group (without target miR155): The final concentration of Probe-25 was 20nM, the final concentration of Splint-a-155-25 was 100nM, the final concentration of Splint-b-155-25 was 100nM, and the final concentration of T4 Rnl2 buffer was 1×. The reaction was carried out at 90℃ for 3min, and then the temperature was lowered to 25℃ at a rate of 0.1℃ / s for 5min for annealing. Then, T4Rnl2 was added at a final concentration of 0.01U / μL and 1U / μL of RNase inhibitor, with a total volume of 10μL. The rest was supplemented with water, and after ligation at 45℃ for 30min, T4 Rnl2 was inactivated at 85℃ for 5min.

[0216] Experimental group (adding target miR155): the final concentrations of miR155 were 10nM and 1nM, respectively, the final concentrations of Probe-25 were 20nM, Splint-a-155-25 were 100nM, Splint-b-155-25 were 100nM, and the final concentration of T4Rnl2buffer was 1×. The reaction was carried out at 90℃ for 3min, and then the temperature was lowered to 25℃ at a rate of 0.1℃ / s for 5min for annealing. Then, T4 Rnl2 was added at a final concentration of 0.01U / μL and 1U / μL of RNase inhibitor. The final concentration of RNase inhibitor was 1U / μL, and the total volume was 10μL. The rest was supplemented with water. After ligation at 45℃ for 30min, T4 Rnl2 was inactivated at 85℃ for 5min.

[0217] 3) RNase R digestion to remove linear RNA

[0218] Take 8 μL from the ligation reaction system, add RNase R buffer to a final concentration of 1×, RNase R to a final concentration of 0.2 U / μL, and the total volume is 10 μL. Make up the rest with water. After reacting at 37°C for 10 minutes, inactivate RNase R at 75°C for 10 minutes.

[0219] 4) RT-RCA amplification reaction

[0220] Take 2 μL from the enzyme digestion reaction system, add dNTPs to a final concentration of 500 μM, M-MLV buffer to a final concentration of 1×, M-MLV to a final concentration of 2 U / μL, RNase inhibitor to a final concentration of 1 U / μL, and a total volume of 10 μL. Make up the rest with water. After amplification at 42°C for 1 hour, inactivate M-MLV at 85°C for 5 minutes.

[0221] 5) Constant temperature exponential amplification reaction

[0222] Take 2 μL from the RT-RCA reaction system, add 0.2 U / μL Bst 2.0 DNA Polymerase, 1× Isothermal Amplification Buffer, the final concentration of dNTPs is 500 μM, the final concentration of primer F-159 / F′-159 is 1 μM, the final concentration of fluorescent dye SYBR Green Ι is 1×, the total volume is 10 μL, the rest is made up with water, and react at 60°C for 90 min.

[0223] The results are as follows Fig.12 As shown: Using the probe chain Probe-25, the target miR155 can be detected.

[0224] The above description is only a preferred embodiment of the present invention, and is not intended to limit the present invention. Although the present invention has been described in detail with reference to the above embodiments, those skilled in the art can still modify the technical solutions described in the above embodiments, or replace some of the technical features therein by equivalents. Any modification, equivalent replacement, modification, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A method for sensitively detecting intact miRNA, characterized in that: The following steps are involved: (1) Designing an RNA probe chain with a length of 25-60 nt, and designing two DNA auxiliary chains based on the sequence information of the target miRNA and the probe chain. The DNA auxiliary chains are 14-20 nt in length and are complementary to the probe chain and the target miRNA chain by 7-13 nt respectively; Design a pair of primers F / F′ with a length of 18-23 nt, wherein primer F contains a 18-23 nt sequence complementary to the target miRNA, and primer F′ contains a 18-23 nt sequence identical to the target miRNA; (2) The two DNA auxiliary chains, the probe chain and the miRNA are mixed with a ligase buffer solution, reacted at 80-90°C for 3-5 minutes, then cooled to 20-25°C at a rate of 0.1°C / s and maintained for 5-20 minutes for annealing, and then a ligase is added; the two DNA auxiliary chains, the probe chain and the complete target miRNA are hybridized after annealing to form two Nick structures, and the Nick is closed under the action of the ligase to form a circular RNA; (3) adding RNase R to the reaction system of step (2), reacting at 25-37° C. for 10-30 min, removing the linear RNA, and obtaining the circular RNA; (4) adding reverse transcriptase to the reaction system of step (3), using circular RNA as a template and one or two DNA auxiliary chains added in step (2) as primers, maintaining at 42-50° C. for 30-120 min, and performing a rolling circle reverse transcription reaction to generate a long repetitive single-stranded DNA product; (5) Add Bst 2.0 DNA polymerase, primer F / F′ and fluorescent dye to the reaction system of step (4), place in a qPCR instrument at 55-65° C. for 60-120 min; use the long repetitive single-stranded DNA generated in step (4) as a template and F / F′ as a primer to perform a constant temperature exponential amplification reaction and detect the fluorescent signal.

2. The method for sensitively detecting complete miRNA according to claim 1, characterized in that: In the step (1), the GC content of the probe chain is greater than 20%; preferably, the GC content of the probe chain is 30-70%.

3. The method for sensitive detection of complete miRNA according to claim 2, characterized in that: When the GC content of the probe chain and the target miRNA is 50-70%, the corresponding DNA auxiliary chain length is 14-18 nt; when the GC content of the probe chain and the target miRNA is 30-50%, the corresponding DNA auxiliary chain length is 18-20 nt.

4. The method for sensitive detection of complete miRNA according to claim 1, characterized in that: The primers F and F' designed in the step (1) may be completely complementary; or have a 1-5 nt overhang at the 3' end and continuous 13-22 nt complementarity at the 5' end; or have a 1-5 nt overhang at the 5' end and continuous 13-22 nt complementarity at the 3' end.

5. The method for sensitive detection of complete miRNA according to claim 1, characterized in that: In the step (2), the concentration of the probe chain is 20-200 nM, and the concentration of the two DNA auxiliary chains is 40-1000 nM.

6. The method for sensitive detection of complete miRNA according to claim 1, characterized in that: In the step (2), the ligase is DNA ligase or T4 RNA ligase 2, the concentration of the ligase is 0.01-1.0 U / μL, and the ligation conditions are: 25-50° C. for reaction for 5-120 min; the final concentration of the ligase buffer solution is 0.05-2 times the standard concentration.

7. The method for sensitively detecting intact miRNA according to claim 1, characterized in that: In the ligation reaction of step (2), the incomplete miRNA whose end is partially hydrolyzed forms a gap structure after hybridization with the probe strand and the two DNA auxiliary strands, which is difficult or impossible to be connected into a closed ring structure under the action of the ligase.

8. The method for sensitive detection of complete miRNA according to claim 1, characterized in that: In the step (3), the concentration of RNase R is 0.1-1.0 U / μL.

9. The method for sensitively detecting intact miRNA according to claim 1, characterized in that: The concentration of the reverse transcriptase in step (4) is 1.0-10 U / μL.

10. The method for sensitive detection of complete miRNA according to claim 1, characterized in that: The concentration of primers F and F' in step (5) is 0.1-5.0 μM; the concentration of Bst 2.0 DNA polymerase is 0.1-1.0 U / μL.

Images