A SNP molecular marker related to lambing number of sheep, primer set, kit, detection method and application

Abstract

The application provides a SNP molecular marker, a primer set, a kit, a detection method and application related to the lambing number of sheep, and belongs to the technical field of molecular markers.The application provides a SNP molecular marker related to the multiple lambing number of sheep, wherein the SNP site is located at the 35863472bp site on the 16th chromosome of sheep.The application provides a primer pair related to the SNP molecular marker, develops an amplification primer and an extension primer, uses the amplification primer to amplify the target genomic DNA, digests the amplification product by using a SAP enzyme, and then uses the extension primer to perform extension, so that an extension product is obtained.The application also develops a kit containing the primer pair and a method for performing the SNP molecular marker, and the method has the advantages of high sensitivity, high accuracy, good cost performance and the ability of simultaneously detecting a large number of samples.

Description

Technical Field

[0001] This invention belongs to the field of molecular marker technology, specifically relating to an SNP molecular marker, primer set, reagent kit, detection method, and application related to lambing number in sheep. Background Technology

[0002] Lambing is one of the most important economic traits in sheep. For sheep, increasing the number of lambs per litter is a crucial measure to improve production efficiency. Research using genomic methods can screen for candidate genes and molecular markers related to sheep reproductive traits at the whole genome level, enabling researchers to gain a deeper understanding of the genetic mechanisms of high lambing rates in sheep. This will bring significant economic benefits to the sustainable development of my country's sheep industry.

[0003] Sheep are one of my country's superior livestock breeds, and improving sheep reproductive performance can bring significant economic benefits to the sustainable development of my country's sheep industry. The FecB gene is the first major gene for prolificacy discovered in sheep, and other genes besides FecB have been identified and verified in multiple breeds to potentially influence lambing numbers. This use of candidate prolificacy genes has already been observed in cattle, pigs, horses, and sheep. Increased litter size in livestock can alter some economic traits, such as ovulation rate and farrowing rate, promote the breeding of new breeds, and improve overall herd productivity, which is beneficial for sheep breeding. Therefore, using whole-genome analysis of sheep lambing performance to explore the correlation between gene polymorphism and lambing numbers can serve as potential genetic molecular markers for sheep, providing a theoretical basis for improving lambing numbers and sheep breeding. However, currently, molecular markers related to the prolificacy trait in sheep are still lacking. Summary of the Invention

[0004] This invention provides a SNP molecular marker, primer set, kit, detection method, and application related to lambing number in sheep. The SNP molecular marker is closely related to lambing number in sheep, and sheep with high lambing numbers can be obtained by screening sheep with dominant genotypes.

[0005] This invention provides a SNP molecular marker associated with lambing number in sheep, wherein the SNP site is located at 35863472 bp on sheep chromosome 16, and the SNP site is located in the 3'UTR uncoding region of the LIFR gene.

[0006] In a preferred embodiment of the present invention, a polymorphism C / T exists at the SNP site, and T is the dominant genotype.

[0007] In a preferred embodiment of the present invention, the SNP site information is based on sheep genome sequence information version number Oar_v3.1.

[0008] The present invention also provides a primer set for detecting the above-mentioned SNP molecular marker, including a first primer, a second primer and an extension primer; wherein the nucleotide sequence of the first primer is shown in SEQ ID No. 1, the nucleotide sequence of the second primer is shown in SEQ ID No. 2, and the nucleotide sequence of the extension primer is shown in SEQ ID No. 3.

[0009] The present invention also provides a kit for detecting lambing count traits in sheep, comprising the above-described primer set.

[0010] In a preferred embodiment of the present invention, the kit further includes dNTPs, Taq DNA polymerase, MgCl2, PCR reaction buffer, and SAP enzyme.

[0011] In a preferred embodiment of the present invention, the working concentration of the first primer and the second primer is 0.50 μmol / L; the working concentration of the extension primer is 0.6–1.3 μmol / L.

[0012] The working concentration of the dNTPs is 25 μmol / L; the working concentration of the Taq DNA polymerase is 5 U / μL; the working concentration of the MgCl2 is 25 mmol / L; the PCR reaction buffer is 10× PCR reaction buffer; and the enzyme activity of the SAP enzyme is 1.7 U / μL.

[0013] The present invention also provides a method for detecting lambing number trait in sheep, comprising the following steps: (1) using the whole genome DNA of the sheep to be tested as a template, performing PCR amplification using the primer set above or the first and second primers of the primer set in the above kit to obtain PCR amplification products;

[0014] (2) The PCR amplification product described in step (1) is digested using SAP enzyme. Using the digested product as a template, an extension reaction is performed using the primer set or the extension primer set in the kit described above to obtain the extension product. The genotype of the extension product is then detected.

[0015] In a preferred embodiment of the present invention, the PCR amplification reaction program in step (1) is as follows: 94℃ pre-denaturation for 2 min; 94℃ denaturation for 20 s, 56℃ annealing for 30 s, 72℃ extension for 60 s, 45 cycles; 72℃ extension for 3 min.

[0016] The procedure for the extended reaction in step (2) is as follows: 94℃ for 30s; [94℃ for 5s, (52℃ for 5s, 80℃ for 5s)]; wherein (52℃ for 5s, 80℃ for 5s) is performed for 5 cycles, and [94℃ for 5s, (52℃ for 5s, 80℃ for 5s)] is performed for 40 cycles; 72℃ for 3min.

[0017] This invention also provides the application of the above-mentioned SNP molecular markers, primer kits, or reagent kits in marker-assisted breeding of sheep.

[0018] Beneficial Effects: This invention provides a SNP molecular marker associated with multiple births in sheep. The SNP site is located at position 35,863,472 bp (NC_056069.1(35998864..36109096)) on sheep chromosome 16; the SNP site is located in the 3'UTR uncoding region of the LIFR gene. Based on sheep genome sequence information version Oar_v3.1, a T / C mutation exists at this site, which is significantly correlated with multiple births in sheep.

[0019] The present invention also provides primer pairs associated with the SNP molecular markers and develops a pair of amplification primers and an extension primer. The amplification primers are used to amplify the target genomic DNA, and after the amplification product is digested with SAP enzyme, the extension primer is used to extend it to obtain an extension product containing the SNP molecular marker.

[0020] This invention also develops a kit containing the above-mentioned primer pairs, and a method for SNP molecular labeling using the kit or primer pairs, specifically including the use of Sequenom. SNP technology for detecting LIFR genotypes and predicting lambing numbers in Small-tailed Han sheep is more sensitive, accurate, and cost-effective, capable of simultaneously detecting dozens to hundreds of SNP loci in hundreds to thousands of samples. The LIFR gene has three genotypes: TT, TC, and CC. This invention utilizes Sequenom... SNP technology enables single nucleotide type detection, screening sheep with the TT genotype as those with a high lambing rate. Attached Figure Description

[0021] Figure 1 This is a graph showing the results of the mass spectrometry analysis. Detailed Implementation

[0022] This invention provides a SNP molecular marker associated with lambing number in sheep, wherein the SNP site is located at 35863472 bp on sheep chromosome 16, and the SNP site is located in the 3'UTR uncoding region of the LIFR gene.

[0023] The polymorphic SNP molecular markers described in this invention are based on sheep genome sequence information version number Oar_v3.1, and polymorphisms C / T exist at the SNP sites, with T being the dominant genotype. In an embodiment of this invention, a small-tailed Han sheep population was used as the screening population. It was found that mutations at the c.*127T>C site in the LIFR gene (ID: rs162302066) reduced lambing numbers. In future breeding processes, artificial selection is needed to increase the frequency of T at the c.*127T>C site, thereby assisting in the breeding of small-tailed Han sheep. Therefore, the c.*127T>C site of the LIFR gene described in this invention can serve as a potential molecular-assisted selection marker for the multi-lambing trait in sheep.

[0024] The present invention also provides a primer set for detecting the above-mentioned SNP molecular marker, including a first primer, a second primer and an extension primer; wherein the nucleotide sequence of the first primer is shown in SEQ ID No. 1, the nucleotide sequence of the second primer is shown in SEQ ID No. 2, and the nucleotide sequence of the extension primer is shown in SEQ ID No. 3.

[0025] The sequences of the primer set described in this invention are as follows:

[0026] First primer (SEQ ID No. 1): 5'-ACGTTGGATGGTTCTGTGGCTTTGAGACTG-3';

[0027] Second primer (SEQ ID No. 2): 5'-ACGTTGGATGTGTGAAGTGTTGCTAGTGGG-3';

[0028] Extension primer (SEQ ID No. 3): 5'-CCGACTTCACTCTCACAAGTT-3'.

[0029] The present invention also provides a kit for detecting lambing count traits in sheep, comprising the above-described primer set.

[0030] In a preferred embodiment of the present invention, the kit further includes dNTPs, Taq DNA polymerase, MgCl2, PCR reaction buffer, and SAP enzyme, wherein the working concentrations of the first and second primers are 0.50 μmol / L; the working concentration of the extension primer is 0.6–1.3 μmol / L; the working concentration of the dNTPs is 25 μmol / L; the working concentration of the Taq DNA polymerase is 5 U / μL; the working concentration of the MgCl2 is 25 mmol / L; the PCR reaction buffer is 10× PCR reaction buffer; and the SAP enzyme activity is 1.7 U / μL. The kit based on the present invention can be used via Sequenom. SNP technology is used to detect the number of lambs born in sheep. The kit described in this invention preferably also includes 10×SAP Buffer.

[0031] The present invention also provides a method for detecting lambing number trait in sheep, comprising the following steps: (1) using the whole genome DNA of the sheep to be tested as a template, performing PCR amplification using the primer set above or the first and second primers of the primer set in the above kit to obtain PCR amplification products;

[0032] (2) The PCR amplification product described in step (1) is digested using SAP enzyme. Using the digested product as a template, an extension reaction is performed using the primer set or the extension primer set in the kit described above to obtain the extension product. The genotype of the extension product is then detected.

[0033] This invention uses the whole genome DNA of the sheep to be tested as a template. There are no special requirements regarding the breed of sheep; any breed can be used. For example, in this embodiment, the Small-tailed Han sheep is used as the screening population, and Hu sheep, Cele black sheep, Sunite sheep, and Bamei meat sheep are used as validation populations. This invention does not specify a particular method for extracting the genome of the sheep to be tested; conventional animal cell genome extraction methods in the art are sufficient.

[0034] This invention utilizes a first primer, a second primer, and template DNA to prepare an amplification system, followed by PCR amplification. The reaction program is as follows: pre-denaturation at 94℃ for 2 min; denaturation at 94℃ for 20 s, annealing at 56℃ for 30 s, extension at 72℃ for 60 s, for 45 cycles; 72℃ for 3 min. After the PCR amplification is completed, the PCR amplification product is stored at 4℃. After the PCR amplification reaction is completed, the PCR amplification product contains the DNA fragment containing the target SNP site.

[0035] After obtaining the PCR amplification product, this invention digests the PCR amplification product using SAP enzyme to obtain the digested product. The digestion procedure of this invention includes: 37℃ for 40 min; 85℃ for 5 min. The digested product of this invention is preferably stored at 4℃. The digestion method of this invention can digest the primer sequences and remaining dNTPs in the PCR amplification reaction system.

[0036] After obtaining the digested product, the present invention uses the digested product as a template and performs an extension reaction using the above-mentioned extension primers to obtain the extended product. The procedure for the extension reaction of the present invention is as follows: 94℃ for 30s; [94℃ for 5s, (52℃ for 5s, 80℃ for 5s)]; wherein the (52℃ for 5s, 80℃ for 5s) is performed for 5 cycles, and the [94℃ for 5s, (52℃ for 5s, 80℃ for 5s)] is performed for 40 cycles; 72℃ for 3min.

[0037] After obtaining the extended product, the present invention uses matrix-assisted laser desorption / ionization time-of-flight mass spectrometry to analyze the extended product and determine the genotype of the LIFE gene.

[0038] This invention also provides the application of the above-mentioned SNP molecular markers, primer kits, or reagent kits in marker-assisted breeding of sheep.

[0039] Using the above-mentioned technical solution of the present invention, new sheep breeds can be rapidly cultivated. The new sheep breeds obtained by assisted breeding all have the characteristic of multiple lambs. For example, in the process of sheep assisted breeding, sheep with the genotype TT are selected as sheep with a high number of lambs.

[0040] To further illustrate the present invention, the following detailed description, in conjunction with embodiments, of the SNP molecular markers, primer sets, kits, detection methods, and applications related to sheep lambing numbers provided by the present invention, should not be construed as limiting the scope of protection of the present invention.

[0041] The reagent used in the embodiments of this invention: Complete Genotyping Reagent Kit for Compact; Gene amplification: ABI 9700Dual; Mass spectrometry spotting: MassARRAY Nanodispenser RS1000; Mass spectrometry analysis: MassARRAY Compact System; All reagent kits and instruments were purchased from Beijing Compass Biotechnology Co., Ltd.; and all primers were synthesized by Beijing Compass Biotechnology Co., Ltd.

[0042] The analysis method used in the embodiments of the present invention is as follows:

[0043] Genotype frequency (TT) = Number of individuals with genotype TT / Total number of individuals;

[0044] Genotype frequency (CT) = Number of individuals with genotype TC / Total number of individuals;

[0045] Genotype frequency (CC) = Number of individuals with genotype CC / Total number of individuals;

[0046] Gene frequency (T) = (genotype frequency of TT × 2 + genotype frequency of CT) / (total number of individuals × 2);

[0047] Gene frequency (C) = (genotype frequency of CC × 2 + genotype frequency of CT) / (total number of individuals × 2);

[0048] Polymorphic information content = 1 - (T gene frequency squared) - (C gene frequency squared) - 2 × (T gene frequency squared) × (C gene frequency squared).

[0049] Heterozygosity = 1 - (the square of the T gene frequency + the square of the C gene frequency);

[0050] Effective number of alleles = 1 / (1 - heterozygosity);

[0051] The p-value was calculated using SPSS 29.0 via a chi-square test.

[0052] Example 1

[0053] 1. Experimental materials

[0054] 384 small-tailed Han sheep were selected as the test subjects.

[0055] 2. Extraction of genomic DNA

[0056] Blood samples were collected from the jugular vein of sheep, and tissue DNA was extracted using a DNA extraction kit.

[0057] 3. Sequenom SNP technology for genotyping

[0058] Primers were designed targeting the 35863472 bp site on sheep chromosome 16, based on the sheep genome sequence version number Oar_v3.1.

[0059] The nucleotide sequences of the PCR amplification primers are as follows:

[0060] 2nd-PCRP (SEQ ID No. 2): ACGTTGGATGTGTGAAGTGTGCTAGTGGG;

[0061] 1st-PCRP (SEQ ID No. 1): ACGTTGGATGGTTCTGTGGCTTTGAGACTG;

[0062] The extended primer sequences are as follows:

[0063] W3 (SEQ ID No. 3): CCGACTTCACTCTCACAAGTT.

[0064] 4. The testing process is as follows:

[0065] (1) Extract genomic DNA from the sheep to be tested;

[0066] (2) Using the genomic DNA of the sheep to be tested as a template, PCR amplification reaction was carried out using the above primers 2nd-PCRP and 1st-PCRP; the PCR amplification reaction system was based on a 196-well PCR plate with 38% reagent loss, as shown in Table 1.

[0067] Table 1 PCR amplification system

[0068] reagents concentration Volume (μL) HPLC water NA 927.5 <![CDATA[PCR buffer containing 15 mM MgCl2]]> 10× 331.25 <![CDATA[MgCl2]]> 25mM 172.25 dNTPMix 25mM 53 2nd-PCRP + 1st-PCRP 0.5μM 530 HotStarTaq 5U / μL 106 DNA template 10 ng / μL 1 μL per well total 5μL per well

[0069] Reaction procedure: pre-denaturation at 94℃ for 2 min; denaturation at 94℃ for 20 s, annealing at 56℃ for 30 s, extension at 72℃ for 60 s, 45 cycles; 72℃ for 3 min. After the PCR amplification is completed, the PCR amplification product is stored at 4℃.

[0070] (3) Digest the PCR amplification products with SAP enzyme;

[0071] The digestion system was based on a 196-well PCR plate with 38% reagent loss, and the system is shown in Table 2.

[0072] Table 2 SAP enzyme digestion system

[0073]

[0074]

[0075] Digestion procedure: 37℃ for 40 min; 85℃ for 5 min; store at 4℃.

[0076] (4) Using the digested PCR amplification product as a template, the extension reaction was carried out using the extension primer W3.

[0077] The extension reaction system was based on a 196-well PCR plate with 38% reagent loss, and the system is shown in Table 3.

[0078] Table 3 Extended Reaction System

[0079] reagents concentration Volume (μL) water NA 400.2 iPLEXbufferpius 10× 106 iPLEXterminator NA 106 PCR amplification products 0.6–1.3 μM 426.1 iPlex enzyme NA 21.7 total 2μL per well

[0080] The procedure for the extended reaction was: 94℃ for 30s; [94℃ for 5s, (52℃ for 5s, 80℃ for 5s)]; of which (52℃ for 5s, 80℃ for 5s) was performed for 5 cycles, [94℃ for 5s, (52℃ for 5s, 80℃ for 5s)] was performed for 40 cycles; 72℃ for 3min.

[0081] (5) Analyze the extended products to determine the sheep LIFR genotype.

[0082] The resin-purified extension products were transferred to a 384-well SpectroCHIP (Sequenom) chip for MALDI-TOF-MS (matrix-assisted laser desorption / ionization time-of-flight mass spectrometry) reaction. The mass spectral peaks were detected using Typer 4.0 software, and the genotype of each target site was determined based on the mass spectral peak diagram.

[0083] Mass spectrometry analysis revealed that the PCR amplification product was 112 bp in size. The mass spectrometry results of the extension product are as follows: Figure 1 As shown: Among 384 small-tailed Han sheep, 209 had the TT type, 147 had the CT type, and 28 had the CC type at the c.*127T>C locus, with a detection rate of 99%.

[0084] Table 4. Statistical analysis of different genotypes at the 35863472bp locus on chromosome 16 of the sheep samples.

[0085]

[0086]

[0087] The polymorphism information content of the c.*127T>C site of the LIFR gene in small-tailed Han sheep is 0.31, which is low polymorphism (PIC<0.25); the P value of this site in small-tailed Han sheep is 0.76, which is in Hardy-Weinberg equilibrium (P>0.05).

[0088] Table 5 shows the statistical results of the association analysis between different genotypes at the 35863472 bp locus on chromosome 16 of the tested sheep and the number of lambs born in Xiaowei Han sheep. In Xiaowei Han sheep, the c.*127T>C locus of the LIFR gene was significantly correlated with the number of lambs born (P<0.05). Mutations at the c.*127T>C locus in the LIFR gene reduce the number of lambs born. In future breeding processes, artificial selection should be used to increase the frequency of the T locus at c.*127T>C to assist in the breeding of Xiaowei Han sheep. The c.*127T>C locus of the LIFR gene can serve as a potential molecular-assisted selection marker for the multi-lambing trait in sheep.

[0089] Table 5. Association analysis between different genotypes at the 35863472 bp locus on chromosome 16 of the tested sheep and the number of lambs born in Small-tailed Han sheep (STH) (mean ± standard error)

[0090]

[0091] Example 2

[0092] Using the same method as in Example 1, validation was performed on 96 high-quality prolific Cele Black sheep (Zhang Hui. Screening and population validation of key candidate genes for lambing number and growth traits in Cele Black sheep. Master's thesis, Hebei University of Engineering) and 96 Hu sheep with "multiple births per year and multiple lambs per litter" (Xie Rui. Genome-wide association analysis of lambing number trait in Hu sheep based on resequencing data. Animal Husbandry and Veterinary Medicine, 2021, 53). The results are shown in Table 6, indicating that TT is the dominant genotype in both Cele Black sheep and Hu sheep with prolific traits.

[0093] Table 6. Statistics on different genotypes at the 35863472bp locus on chromosome 16 between Hu sheep and Cele black sheep.

[0094]

[0095]

[0096] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A method for detecting the lambing count trait in sheep, characterized in that, Includes the following steps: (1) Using the whole genome DNA of the sheep to be tested as a template, PCR amplification was performed using the first primer and the second primer to obtain the PCR amplification product; The nucleotide sequence of the first primer is shown in SEQ ID No. 1, and the nucleotide sequence of the second primer is shown in SEQ ID No. 2; (2) The PCR amplification product described in step (1) was digested using SAP enzyme. Using the digested product as a template, an extension reaction was performed using extension primers to obtain an extension product. The extension product was analyzed using matrix-assisted laser desorption / ionization time-of-flight mass spectrometry to determine the genotype of the LIFE gene at the SNP site. Sheep with the genotype TT were sheep with a high number of lambs. The nucleotide sequence of the extension primers is shown in SEQ ID No.

3. The SNP locus is located at position 35863472 bp on sheep chromosome 16. Polymorphism C / T exists at the SNP locus, and T is the dominant genotype. The information of the SNP locus is based on sheep genome sequence information version number Oar_v3.

1.

2. The method according to claim 1, characterized in that, The PCR amplification reaction program in step (1) is as follows: 94℃ pre-denaturation for 2 min; 94℃ denaturation for 20 s, 56℃ annealing for 30 s, 72℃ extension for 60 s, 45 cycles; 72℃ extension for 3 min. The procedure for the extended reaction in step (2) is as follows: 94℃ for 30s; [94℃ for 5s, (52℃ for 5s, 80℃ for 5s)]; wherein (52℃ for 5s, 80℃ for 5s) is performed for 5 cycles, and [94℃ for 5s, (52℃ for 5s, 80℃ for 5s)] is performed for 40 cycles; 72℃ for 3min.

Images