Exosome circRNA as molecular marker for diagnosing aortic valve calcification and application thereof

Abstract

The invention discloses application of exosome circRNA (Ribonucleic Acid) as a molecular marker for diagnosing aortic valve calcification, and relates to the technical field of molecular diagnosis, and the molecular marker is any one or a combination of more than two of the exosomes of hsacirc0087765, hsacirc0062397, hsacirc0000098, hsacirc0074944, hsacirc0009155 and hsacirc0131642. The invention also discloses an application of the exosome circRNA as the molecular marker for diagnosing aortic valve calcification, the exosome circRNA is used as a marker for preparing a kit, a microarray or a biological chip for diagnosing aortic valve calcification, and the molecular marker provided by the invention has the advantages that the detection accuracy of the aortic valve calcification is effectively improved; the P value of the combination of the molecular marker is less than 0.05, the log fold change (FC) is greater than 2, and the molecular marker has obvious differential expression compared with a healthy control group.

Description

Technical field:

[0001] The present invention relates to the technical field of molecular diagnosis, and in particular to a combination of plasma exosome circRNAs used as markers for diagnosing aortic valve calcification. Background technology:

[0002] Calcific aortic valve disease (CAVD) is a progressive disease of the elderly with high morbidity and mortality. The main pathophysiological changes are calcification of aortic valve leaflets, which leads to valve stiffening and hemodynamic changes, thus affecting cardiac function. In the past, it was believed that CAVD was an age-related degenerative disease, which was a process of degeneration and hardening of valve tissue with aging. At present, there is a lack of effective clinically available drug treatment for CAVD, and its main treatment is aortic valve replacement surgery. However, patients undergoing surgery will inevitably bear higher medical and surgical risks and economic burdens. Therefore, understanding the molecular mechanism of CAVD and finding new molecular biomarkers are crucial to improve the diagnosis of the disease and achieve early prevention and early intervention of the disease.

[0003] Exosomes are nanoscale double-layer membrane vesicles with a diameter of 40-100nm, which are widely distributed in blood, saliva, urine and other body fluids. Exosomes can carry proteins, liposomes, non-coding RNA and mRNA to target tissues, and regulate tumors, immunity and cardiovascular diseases by participating in cell-to-cell interactions.

[0004] Circular RNA (circRNA) is a type of non-coding RNA that forms a covalently closed structure by reverse splicing of precursor RNA (pre-mRNA). Studies have found that exosomes are rich in stable circRNA. CircRNA has important characteristics such as conservation, versatility, stability, and tissue or developmental stage specificity. A large number of studies have shown that circular RNA plays an important role in cardiovascular diseases such as atherosclerosis, myocardial infarction, and heart failure. The above characteristics make circRNA have a very broad prospect in the development and application of ideal diagnostic markers for clinical diseases.

[0005] Compared with free RNA in the blood, exosome-derived RNA has several advantages as a biomarker. On the one hand, the exosome membrane effectively protects the contents from RNase degradation, thereby maintaining its integrity and functionality. On the other hand, circRNA is stable and stably and abundantly expressed in blood, saliva and exosomes, and is a reliable indicator for early diagnosis, prevention and early intervention of aortic valve calcification. Human serum exosomes are rich in complete and stable circRNA, which has great potential as a biomarker for early diagnosis of aortic valve calcification. In the prior art, an invention patent application with publication number CN113667733A discloses an application of circRNA in the development of a diagnostic kit and therapeutic drugs for aortic valve calcification. In this invention, circRNA PRDM5 in calcified aortic valve tissue is significantly upregulated compared with normal aortic valve tissue, and can also be used as a target gene for the preparation of drugs for the treatment of aortic valve calcification. Although the technical solution disclosed in this patent can be used for drug development and diagnosis, its diagnostic value as a molecular marker for aortic valve calcification is not clear, and its circRNA is derived from valve tissue rather than plasma exosomes, which is not suitable for early clinical diagnosis of aortic valve calcification. Therefore, it is necessary to propose an exosomal circRNA as a molecular marker for diagnosing aortic valve calcification and its application to solve the above problems. Summary of the invention:

[0006] 1. Technical issues to be solved

[0007] In view of the above background, the present invention proposes exosomal circRNA as a molecular marker for diagnosing aortic valve calcification, which can be applied to the clinical early diagnosis of aortic valve calcification, and has solved the problem that the prior art lacks effective means for early diagnosis of aortic valve calcification.

[0008] (II) Technical solution

[0009] In order to achieve the above object, the present invention adopts the following technical scheme:

[0010] The use of exosome circRNA as a molecular marker for diagnosing aortic valve calcification, wherein the exosome circRNA is any one of exosome hsa_circ_0087765, hsa_circ_0062397, hsa_circ_0000098, hsa_circ_0074944, hsa_circ_0009155, and hsa_circ_0131642, and the molecular marker is any one of exosome hsa_circ_0087765, hsa_circ_0062397, hsa_circ_0000098, hsa_circ_0074944, hsa_circ_0009155, and hsa_circ_0131642 or a combination of two or more molecular markers, and the exosome is a plasma exosome, and the nucleotide sequence of the exosome is shown in SEQ ID NO: 1-6, specifically as follows,

[0011] The location of the exosome hsa_circ_0087765 on the genome is

[0012] chr9:100308499-100310379, the length of the cyclized sequence is 263 bases, and its nucleotide sequence is shown in SEQ ID NO:1, specifically:

[0013] GCAGTTTTCACAGTTTATTGGTTATTCCTGCCCGAAGTCAGAACTTTGACATCTTGCAAAGTGCCAT

[0014] CAGTAAGCATTTGGTTGGGTTGACTGTAATTCCTGACAGCACGGCTGGCTGTGTTTTTGGTGTTATCT

[0015] GTAAGCTCCTGGATCATACTTGTGTAGTTAGTGAGACTCTACTGCCATTTCTGGCTTCTTGTTGCTACAGTCTTCTTTATTTTCTGCTCACTATAGAGAAAGGGGAAGCAGAACATCTAAGAAAGAG;

[0016] The location of the exosome hsa_circ_0062397 on the genome is

[0017] chr22:20824325-20838731, the length of the cyclized sequence is 300 bases, and its nucleotide sequence is shown in SEQ ID NO:2, specifically:

[0018] GTCCAAAAGCTTCTTTGCATGTGTCCAGTGGATTTCCATGGGATCTCCAGTTAGATGAAAGACGGAG

[0019] AGATGCAGTGATTGCATTGGGCATTTTTCTGATTGAATCTGATCTTCAGCACAAAAGATTGTGTGGTTC

[0020] CTTACCTTCTTCGACTTCTCAAAGGTCTTCCAAAAGTGTATTGGGTAGAAGAAAGCACAGCTCGGAAA

[0021] GGCAGAGGTGCCCTCCCGGTTGCAGAGAGCTTCAGCTTCTGCTTGGTAACTCTGCTGTCTGATGTGGCCTATAGGGATCCTTCACTTAGGGATGAG;

[0022] The location of the exosome hsa_circ_0000098 on the genome is

[0023] chr1:100906851-100921841, the length of the cyclized sequence is 660 bases, and its nucleotide sequence is shown in SEQ ID NO:3, specifically:

[0024] ;

[0025] The location of the exosome hsa_circ_0074944 on the genome is

[0026] chr5:169681743-169684350, the length of the cyclized sequence is 291 bases, and its nucleotide sequence is shown in SEQ ID NO:4, specifically:

[0027] AATCCTTGAGCTTGATTTGATTGTCAGAGATGAAGACGGAAATATCTTGGACCCTGATAATACCAGTGTCATCAGCTTGTTCCATGCACATGAGGAAGCAACTGATAAAATCACAGAGCGTATCAAAGAAGAAATGTCAAAAGACC AGCCAGATTATGCAATGTATTCCCGGATCTCCTCATCCCCCACCCATAGCCTCTATGTGTTTGTGAGAAACTTTGTGTGCAGAATTGGGGAAGATGCTGAGCTCTTCATGTCTCTCTACGACCCCAACAAGCAAACGGTCATAAG;

[0028] The location of the exosome hsa_circ_0009155 on the genome is

[0029] chr11:46493607-46494204, the length of the cyclized sequence is 182 bases, and its nucleotide sequence is shown in SEQ ID NO:5, specifically:

[0030] GGACAATGGTGACAGATCCAGGCACCGAGCTCCACGCAATGCCCGGATGTCTGCACCTTCGCTTGGACGCTTTGTCCCAAGGCGTTTCTTGCTGCCTGAGTACTTGCCTTATGCTGGGATTTTTCATGAACGTGGACAGCCTGGCTTGGCTACTCACTCTTCTGTTAACAGGGTCCTGGCAG;

[0031] The location of the exosome hsa_circ_0131642 on the genome is

[0032] chr6:34646600-34654779, the length of the cyclized sequence is 353 bases, and its nucleotide sequence is shown in SEQ ID NO:6, specifically:

[0033] GAACCTACAAGCAGCAATTGGCGCCTATTATGACTTTGAGAGCCCAAACATCAGTGTGCCCTCTATGT

[0034] CCTTTGTTGAAGATGTCACCATAGGAGAAGGGGAGTCAATACCTCCGGATACTCAGTTTGTAAAAACA

[0035] TGGCGGATCCAGAATTCTGGGGCAGAGGCCTGGCCTCCAGGGGTTTGTCTTAAATATGTCGGGGGAGA

[0036] CCAATTTGGACATGTGAACATGGTGATGGTGAGATCGCTAGAGCCCCAAGAGATTGCAGATGTCAGCG

[0037] TCCAGATGTGCAGCCCCAGCAGAGCAGGAATGTATCAGGGACAGTGGCGGATGTGCACTGCTACAGGACTCTACTATGGAG.

[0038] Furthermore, the exosomal circRNA is used to prepare a marker for a kit, a microarray or a biochip for diagnosing aortic valve calcification.

[0039] Furthermore, the detection object of the exosomal circRNA expression amount is a primer or a probe.

[0040] Furthermore, the primers are primer combinations for detecting the expression of exosome circRNA by fluorescence quantitative detection, specifically:

[0041]

[0042] The present invention also provides a kit for diagnosing aortic valve calcification, wherein the kit is used to detect the expression level of plasma exosome circRNA, wherein the exosome circRNA is any one of hsa_circ_0087765, hsa_circ_0062397, hsa_circ_0000098, hsa_circ_0074944, hsa_circ_0009155, and hsa_circ_0131642, or a combination of two or more thereof.

[0043] The present invention clarifies the diagnostic efficacy of the combination of circRNA in the exosomes secreted by the valve endothelium and human plasma exosomes for diseases, and early diagnosis of aortic valve calcification disease can be achieved by in vitro detection of plasma exosome circRNA in blood.

[0044] (III) Beneficial effects

[0045] The beneficial effects produced by the present invention are:

[0046] (1) The present invention selects any one or a combination of two or more molecular markers from plasma exosomes hsa_circ_0087765, hsa_circ_0062397, hsa_circ_0000098, hsa_circ_0074944, hsa_circ_0009155, and hsa_circ_0131642 as molecular markers for the expression of exosome circRNA, which effectively improves the detection accuracy of aortic valve calcification. Through experimental verification, the P value of the combination of molecular markers is less than 0.05, and |log fold change (FC)|>1, which has significant differential expression relative to the healthy control group, which will help explore the pathogenesis of this disease and provide a new direction for the diagnosis of CAVD. (2) The present invention discloses molecular markers for diagnosing aortic valve calcification derived from plasma exosome circRNA and their applications. RT-qPCR results showed that six human plasma exosomal circRNAs, including hsa_circ_0087765, hsa_circ_0062397, hsa_circ_0000098, hsa_circ_0074944, hsa_circ_0009155, and hsa_circ_0131642, were differentially expressed between patients with aortic valve calcification and healthy controls. The ROC curve was used to analyze the diagnostic efficacy of the six plasma exosomal circRNAs, and the results showed that the AUC values ​​of the above exosomal circRNAs were 0.898, 0.874, 0.833, 0.760, 0.863, and 0.857, respectively.

[0047] (3) The present invention proves that the above six plasma exosome circRNAs can be used as molecular diagnostic markers for aortic valve calcification. They are made into diagnostic kits, microarrays or biochips, and aortic valve calcification is quickly diagnosed and determined by detecting the expression of plasma exosome circRNA in subjects: when the expression of exosome hsa_circ_0087765, hsa_circ_0062397, hsa_circ_0000098, hsa_circ_0074944, hsa_circ_0009155, and hsa_circ_0131642 is upregulated, it indicates that the subject suffers from aortic valve calcification, which has important clinical application value.

[0048] (4) The kit provided by the present invention diagnoses aortic valve calcification by detecting the expression of plasma exosome circRNA, wherein any one or a combination of two or more molecular markers among the exosomes hsa_circ_0087765, hsa_circ_0062397, hsa_circ_0000098, hsa_circ_0074944, hsa_circ_0009155, and hsa_circ_0131642 effectively improves the detection accuracy of aortic valve calcification, and the P value of the combination of molecular markers is less than 0.05, and |log fold change (FC)| is greater than 2, which has significant differential expression compared with the healthy control group, providing a new and effective solution for the clinical early detection of aortic valve calcification disease. Description of the drawings:

[0049] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the drawings required for use in the embodiments are briefly introduced below.

[0050] Figure 1 The co-culture system of aortic valve endothelial cells and aortic valve interstitial cells (hVEC) under different shear stress stimulation OSS / hVIC OM VS hVEC LSS / hVIC OM ) pattern diagram.

[0051] Figure 2 hVEC OSS / hVIC OM Group and hVEC LSS / hVIC OM After adding exosome inhibitors to the culture medium of endothelial cells in group A, the effect on osteogenic differentiation of VIC was detected by Alizarin red staining;

[0052] Figure 3 hVEC OSS / hVIC OM Group and hVEC LSS / hVIC OM TEM images of exosomes in the culture medium of endothelial cells in group A;

[0053] Figure 4 hVEC OSS / hVIC OM Group and hVEC LSS / hVIC OM The results of the analysis of the size of exosomes in the culture medium of endothelial cells in the group;

[0054] Figure 5The images are protein expression images of exosome-specific markers. NC-Exo represents the healthy control group; AVC-Exo represents the aortic valve calcification group;

[0055] Figure 6 hVEC OSS / hVIC OM Group and hVEC LSS / hVIC OM Hierarchical clustering results of microarray analysis of circRNA expression differences in exosomes from endothelial cell culture media of the two groups;

[0056] Figure 7 RT-qPCR was used to verify the differential expression of 6 highly conserved circRNAs: hsa_circ_0087765, hsa_circ_0062397, hsa_circ_0000098, hsa_circ_0074944, hsa_circ_0009155, and hsa_circ_0131642 in plasma exosomes of patients with aortic valve calcification and healthy controls;

[0057] Figure 8 The diagnostic efficacy of 6 highly conserved exosomal circRNAs: hsa_circ_0087765, hsa_circ_0062397, hsa_circ_0000098, hsa_circ_0074944, hsa_circ_0009155, and hsa_circ_0131642 for aortic valve calcification;

[0058] Fig. 9 ROC curve analysis of the diagnostic efficacy of the hsa_circ_0087765, hsa_circ_0062397, hsa_circ_0000098, hsa_circ_0074944, hsa_circ_0009155, and hsa_circ_0131642 molecular marker combination for aortic valve calcification. Specific implementation method:

[0059] The technical solutions in the embodiments of the present invention will be described clearly and completely below in conjunction with the accompanying drawings in the embodiments of the present invention.

[0060] Example 1: To verify the effect of valvular endothelial cells on aortic valve calcification under pathogenic shear stress stimulation, a co-culture system of aortic valve endothelial cells and aortic valve interstitial cells (hVEC) was constructed under different shear stress stimulations. OSS / hVIC OM VS hVEC LSS / hVIC OM), and treated them with exosome inhibitor GW4869 respectively to observe the effect of exosomes on the interaction between the two. The specific experimental plan is:

[0061] The hVEC (bottom of the membrane) and hVIC (top of the membrane) were co-cultured using a parallel plate co-culture flow system (ibidi pump system 10902, ibidi, Munich, Germany) with a 0.5 μm pore size ibiPore siN membrane (85216-S, Falcon cell culture inserts; Becton Dickinson) as a carrier. First, hVECs were plated on the bottom of the cell culture membrane for 6 hours, and then the endothelial cell culture surface was placed face down in a 6-well plate containing a dedicated culture medium (CC-3202, EGM-2) containing 2% FBS, 100 μg / mL streptomycin and 100 U / mL penicillin. Next, hVICs were inoculated on the surface of the culture membrane. After hVECs and hVICs adhered to both sides of the cell culture membrane, they were placed in a parallel plate co-culture flow system containing a polycarbonate scaffold.

[0062] hVEC shear stress conditions were set up for grouping: simulated laminar shear stress on the ventricular side (5 dynes / cm2 laminar flow) and oscillatory shear stress on the aortic surface (1Hz oscillatory flow, ±5 dynes / cm2 laminar flow), and the control group was static culture conditions.

[0063] The results suggest that exosome inhibitors can significantly reduce hVEC OSS / hVIC OM The osteogenic differentiation of valvular interstitial cells in the system was shown. This indicates that valvular endothelial cells stimulated by pathogenic shear stress can regulate aortic valve calcification by secreting exosomes. Figure 1 and Figure 2 .

[0064] Embodiment 2:

[0065] hVEC OSS / hVIC OM and hVEC LSS / hVIC OM Culture system double valve endothelial cell culture medium exosomes, -80 ℃ stored in time.

[0066] In the present invention, the Exoquick kit (System Biosciences) was used to extract exosomes from the sample and fixed on a sample-carrying copper grid. After staining and drying, the exosome morphology was identified using a transmission electron microscope (JEOL-1230); the exosome particle size was analyzed using a ZetaView PMX 110 particle tracker, and the exosome-specific marker protein was analyzed using a protein blotting experiment. The transmission electron microscope TEM image is shown in Figure 3 ; Nanoparticle tracking analysis (NTA) results are shown in Figure 4 Western blot results are shown in Figure 5 (TSG101, CD9 and CD81). The results showed that the extracted vesicles were consistent with the characteristics of exosomes in terms of morphology, particle size distribution and specific protein markers.

[0067] Subsequently, high-throughput sequencing was performed to analyze the differences in circRNA expression in the extracted exosomes. Figure 6 The results suggested that under the stimulation of pathogenic shear force, six highly conserved exosomal circRNAs in the exosomes secreted by valvular endothelial cells were associated with aortic valve calcification, namely hsa_circ_0087765, hsa_circ_0062397, hsa_circ_0000098, hsa_circ_0074944, hsa_circ_0009155, and hsa_circ_0131642. The specific nucleic acid sequences are shown in SEQ ID NO: 1-6.

[0068] Embodiment three:

[0069] In order to further detect the correlation between circRNA in exosomes and aortic valve calcification and the diagnostic efficacy of aortic valve calcification, serum exosomes from 32 patients in the healthy control group and aortic valve calcification group were further collected and stored at -80°C in time. The ethics committee was approved before blood sample collection; all subjects signed written informed consent. The exosome extraction scheme is shown in Example 2. The above-mentioned circRNA was verified by qRT-PCR in serum exosomes. The specific experimental scheme is as follows:

[0070] 1. Exosome RNA extraction

[0071] (1) Take an appropriate amount of exosomes in a 1.5 ml EP tube, add 800 μl Trizol reagent (Invitrogen), mix thoroughly, and lyse for 10 min. Add 250 μL chloroform to the Trizol-sample mixture, mix thoroughly, and let stand on ice for 5 min. Centrifuge the mixture at 4°C, 10,000 g, for 10 min.

[0072] (2) Carefully pipette 500 μL of the supernatant into a 1.5 mL EP tube in a clean bench. Add an equal volume of 4°C precooled isopropanol, invert to mix, and let stand at -20°C for 15 min.

[0073] (3) Centrifuge the solution at 4°C, 10,000 g for 10 min, carefully discard the liquid, add 1 mL of 75% ethanol precooled at 4°C, invert several times to wash the RNA precipitate, and centrifuge at 4°C, 10,000 g for 5 min. Discard the liquid and dry in a clean bench for several minutes to evaporate the ethanol. Add 50 μL of RNase-Free Water to fully dissolve the RNA.

[0074] 2. First-strand cDNA synthesis (EntiLink TM 1st Strand cDNA Synthesis Kit, ELKBiotechnology, EQ003)

[0075] (1) Prepare the following reaction mixture on ice.

[0076] Reagents Usage RTprimerMix* 2.0μL dNTPs (2.5 mM each) 1.0μL RNA To15.0μL

[0077] Incubate at 70°C for 5 min on a PCR instrument and quickly cool on ice for 2 min.

[0078] (2) Prepare the following reaction solution on ice

[0079]

[0080] Incubate at 37°C for 60 min, 85°C for 5 min, then reduce to 4°C

[0081] 3. Fluorescence quantitative PCR (EnTurbo TM SYBR Green PCR SuperMix, ELK Biotechnology, EQ001)

[0082] (1) The reaction procedure is: pre-denaturation at 95°C for 3 min

[0083] Cycle (40 times) 95℃, 10s→58℃, 30s→72℃, 30s

[0084] Melting curve instrument default settings

[0085] (2) The reaction system is:

[0086] Reagents Usage 2×MasterMix 5.0μL Primer working solution (2.5μM) 1.0μL Template 1.0μL <![CDATA[ddH2O]]> 2.0μL Rox 1.0μL

[0087] 4. QRT-PCR detection

[0088] The exosome circRNA was analyzed using a Stepone plus fluorescent quantitative PCR instrument (Applied Biosystems), and each sample was analyzed three times. Table 1 shows the nucleic acid sequences of the six circRNAs and their forward and reverse primer sequences. The primer pairs were designed and synthesized by Jikai, and the sensitivity and specificity of the primers were explored using NCBI blast comparison analysis. The qPCR kit was purchased from TAKARA. GAPDH was used as an external reference, and Log2 (2-ΔΔCT) represented the relative expression level of the target gene.

[0089] Table 1 Forward and reverse primer sequences of exosome circRNA and GAPDH

[0090]

[0091] 5. QRT-PCR results analysis

[0092] Results Figure 7 The expression of hsa_circ_0087765, hsa_circ_0062397, hsa_circ_0000098, hsa_circ_0074944, hsa_circ_0009155, and hsa_circ_0131642 was detected in the plasma exosomes of 32 healthy controls and 32 patients with aortic valve calcification. The results showed that compared with the healthy control group, the expression of the six circRNAs in the plasma exosomes of patients with aortic valve calcification was upregulated, and the difference was statistically significant.

[0093] Statistical analysis and plotting were performed using R language and SPSS 22.0, and the area under the curve was calculated to evaluate the diagnostic efficacy of exosomal circRNA. ROC curve analysis of the expression levels of 6 plasma exosomal circRNAs is shown in Figure 5 The results showed that the AUC values ​​of the above exosomes hsa_circ_0087765, hsa_circ_0062397, hsa_circ_0000098, hsa_circ_0074944, hsa_circ_0009155, and hsa_circ_0131642 were 0.898, 0.874, 0.833, 0.760, 0.863, and 0.857, respectively. Figure 8. These six exosomes hsa_circ_0087765, hsa_circ_0062397, hsa_circ_0000098, hsa_circ_0074944, hsa_circ_0009155, and hsa_circ_0131642 were investigated as a combination of molecular markers. The results showed that the AUC value of the molecular marker combination reached 0.928, which was higher than that of a single indicator (P<0.0001), and the sensitivity and specificity were 96.8% and 95.0%, respectively. It is proved that the exosome circRNA combination has good diagnostic efficacy for aortic valve calcification. Results are shown in Fig. 9 .

[0094] The kit provided by the present invention diagnoses aortic valve calcification by detecting the expression of plasma exosome circRNA, wherein any one or a combination of two or more molecular markers among the exosomes hsa_circ_0087765, hsa_circ_0062397, hsa_circ_0000098, hsa_circ_0074944, hsa_circ_0009155, and hsa_circ_0131642 effectively improves the detection accuracy of aortic valve calcification, and the P value of the combination of molecular markers is less than 0.05, |log fold change (FC)|>2, and has obvious differential expression compared with the healthy control group, providing a new and effective solution for the clinical early detection of aortic valve calcification disease.

[0095] Finally, it should be noted that the above embodiments are only used to illustrate the present invention and are not intended to limit the protection scope of the present invention. In addition, after reading the technical content of the present invention, those skilled in the art may make various changes, modifications or variations to the present invention, and all of these equivalent forms also fall within the protection scope defined by the present application.

Claims

1. Application of exosomal circRNA as a molecular marker for diagnosing aortic valve calcification, characterized by: The exosome circRNA is any one of exosome hsa_circ_0087765, hsa_circ_0062397, hsa_circ_0000098, hsa_circ_0074944, hsa_circ_0009155, and hsa_circ_0131642. The molecular marker is any one of exosome hsa_circ_0087765, hsa_circ_0062397, hsa_circ_0000098, hsa_circ_0074944, hsa_circ_0009155, and hsa_circ_0131642, or a combination of two or more molecular markers. The exosome is a plasma exosome. The nucleotide sequence of the exosome is shown in SEQ ID NO: 1-6, specifically as follows, The nucleotide sequence of the exosome hsa_circ_0087765 is: GCAGTTTTTCACAGTTTATTGGTTATTCCTGCCCGAAGTCAGAACTTTGACATCTTGCAAAGTGCCATCAGTAAGCATTTGGTTGGGTTGACTGTAATTCCTGACAGCACGGCTGGCTGTGTTTTTGGTGTT ATCTGTAAGCTCCTGGATCATACTTGTGTAGTTAGTGAGACTCTACTGCCATTTCTGGCTTCTTGTTGCTACAGTCTTCTTTATTTTCTGCTCACTATAGAGAAAGGGGAAGCAGAACATCTAAGAAAGAG; The nucleotide sequence of the exosome hsa_circ_0062397 is: GTCCAAAAGCTTCTTTGCATGTGTCCAGTGGATTTCCATGGGATCTCCAGTTAGATGAAAGACGGAGATGCAGTGATTGCATTGGGCATTTTTCTGATTGAATCTGATCTTCAGCACAAAGATTGTGTGGTTCCTTACCTTCTTCGA CTTCTCAAAGGTCTTCCAAAAGTGTATTGGGTAGAAGAAAGCACAGCTCGGAAAGGCAGAGGTGCCCTCCCGGTTGCAGAGAGCTTCAGCTTCTGCTTGGTAACTCTGCTGTCTGATGTGGCCTATAGGGATCCTTCACTTAGGGATGAG; The nucleotide sequence of the exosome hsa_circ_0000098 is: CTTAGGCTTGATTTCCGACTCTTTTCACATGTTTTTCGATAGCACTGCCATTTTGGCTGGACTGGCAGCTTCTGTTATTTCAAAATGGAGAGATAATGATGCTTTCTCCTATGGGTATGTTAGAGCGGAAGTTCTGGCTGGCTTTGTCAATGGCCTATTTTTGATCTTCACTGCTTTTTTTATTTTCTCAGAAGGAGTTGAGAGAGCATTAGCCCCTCCAGATGTCCACCATGAGAGACTGCTTCTTGTTTCCATTCTTGGGTTTGTGGTAAACCTAATAGGAATATTTGTTTTCAAACATGGAGGTCATGGACATTCTCATGGCTCTGGCCACGGACACAGTCATTCCCTCTTTAATGGTGCTCTAGATCAGGCACATGGCCATGTCGATCATTGCCATAGCCATGAAGTGAAACATGGTGCTGCACATAGCCATGATCATGCTCATGGACATGGACACTTTCATTCTCATGATGGCCCGTCCTTAAAAGAAACAACAGGACCCAGCAGACAGATTTTACAAGGTGTATTTTTACATATCCTAGCAGATACACTTGGAAGTATTGGTGTAATTGCTTCTGCCATCATGATGCAAAATTTTGGTCTGATGATAGCAGATCCTATCTGTTCAATTCTTATAGCCATTCTTATAGTTGTAAG; The nucleotide sequence of the exosomal hsa_circ_0074944 is as follows: AATCCTTGAGCTTGATTTGATTGTCAGAGATGAAGACGGAAATATCTTGGACCCTGATAATACCAGTGTCATCAGCTTGTTCCATGCACATGAGGAAGCAACTGATAAAATCACAGAGCGTATCAAAGAAGAAATGTCAAAAGACCAGCCAGATTATGCAATGTATTCCCGGATCTCCTCATCCCCCACCCATAGCCTCTATGTGTTTGTGAGAAACTTTGTGTGCAGAATTGGGGAAGATGCTGAGCTCTTCATGTCTCTCTACGACCCCAACAAGCAAACGGTCATAAG; The nucleotide sequence of the exosome hsa_circ_0009155 is: GGACAATGGTGACAGATCCAGGCACCGAGCTCCACGCAATGCCCGGATGTCTGCACCTTCGCTT GGACGCTTTGTCCCAAGGCGTTTCTTGCTGCCTGAGTACTTGCCTTATGCTGGGATTTTTCATGAACG TGGACAGCCTGGCTTGGCTACTCACTCTTCTGTTAACAGGGTCCTGGCAG; The nucleotide sequence of the exosome hsa_circ_0131642 is: GAACCTACAAGCAGCAATTGGCGCCTATTATGACTTTGAGAGCCCAAACATCAGTGTGCCCTCTATGTCCTTTGTTGAAGATGTCACCATAGGAGAAGGGGAGTCAATACCTCCGATACTCAGTTTGTAAAAACATGGCGGATCCAGAATTCTGGGGCAGAGGCCTGGCCTCCAGG GGTTTGTCTTAAATATGTCGGGGGAGACCAATTTGGACATGTGAACATGGTGATGGTGAGATCGCTAGAGCCCCAAGAGATTGCAGATGTCAGCGTCCAGATGTGCAGCCCCAGCAGAGCAGGAATGTATCAGGGACAGTGGCGGATGTGCACTGCTACAGGACTCTACTATGGAG.

2. The use of the exosomal circRNA according to claim 1 as a molecular marker for diagnosing aortic valve calcification, characterized in that: The exosome circRNA is used to prepare a marker for a kit, a microarray or a biochip for diagnosing aortic valve calcification.

3. The exosomal circRNA according to claim 2 is used as a molecular marker for diagnosing aortic valve calcification, characterized in that: The detection object of the exosome circRNA expression amount is a primer or a probe.

4. The exosomal circRNA according to claim 3 is used as a molecular marker for diagnosing aortic valve calcification, characterized in that: The primers are a primer combination for detecting the expression amount of the exosome circRNA by fluorescence quantitative detection.

5. A kit for diagnosing aortic valve calcification, characterized in that: The kit is used to detect the expression level of plasma exosome circRNA, and the exosome circRNA is any one of hsa_circ_0087765, hsa_circ_0062397, hsa_circ_0000098, hsa_circ_0074944, hsa_circ_0009155, and hsa_circ_0131642, or a combination of two or more thereof.

Images