SNP markers associated with body size traits of small-tail han sheep and application thereof

Abstract

The application belongs to the technical field of genetic breeding, and provides a SNP marker related to the body size trait of a large-size small-tail Han sheep and application thereof. The nucleotide sequence of the SNP marker is shown as SEQ ID NO. 1, wherein r in the sequence is G or A; when r is G, the genotype is GG or GA; and when r is A, the genotype is AA. The application successfully screens out 148 SNP markers closely related to the growth rate and body size of sheep by performing whole genome sequencing on common small-tail Han sheep and large-size small-tail Han sheep. On this basis, a PCR-RFLP genotyping method is established for one of the sites (Chr6:g.40293415A>G). The method provides a powerful tool for marker-assisted selection of small-tail Han sheep, and aims to breed a new strain with larger body size, faster growth rate and higher weight, thereby effectively accelerating the breeding process of small-tail Han sheep.

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of genetic breeding, and particularly relates to a SNP marker related to body size traits of large-size small-tail Han sheep and application thereof. BACKGROUND

[0002] With the continuous improvement of the quality of life, people's demand for mutton products is increasing, which promotes the sheep breeding industry to focus more on the optimization of mutton performance of sheep. However, the existing sheep local breeds in China are mostly meat and wool or skin and meat types, although they have strong fertility and good environmental adaptability, but they generally have the disadvantages of light weight, small size, etc. At present, the mutton sheep breeding industry in China relies on imports to a large extent, and needs to import high-quality commercial mutton sheep breeds from abroad to crossbreed with domestic local breeds. However, it is worth noting that disordered or blind crossbreeding may lead to the decline of excellent traits and performance of local sheep breeds, and even loss of genetic resources. Therefore, how to scientifically and efficiently tap the resources of domestic local sheep breeds and cultivate a new local sheep strain with large size, fast growth rate, high weight and independent intellectual property rights is particularly important.

[0003] Since body size and weight are quantitative traits, they are controlled by micro-effect polygenes and are easily affected by natural environment and feeding conditions. In addition, compared with pigs, sheep have relatively fewer litters, longer generation intervals and more difficult growth performance determination, so traditional breeding methods often lead to long breeding cycles and low accuracy. Single nucleotide polymorphism (SNP) refers to DNA sequence polymorphism caused by single nucleotide mutation in the genome. Because of its wide distribution in the genome, high genetic stability and convenient detection, SNP has become an important means of marker-assisted breeding of livestock.

[0004] Small-tail Han sheep is a famous local sheep breed in China, which is loved by breeders for its characteristics of estrus in four seasons, multiple births, and roughage tolerance, and is widely raised in many provinces and cities in China. However, the weight and growth rate of ordinary small-tail Han sheep still have obvious gaps compared with foreign commercial mutton sheep breeds. In addition, there are significant differences in growth rate and weight among individuals within the small-tail Han sheep breed. Large-size small-tail Han sheep is a new population selected from ordinary small-tail Han sheep, which has significantly higher weight, body height and body length than ordinary individuals, providing valuable breeding materials for cultivating a new small-tail Han sheep strain with large size and fast growth rate. However, there is currently a lack of molecular markers related to body size traits of large-size small-tail Han sheep, making early individual selection and breeding difficult. Therefore, the present application provides a SNP marker related to body size traits of large-size small-tail Han sheep and application thereof. SUMMARY

[0005] The present application aims to provide a SNP marker related to body size traits of large-size small-tail Han sheep and application thereof, and aims to solve the problems raised in the background.

[0006] The object of the present application is achieved by the following technical solutions.

[0007] The SNP marker related to the body size trait of small-tail Han sheep, wherein the SNP site corresponds to the A>G polymorphic site at position 40293415 on chromosome 6 of the sheep reference genome Oar_rambouillet_v1.0 version.

[0008] The nucleotide sequence of the SNP marker is shown as SEQ ID NO. 1, wherein r in the sequence is G or A; when r is G, the genotype is GG or GA; and when r is A, the genotype is AA.

[0009] Further, the primer pair for amplifying the SNP marker comprises SDL-M1-F and SDL-M1-R, and the nucleotide sequences are shown as SEQ ID NO. 2 and SEQ ID NO. 3 respectively.

[0010] Further, the method for detecting the SNP marker comprises the following steps:

[0011] Step 1, extracting the genomic DNA of small-tail Han sheep;

[0012] Step 2, performing PCR amplification on the genomic DNA obtained in step 1 by using the primer pair to obtain a PCR amplification product;

[0013] Step 3, performing genotyping detection on the PCR amplification product obtained in step 2, and the genotype is AA, GG or GA.

[0014] Further, the PCR amplification system comprises 2xPCR Master Mix 10 μL, DNA template 1 μL, SDL-M1-F and SDL-M1-R each 0.25 μL, and ddH2O 8.5 μL.

[0015] Further, the PCR amplification condition comprises: 95℃ pre-denaturation for 2 min; 94℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 30 s, a total of 30 cycles; and 72℃ extension for 5 min.

[0016] The application of the SNP marker related to the body size trait of small-tail Han sheep in the molecular marker assisted breeding related to the body size trait of small-tail Han sheep.

[0017] Compared with the prior art, the present application has the following beneficial effects:

[0018] The present application successfully screens 148 SNP markers closely related to the growth rate and body size of sheep by whole genome sequencing of common small-tail Han sheep and large-size small-tail sheep. On this basis, a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) genotyping method is established for one of the sites (Chr6:g.40293415A>G). This method provides a powerful tool for marker-assisted selection of small-tail Han sheep, aiming to breed new strains with larger body size, faster growth rate and higher body weight, thereby effectively accelerating the breeding process of small-tail Han sheep. BRIEF DESCRIPTION OF DRAWINGS

[0019] Figure 1 is the PCR amplification electrophoresis result; wherein, M: DL2000 DNA Marker; 1-10: large-size small-tail Han sheep; 11-17: common small-tail Han sheep.

[0020] Figure 2 is the PCR product enzyme digestion electrophoresis result of 17 small-tail Han sheep.

[0021] Figure 3 is the sequencing peak chart of AA, GA and GG genotypes.

[0022] Figure 4 is the genotyping result of 40 large-size small-tail Han sheep.

[0023] Figure 5 is the genotyping result of 56 common small-tail Han sheep. DETAILED DESCRIPTION

[0024] In order to have a clearer understanding of the technical features, objectives and beneficial effects of the present application, the technical solutions of the present application are described in detail below, but it should not be understood as limiting the scope of the present application.

[0025] The specific implementation of the present application is described in detail below in combination with specific examples.

[0026] Example 1;

[0027] (1) Selection of experimental animals;

[0028] Ten large-size small-tail Han sheep and seven common small-tail Han sheep were selected, and the phenotype data was counted, and the results are shown in Table 1:

[0029] Table 1 Comparison of phenotype data of large-size small-tail Han sheep and common small-tail Han sheep

[0030]

[0031]

[0032] From the data results of Table 1, it can be seen that the two groups have significant differences in the five traits of body weight, body height, body length, chest circumference and girth.

[0033] (2) Genomic extraction and sequencing;

[0034] The anticoagulated blood of the jugular vein of 17 small-tail Han sheep was collected, the blood DNA kit (EasyPure Blood Genomic DNA Kit) of Beijing Zhenzi Jin Biological Technology Co., Ltd. was used for DNA extraction, the quality of the DNA was detected by agarose gel electrophoresis and ultraviolet spectrophotometer, and then the DNA was used for library construction and sequencing. PE150 double-end sequencing was performed by using DNBSEQ-T7 platform, the sequencing read length was PE150, the sequencing depth of 17 individuals was about 10x, and the Clean Data was filtered. The MEM algorithm of BWA (v0.7.15) software was used to align the Clean Data to the sheep reference genome (Oar_rambouillet_v1.0), and then the alignment results were sorted and repeated by using Picard software, and the bam file was obtained for subsequent analysis.

[0035] (3) Screening of SNPs related to body size and weight;

[0036] The merging and genotyping of SNPs were performed by the recommended process of GATK website, and filtering was performed according to the minimum allele frequency (MAF>0.1) and the missing rate (geno<0.1). A total of 17586982 high-quality SNP sites were identified in the genomes of 17 small-tail Han sheep. By using vcftools software, the Fst values of the common small-tail Han sheep and the large-size small-tail Han sheep were calculated, and a total of 261 sites with Fst values greater than 0.85 were counted. Then the sequences on both sides were taken, and BLAST analysis was performed by referring to the reference genome (Oar_rambouillet_v1.0 and ARS-UI_Ramb_v3.0) to exclude repetitive sequence regions or low homology sequences. Finally, 148 sites with significant differences in allele frequency in the two groups were obtained, and the site information is shown in Table 2.

[0037] Table 2 Information of SNP sites with significant differences related to body size and weight

[0038]

[0039]

[0040]

[0041]

[0042]

[0043] (4) Primer design, PCR amplification, and sequencing;

[0044] Using online restriction site analysis software to analyze the SNP and flanking sequence restriction sites, an Mlu I restriction endonuclease site was found at the 40293415A>G polymorphic site on chromosome 6 (NC_040257.1). The gene frequency of the G allele in large-bodied small-tailed Han sheep is 1, while in ordinary small-tailed Han sheep it is 0.14, a significant difference. Primer 5.0 was used to design a pair of primers: SDL-M1-F (5'-CTGCCATCAGACACTTTTCATCGT-3') (shown in SEQ ID NO. 2) and SDL-M1-R (5'-TGTTGTGTTAGACAGGATCAAAGC-3') (shown in SEQ ID NO. 3). PCR amplification using this pair of primers yielded a 347bp DNA fragment containing the SNP site:

[0045] CTGCCATCAGACACTTTTCATCGT CCGATTAAAGGCCCCAGTGTGACTTGAACTA AGTGGCCAAAATCACCAGTAAGCTTTCCTACCGCTGGCTGCTAGCTGCGGTCTCCGCT CAGCAGCCCCCTCTAGGGCTGCCACGC r (G / A) TGTGGAGGCACGTGGCCAGAAGGGA AGTGGGTGGAGCCAGAGGCCAGGTTTTAAGGAGCCGCACCTGTGTGGGTGGGGGAAGGGTGGCAACACGCCTGCAAGGTCAAACGAAACAAACGAGAATTCTGGTTTGTAAGCTCCGTGGCGCTAATGGATCTTGGAGAAAATTGGGCTGCGGGGCAGCTTTGATCCTGTCTAACACAACA

[0046] Note: The "r" marked in the sequence is the mutation site, which is underlined (the mutated base in brackets is the allele mutation).

[0047] Primers were synthesized by Shenguo Bioengineering (Shanghai) Co., Ltd. The PCR amplification reaction system was 20 μL, including 2 × PCR Master Mix 10 μL, DNA template 1 μL, forward and reverse primers 0.25 μL each, and ddH2O 8.5 μL. The PCR amplification conditions were as follows: 95 °C pre-denaturation for 2 min; 94 °C denaturation for 30 s, 60 °C annealing for 30 s, 72 °C extension for 30 s, for a total of 30 cycles; and 72 °C extension for 5 min. The PCR product was detected by 2.5% agarose gel electrophoresis, and the results showed that the 347 bp target fragment was successfully amplified in 17 individuals (as shown in Figure 1 .

[0048] (5) Enzymatic digestion and genotype determination;

[0049] Mlu I endonuclease was used for genotyping, and the enzyme digestion system was 10 μL, including 10 × buffer 1 μL, ddH2O 4.5 μL, Mlu I 0.5 μL, and PCR product 4 μL. The enzyme digestion was performed at 37 °C for 3 h. The enzyme digestion product was detected by 2.5% agarose gel electrophoresis, and the genotype of the individual could be determined according to the electrophoresis bands. When the allele was G, the amplified fragment could be cut into two fragments of 137 and 210 bp by Mlu I endonuclease, and when the allele was A, the amplified fragment could not be cut. Therefore, in the agarose gel electrophoresis, the GG homozygote produced two bands of 137 and 210 bp, the GA heterozygote produced three bands of 347, 210 and 137 bp, and the AA homozygote produced only one band of 347 bp.

[0050] The genotypes of 10 large-sized Small Tail Han sheep and 7 ordinary Small Tail Han sheep were determined, and the results (as shown in Figure 2 ) showed that all the 10 large-sized Small Tail Han sheep were of AA genotype, and among the 7 ordinary Small Tail Han sheep, 2 were of GA genotype and the remaining 5 were of GG genotype.

[0051] The PCR products of individuals with three genotypes (AA, GA and GG) were selected for first-generation sequencing. The sequencing results (as shown in Figure 3 ) showed that there were three genotypes of AA, GA and GG, indicating that the DNA sequence of the SNP site was consistent with the expectation.

[0052] (6) Population genotype analysis;

[0053] The genotypes of 40 large-sized Small Tail Han sheep and 56 ordinary Small Tail Han sheep were determined by PCR-RFLP detection method. As shown in Figure 4 , in the population of 40 large-sized Small Tail Han sheep, only AA and GA genotypes existed, of which there were 32 and 8 of AA and GA genotypes, respectively, and the frequencies of A and G alleles were 0.9 and 0.1, respectively. As shown in Figure 5 .As shown, in 56 ordinary small-tail Han sheep population, only two genotypes of GA and GG existed, in which GA and GG genotypes were 5 and 51, respectively, and A and G allele frequencies were 0.04 and 0.96, respectively. This indicates that the dominant allele in large-type small-tail Han sheep is A, and the dominant allele in ordinary small-tail Han sheep is G. Therefore, this site can be applied to the molecular marker-assisted breeding of large-type small-tail Han sheep.

[0054] The above is only the preferred embodiment of the present application, and it should be noted that for those skilled in the art, without departing from the concept of the present application, several modifications and improvements can also be made, which should also be considered as the protection scope of the present application, and these will not affect the effect and practicality of the patent.

Claims

1. The use of SNP markers associated with body size traits of Small Tail Han Sheep in the assisted breeding of body size traits of Small Tail Han Sheep, characterized in that, The SNP site of the SNP marker corresponds to the A>G polymorphic site at position 40293415 on chromosome 6 of the sheep reference genome Oar_rambouillet_v1.0; The nucleotide sequence of the SNP marker is shown as SEQ ID NO. 1, wherein r in the sequence is G or A; when r is G, the genotype is GG or GA; and when r is A, the genotype is AA.

2. Use according to claim 1, characterized in that, The primer pair for amplifying the SNP marker comprises SDL-M1-F and SDL-M1-R, and the nucleotide sequences are shown as SEQ ID NO. 2 and SEQ ID NO. 3, respectively.

3. Use according to claim 2, characterized in that, The method for detecting the SNP marker comprises the following steps: Step 1, extracting the genomic DNA of small-tailed han sheep; Step 2, performing PCR amplification on the genomic DNA obtained in step 1 by using the primer pair to obtain a PCR amplification product; Step 3, performing genotyping detection on the PCR amplification product obtained in step 2, and the genotype is AA, GG or GA.

4. Use according to claim 3, characterized in that, The PCR amplification system comprises 2×PCR MasterMix 10 µL, DNA template 1 µL, SDL-M1-F and SDL-M1-R each 0.25 µL, and ddH2O 8.5 µL.

5. Use according to claim 3, characterized in that, The PCR amplification conditions comprise 95℃ pre-denaturation for 2 min; 94℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 30 s, a total of 30 cycles; and 72℃ extension for 5 min.

Images