A primer-probe composition, detection kit and detection method for differentiating Babesia canis and Babesia gibsoni

Abstract

The present invention belongs to the technical field of pathogen detection for canine babesiosis, and discloses a primer-probe composition, a detection kit and a detection method for differentiating Babesia gibsoni and Babesia canis. The primer-probe composition includes: an upstream primer Jiba-F with a sequence as shown in SEQ ID NO.1, a downstream primer Jiba-R with a sequence as shown in SEQ ID NO.2, and a fluorescent probe Jiba-P with a sequence as shown in SEQ ID NO.3; an upstream primer Canine Babesia-F with a sequence as shown in SEQ ID NO.4, a downstream primer Canine Babesia-R with a sequence as shown in SEQ ID NO.5, and a fluorescent probe Canine Babesia-P with a sequence as shown in SEQ ID NO.6. The above detection kit includes the above primer-probe composition, and the detection method includes sample processing, fluorescence quantitative amplification and analysis of detection results. The above detection method can achieve simultaneous and accurate detection of Babesia gibsoni and Babesia canis in samples and effective differentiation between the two, providing a precise medication plan for dogs infected with Babesia.

Description

Technical Field

[0001] The present invention relates to the technical field of pathogen detection for canine babesiosis, and particularly to a primer-probe composition, a detection kit, and a detection method for differentiating Babesia canis and Babesia gibsoni. Background Art

[0002] Canine babesiosis is a disease caused by Babesia parasitizing in canine red blood cells. Babesia is a tick-borne hemoprotozoan. After a dog is infected with Babesia, it shows symptoms such as fever and lethargy, and then develops hemolytic anemia, rupture of red blood cells, abnormal blood coagulation in the liver, lungs, and kidneys, electrolyte imbalance, and organ dysfunction. It usually has an acute course and seriously threatens the health of dogs.

[0003] Currently, the occurrence and distribution of canine babesiosis in China are epidemic and widespread. Spring, summer, and autumn of each year are the peak seasons. As long as there are areas where ticks can breed, the transmission of this disease may exist, and in recent years, the incidence of this disease has shown an increasing trend year by year.

[0004] The pathogens causing canine babesiosis in China are mainly Babesia canis and Babesia gibsoni. Among them, Babesia canis has a relatively large body, generally 4-5 μm in length. Babesia canis vogeli, Babesia canis, and Babesia canis rossi are three relatively common species of Babesia canis in China. Babesia gibsoni has a very small body, with a length of 1-2.5 μm, and is the main pathogenic species of babesiosis in China. Clinically, the clinical symptoms caused by Babesia canis and Babesia gibsoni are similar, but there are differences in drug treatment. Diminazene aceturate and oxyclozanide are highly effective against Babesia canis but cannot eliminate Babesia gibsoni. The combination of atovaquone and azithromycin is the most effective in treating Babesia gibsoni. Therefore, effectively differentiating the pathogenic parasites is of great significance for the prevention and treatment of canine babesiosis.

[0005] Currently, the relatively direct diagnostic method in clinical practice is the blood smear staining method after venous blood collection. It is not only convenient and fast but also can distinguish Babesia gibsoni and Babesia canis according to the size of the parasites. However, the blood smear is limited by smear and reading techniques, requires high requirements for operators, and it is difficult to detect parasites in the early stage of infection, and it is very easy to cause missed detection.

[0006] With the development of molecular biology techniques, fluorescence quantitative PCR technique has been widely used in the diagnosis of canine babesiosis due to its ultra-high sensitivity and specificity. However, there is currently no differential detection method that can effectively distinguish Babesia gibsoni and Babesia canis at the same time. Moreover, the existing fluorescence quantitative PCR reagents are cumbersome to prepare, require a professional PCR laboratory, and have a relatively long detection cycle, about 2 hours, which limits its popularization and use in pet hospitals.

[0007] Therefore, the existing technology needs to be further improved. Summary of the Invention

[0008] In view of the above problems, the present invention provides a primer-probe composition, a detection kit and a detection method for quickly and accurately distinguishing Babesia canis and Babesia gibsoni. The detection method is simple to operate, can quickly and effectively distinguish Babesia gibsoni and Babesia canis in a sample, is suitable for popularization and application, and is of great significance for the prevention and treatment of canine babesiosis.

[0009] In a first aspect, the present application provides a primer-probe composition for distinguishing Babesia canis and Babesia gibsoni, which includes:

[0010] Primer-probes for detecting the specific gene TRAP of Babesia gibsoni: the upstream primer Gibba-F with the sequence shown in SEQ ID NO.1, the downstream primer Gibba-R with the sequence shown in SEQ ID NO.2, and the fluorescent probe Gibba-P with the sequence shown in SEQ ID NO.3;

[0011] Primer-probes for detecting 18s rRNA of Babesia canis: the upstream primer Canis-F with the sequence shown in SEQ ID NO.4, the downstream primer Canis-R with the sequence shown in SEQ ID NO.5, and the fluorescent probe Canis-P with the sequence shown in SEQ ID NO.6;

[0012] The 5' end of the fluorescent probe is labeled with a fluorescent reporter group, and the 3' end of the fluorescent probe is labeled with a fluorescent quenching group.

[0013] Preferably, the primer-probe composition further includes primer-probes for detecting the internal reference gene ACTB: the upstream primer ACTB-F with the sequence shown in SEQ ID NO.7, the downstream primer ACTB-R with the sequence shown in SEQ ID NO.8, and the fluorescent probe ACTB-P with the sequence shown in SEQ ID NO.9.

[0014] Optionally, in the primer-probe composition, the fluorescent reporter group is selected from FAM, HEX, CY5, ROX, VIC; and the fluorescent quenching group is selected from BHQ1, BHQ2, BHQ3.

[0015] Second aspect, the present application also provides a detection kit for differentiating Babesia canis and Babesia gibsoni, which comprises the aforementioned primer-probe composition.

[0016] Optionally, the detection kit comprises freeze-dried PCR reagents, which are prepared by freeze-drying a PCR mixture. The PCR mixture comprises: the aforementioned primer-probe composition, DNA polymerase, dNTPs, buffer, and cryoprotectant;

[0017] Preferably, the cryoprotectant consists of the following components: 4% W / V% trehalose and 3% W / V% dextran;

[0018] Preferably, the PCR mixture is mainly prepared from the following components: 0.1 - 1 μM of primer-probe, 0.2 - 0.8 μl of super Taq DNA polymerase, 2.5 μl of 10x buffer, and 12.5 μl of cryoprotectant.

[0019] Preferably, in the freeze-dried PCR reagents in the kit, the concentration of the primer is 0.4 - 1 μM; the concentration of the probe is 0.1 - 0.5 μM.

[0020] Preferably, the DNA polymerase is super Taq DNA polymerase. The super Taq DNA polymerase is a modified and optimized Taq DNA polymerase, which has better tolerance to inhibitors and higher amplification and extension efficiency;

[0021] Optionally, in the detection kit, the PCR mixture further comprises: a PCR denaturation promoter, which is a combination of one or more of the following components: 1% - 15% W / V% betaine, 1% - 15% V / V% DMSO, and 1% - 15% V / V% formamide.

[0022] Preferably, the PCR mixture further comprises: a nucleic acid release agent; the nucleic acid release agent comprises the following components at the following concentrations: 100 mM of KOH, 5 mM of EDTA, 100 mM of Tris-HCl, and 5% V / V% of sorbitol;

[0023] Optionally, the PCR mixture further comprises a reconstitution solution, which is a sterile aqueous solution containing 5% V / V% glycerol.

[0024] Preferably, the PCR denaturation promoter is 1 - 15% V / V% of DMSO. More preferably, the PCR denaturation promoter is 15% V / V% of DMSO.

[0025] Optionally, the detection kit further includes: a positive control and a negative control. The positive control is a mixture of Babesia gibsoni plasmid, Babesia canis plasmid, and canine ACTB internal reference plasmid, and the ratio of the three is 1:1:1; the negative control is sterile deionized water.

[0026] In a third aspect, a method for preparing the aforementioned freeze-dried PCR reagent includes the following steps: After mixing all components, perform freeze-drying through a multi-stage freeze-drying program. The multi-stage freeze-drying program is as follows:

[0027] Pre-freezing stage: -45°C, maintained for 2 h; primary sublimation drying: raise the temperature to -30°C, and at the same time turn on the vacuum pump to quickly evacuate to 1 mbar, maintain for 2 h; then raise the temperature to -15°C, maintain for 2 h; secondary sublimation drying: continue to raise the temperature to 10°C, maintain for 2 h; after completion, raise the temperature to 25°C, maintain for 2 h. Capping: After the freeze-drying program is completed, flush with nitrogen to balance to atmospheric pressure, and then perform capping and bag sealing on the eight-well row tubes to complete freeze-drying.

[0028] In a fourth aspect, the present application also provides a detection method for differentiating Babesia canis and Babesia gibsoni for non-disease diagnosis purposes, which includes the following steps:

[0029] S1. Add a nucleic acid release agent to the sample, vortex and shake, then aspirate the suspension and add it to the reconstitution solution, shake and mix well, and then add the mixture to the freeze-dried PCR reagent, mix well and centrifuge to obtain a reaction mixture;

[0030] S2. Perform ultra-fast fluorescence quantitative PCR amplification on the above reaction mixture; the ultra-fast fluorescence quantitative PCR amplification program is as follows:

[0031] The denaturation temperature is 88 - 95°C, and the reaction time is 1 - 8 s;

[0032] The annealing temperature is 58 - 70°C, the reaction time is 3 - 15 s, and fluorescence is collected;

[0033] The number of reaction cycles is 35 - 45 cycles;

[0034] S3. Analyze and judge whether the test sample is infected with Babesia gibsoni and / or Babesia canis according to the Ct values of the three channels in the fluorescence quantitative PCR reaction system.

[0035] The above detection method for differentiating Babesia canis and Babesia gibsoni is simple to operate, has high specificity and accuracy, and the detection period is greatly shortened. The total time from sample addition to report issuance can be as short as 20 - 30 min, with the advantages of short cycle and high efficiency.

[0036] Optionally, the operation in step S2 is performed on an ultra-fast fluorescence quantitative PCR instrument.

[0037] Preferably, the ultra-fast fluorescence quantitative PCR instrument is small in volume and light in weight, and includes 8 PCR reaction wells and 4 fluorescence channels, and the 4 fluorescence channels are FAM, HEX, ROX and CY5.

[0038] More preferably, in step S2, the ultra-fast fluorescence quantitative PCR amplification program is: 90°C, 2 s; 65°C, 5 s; the amplification is carried out for 40 cycles.

[0039] Preferably, in step S3, an intelligent result analysis and report interpretation software is used. This software includes various pre-stored common item databases and can generate an interpretation report by automatically identifying the fluorescence quantitative PCR results. In actual application, it is more convenient for the rapid display of experimental results.

[0040] Optionally, in the detection method, the specific analysis and judgment method in step S3 is:

[0041] If the fluorescence channel of the fluorescence probe Giardia-P is the first fluorescence channel, and the fluorescence channel used by the fluorescence probe Babesia canis-P is the second fluorescence channel;

[0042] When the Ct value of the first fluorescence channel < 40 and the Ct value of the second fluorescence channel is absent, it indicates that the sample only contains Babesia gibsoni;

[0043] When the Ct value of the first fluorescence channel is absent and the Ct value of the second fluorescence channel < 40, it indicates that the sample only contains Babesia canis;

[0044] When the Ct value of the first fluorescence channel < 40 and the Ct value of the second fluorescence channel < 40, it indicates that the sample contains Babesia gibsoni and Babesia canis;

[0045] When the Ct value of the first fluorescence channel is absent and the Ct value of the second fluorescence channel is absent, it indicates that the sample does not contain Babesia gibsoni and Babesia canis.

[0046] Optionally, in the detection method, if the fluorescence channel used by the fluorescence probe ACTB-P is the third fluorescence channel, then when the Ct value of the third fluorescence channel < 40, it indicates that the sample sampling is qualified.

[0047] More preferably, the first fluorescence channel is FAM, the second fluorescence channel is HEX, and the third fluorescence channel is CY5.

[0048] The present invention has the following beneficial effects:

[0049] 1. The present invention for the first time realizes the simultaneous and accurate detection of Babesia gibsoni and Babesia canis in the same PCR reaction system, and effectively distinguishes Babesia gibsoni and Babesia canis according to their specific gene sequences, providing a precise medication plan for dogs infected with Babesia, which is of great significance for the prevention and treatment of canine babesiosis and plays a great role in promoting the healthy development of the dog breeding industry in China.

[0050] 2. The present invention adopts direct release of blood samples, fully premixed freeze-dried PCR reagents, an ultra-fast nucleic acid amplification program and a supporting ultra-fast fluorescence quantitative PCR detection and analysis system. The equipment is small, convenient, easy to operate, the kit can be transported and stored at room temperature, the detection time is short, and the report can be interpreted immediately. From sample loading to issuing a report, it is ≤30 min, which is conducive to popularization and use in pet hospitals.

[0051] 3. The present invention uses the PCR-fluorescent probe method. The amplification reaction and detection adopt a completely closed system, avoiding false positives caused by aerosol contamination. The operation method is simple, the detection cycle is short, the detection cost is low, and the sensitivity and specificity are good. BRIEF DESCRIPTION OF THE DRAWINGS

[0052] Figure 1 Amplification curves of positive plasmids amplified by the three groups of primer-probes of the present application in Example 2, Comparative Example 1 and Comparative Example 2;

[0053] Figure 2 Amplification curve results of Babesia gibsoni samples amplified by the three groups of primer-probes of the present application in Example 2, Comparative Example 1 and Comparative Example 2; among them Figure 2 A is the result of amplifying Babesia gibsoni samples with the canine Bab primer among the three groups of primer-probes; Figure 2 B is the result of amplifying Babesia gibsoni samples with the Gib Bab primer among the three groups of primer-probes;

[0054] Figure 3 Amplification curve results of Babesia canis samples amplified by the three groups of primer-probes of the present application in Example 2, Comparative Example 1 and Comparative Example 2; among them Figure 3 A is the result of amplifying Babesia canis samples with the canine Bab primer among the three groups of primer-probes; Figure 3 B is the result of amplifying Babesia canis samples with the Gib Bab primer among the three groups of primer-probes;

[0055] Figure 4 Fluorescence quantitative amplification results of the kit in Example 4 for detecting gradient-diluted plasmids of Babesia canis at 1x10 1 ~1x10 6 copies / ul;

[0056] Figure 5 Fluorescence quantitative amplification results of the kit in Example 4 for detecting Babesia gibsoni at 1x10 1~1x10 6 Fluorescence quantitative amplification results of gradient-diluted plasmid with

[0057] Figure 6 For the kit of Example 4 to detect canine reference gene ACTB 1x10 1 ~1x10 6 Fluorescence quantitative amplification results of gradient-diluted plasmid. Detailed implementation manners

[0058] Next, the technical solutions in the embodiments of the present invention will be clearly and completely described in conjunction with the accompanying drawings in the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. These embodiments are only used to illustrate the detection methods and procedures described in the present invention, rather than to limit the scope of the present invention. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without making creative efforts belong to the scope of protection of the present invention. In the present invention, unless otherwise specified, the equipment and raw materials used can be purchased from the market or are commonly used in the art. The methods in the following embodiments are conventional methods in the art unless otherwise specified.

[0059] Example 1 Screening of primer-probe compositions and setting of kits

[0060] 1. Design of primer-probe compositions

[0061] Obtain 40 Babesia gibsoni TRAP gene sequences from NCBI, perform sequence alignment through Clustal X2 software, find relatively conserved gene sequences, and design multiple pairs of upstream and downstream primers and probes for specific amplification of Babesia gibsoni.

[0062] Obtain 40 Babesia canis 18s rRNA and 20 Babesia gibsoni 18s rRNA from NCBI, perform sequence alignment through Clustal X2 software, find multiple gene sequences that are relatively conserved in Babesia canis but specific to Babesia gibsoni, and correspondingly design multiple pairs of upstream and downstream primers and probes.

[0063] Obtain the canine ACTB gene sequence from NCBI, use this gene as a reference gene, and design upstream and downstream primers and probes. Use the primers of this reference gene to avoid interference of false negatives on the detection results. In other embodiments, other conserved genes of dogs can also be selected as reference genes.

[0064] 2. Screening and verification of primer-probe compositions

[0065] Verify and screen the primer-probe combinations through multiple samples and plasmids, and screen out primer-probe combinations with good specificity, high sensitivity, and high amplification efficiency that can simultaneously distinguish Babesia canis and Babesia gibsoni. The specific primer-probe information is shown in Table 1 below:

[0066] Table 1 Primer and Probe Sequences of Babesia gibsoni, Babesia canis, and ACTB Gene

[0067] Name Sequence (5’-3’) Jiba-F TTGGAAGCAGGTTGTAGGCTGTCGTG (SEQ ID NO.1) Jiba-R CCTCACCATTGTTCCAACCTTCTCTAGCA (SEQ ID NO.2) Jiba-P FAM-CTTAAATACATGTCTGCACTGAATCAGGAATTGC-BHQ1 (SEQ ID NO.3) Canisba-F GGAAACTCACCAGGTCCAGACAAACGG (SEQ ID NO.4) Canisba-R TAGTTAGCAGGTTAAGGTCTCGTTCGTTAACGG (SEQ ID NO.5) Canisba-P HEX-TGGTGCATGGCCGTTCTTAGTTGGTGGAGTGATTT-BHQ1 (SEQ ID NO.6) ACTB-F CGGGAAATCGTGCGTGACATCAA (SEQ ID NO.7) ACTB-R CCGTCGGGCAGCTCATAGCTCTT (SEQ ID NO.8) ACTB-P CY5-CTGTGTTATGTGGCCCTGGACTTCGAGCAGG-BHQ2 (SEQ ID NO.9)

[0068] 3. Preparation of the Kit

[0069] In this example, a kit for the application of the multiple groups of primer-probes in Table 1 above was designed.

[0070] As shown in Table 2, the kit includes: freeze-dried PCR reagent, nucleic acid release agent, reconstitution solution, positive control, and negative control.

[0071] Among them, the freeze-dried PCR reagent includes the following components: 0.5 μM Jiba-F, 0.5 μM Jiba-R, 0.25 μM Jiba-P, 0.5 μM Canis-F, 0.5 μM Canis-R, 0.25 μM Canis-P, 0.4 μM ACTB-F, 0.4 μM ACTB-R, 0.2 μM ACTB-P; 0.6 μl super Taq DNA polymerase, 2.5 μl 10x buffer, 15% v / v% DMSO as PCR denaturation promoter, and 12.5 μl freeze-drying protectant. It is dispensed into PCR eight-strip tubes and then freeze-dried according to a multi-stage freeze-drying procedure.

[0072] The freeze-drying procedure is as follows: Pre-freezing: -45°C, maintaining for 2 h; Primary sublimation drying: Heating to -30°C, simultaneously turning on the vacuum pump to quickly evacuate to 1 mbar and maintaining for 2 h; then heating to -15°C and maintaining for 2 h; Secondary sublimation drying: Continuing to heat to 10°C and maintaining for 2 h; After completion, heating to 25°C and maintaining for 2 h. Capping: After the freeze-drying procedure is completed, nitrogen is flushed in to balance to atmospheric pressure, and then the eight-strip tube caps are capped and sealed to complete freeze-drying.

[0073] The concentration of the primers in the freeze-dried PCR reagent is 0.4 - 1 μM; the concentration of the probes is 0.1 - 0.5 μM.

[0074] The nucleic acid release agent is used for nucleic acid release from blood samples. The nucleic acid release agent contains the following components at the following concentrations: 100 mM KOH, 5 mM EDTA, 100 mM Tris-HCl, and 5% v / v% sorbitol.

[0075] The reconstitution solution reconstitutes the fully premixed freeze-dried reagent and contains sterile deionized water with 5% v / v% glycerol.

[0076] The positive control is a mixed solution prepared from a Theileria gibsoni plasmid, a Babesia canis plasmid, and one plasmid of canine ACTB internal reference with a molar ratio of 1:1:1. Among them, the target gene sequence of the Theileria gibsoni plasmid is as shown in SEQ ID NO.10 in the sequence listing; the target gene of the Babesia canis plasmid is as shown in SEQ ID NO.11 in the sequence listing; the target gene sequence of the ACTB plasmid is as shown in SEQ ID NO.12 in the sequence listing.

[0077] The lyoprotectant consists of the following components: 4% W / V trehalose and 3% W / V dextran.

[0078] Table 2 Composition of the kit

[0079]

[0080]

[0081] 4. This embodiment also provides a detection method for differentiating Babesia canis and Theileria gibsoni using the above method, and the detection method includes the following steps:

[0082] S1. Draw 1 ml of canine venous blood with an EDTA blood collection tube; and take out various reagents in the kit;

[0083] Take 25 μl of the sample to be tested (i.e., the above-mentioned canine venous blood), add a nucleic acid release agent to the sample, vortex for 2 min, then take out 25 μl of the mixed solution from it and add it to the reconstitution solution, vortex and mix well, and then take out 25 μl and add it to the lyophilized reagent.

[0084] At the same time, take 25 μl of the positive control product and the negative control respectively and add them to the corresponding lyophilized reagents as the positive control and the negative control. Cover the tube caps, mix well, and centrifuge.

[0085] S2. Put the centrifuged reaction mixture into a rapid fluorescence quantitative PCR detection and analysis system (i.e., an ultra-rapid fluorescence quantitative PCR instrument), and perform ultra-rapid fluorescence quantitative PCR amplification according to the following amplification program;

[0086] The ultra-rapid fluorescence quantitative PCR amplification program is: 90°C, 2 s; 65°C, 5 s (collect fluorescence); the amplification is carried out for 40 cycles.

[0087] S3. Analyze and judge whether the sample to be tested is infected with Theileria gibsoni and / or Babesia canis according to the Ct values of the three channels in the fluorescence quantitative PCR reaction system.

[0088] The specific analysis and judgment method is as follows: (as shown in Table 3).

[0089] When the Ct value of the FAM channel is < 40 and there is no Ct value in the HEX channel, it indicates that the sample only contains Babesia gibsoni;

[0090] When there is no Ct value in the FAM channel and the Ct value of the HEX channel is < 40, it indicates that the sample only contains Babesia canis;

[0091] When the Ct value of the FAM channel is < 40 and the Ct value of the HEX channel is < 40, it indicates that the sample contains Babesia gibsoni and Babesia canis;

[0092] When there is no Ct value in the FAM channel and no Ct value in the HEX channel, it indicates that there are no Babesia gibsoni and Babesia canis in the sample;

[0093] When the Ct value of the CY5 channel is < 40, it indicates that the sample sampling is qualified.

[0094] In other embodiments, the above three fluorescence channels can be replaced with other types of fluorescence channels, and the solution of the present invention is not limited to the specific settings of this embodiment.

[0095] Table 3 Analysis and judgment method

[0096] Serial number FAM HEX CY5 Result 1 Ct value < 40 Ct value < 40 Ct value < 40 Co-infected with Babesia gibsoni and Babesia canis 2 Ct value < 40 No Ct value Ct value < 40 Babesia gibsoni infection 3 No Ct value Ct value < 40 Ct value < 40 Babesia canis infection 4 No Ct value No Ct value Ct value < 40 No Babesia gibsoni and / or Babesia canis infection

[0097] Note: If there is no Ct value in the CY5 channel, retesting is required.

[0098] Effect comparison of primer-probe compositions in Example 2

[0099] 1. Experimental method

[0100] This experiment provides kits for Comparative Example 1, Comparative Example 2, Comparative Example 3, and Comparative Example 4. The differences between these four kits and the kit of Example 1 lie in the different primer-probe compositions used, as shown in Table 1 below. The fluorescence probes on each primer-probe of each control group refer to the settings of Example 1 for comparative analysis, and the preparation methods of the kits in each group are the same as those of Example 1 described above.

[0101] Table 4 Primer-probes of control groups

[0102]

[0103]

[0104]

[0105] The kits prepared in Example 1 of the present application, and the kits prepared in Comparative Example 1, Comparative Example 2, Comparative Example 3, and Comparative Example 4 were respectively subjected to the following experiment on the same sample according to the detection method of Example 1 and the common amplification program of 95°C, 5 min; (95°C, 15 s, 60°C, 30 s (fluorescence collection), 40 cycles):

[0106] (1) The specific primers for Babesia gibsoni and Babesia canis in Example 1, Control Group 1, Control Group 2, Control Group 3, and Control Group 4 were respectively used to amplify the positive plasmid of Babesia gibsoni and the positive plasmid of Babesia canis in the kit of Example 1 described above, and the amplification effects of each primer pair were analyzed.

[0107] (2) The specific primers for Babesia gibsoni and Babesia canis in Example 1, Control Group 1, Control Group 2, Control Group 3, and Control Group 4 were respectively used to amplify the Babesia gibsoni sample and the Babesia canis sample, and the amplification effects of each primer pair were analyzed.

[0108] The experimental effects of each kit were compared.

[0109] 2. Experimental Results and Analysis

[0110] As Figure 1 shown, from the results of amplifying the positive plasmid with the above five sets of primers, it can be seen that in the multiplex reaction system, the amplification differences of the five sets of primers and probes for Babesia gibsoni and Babesia canis are not significant, and all can effectively amplify the corresponding plasmids. However, the amplification of the internal reference ACTB in Comparative Example 3 and Comparative Example 4 was significantly inhibited, and the CT value was significantly delayed (the value increased), and the amplification of the internal reference ACTB in Comparative Example 1 and Comparative Example 2 was slightly inhibited.

[0111] Figure 2 are the results of amplifying the Babesia gibsoni sample with five sets of primers; among them, as Figure 2 shown in A, from the results of amplifying the Babesia gibsoni sample with the five sets of primers for Babesia canis, it can be seen that the primers for Babesia canis in Comparative Example 1, Comparative Example 3, and Comparative Example 4 had non-specific amplification for the Babesia gibsoni sample, and the primers for Babesia canis in Comparative Example 2 and Example 1 had no non-specific amplification for Babesia gibsoni. As Figure 2 shown in B, from the results of amplifying the Babesia gibsoni sample with the five sets of primers for Babesia gibsoni, it can be seen that all five sets of primers could amplify Babesia gibsoni, and the Ct values of Comparative Example 1, Comparative Example 3, and Comparative Example 4 were earlier than those of Comparative Example 2 and Example 1.

[0112] Figure 3 are the results of amplifying the Babesia canis sample with five sets of primers; among them, as Figure 3 shown in A, all five sets of primers for Babesia canis could amplify the Babesia canis sample, and the amplification Ct values of Comparative Example 1, Comparative Example 3, and Comparative Example 4 were earlier, and Comparative Example 2 was the same as Example 1. However, as Figure 3As shown in B, five sets of primers of Giemsa were used to amplify Babesia canis samples. In Comparative Example 1, there was non-specific amplification of Babesia canis samples. There was no non-specific amplification in Comparative Example 2, Comparative Example 3, Comparative Example 4 and Example 1.

[0113] Based on the above analysis, it can be seen that the primer-probe compositions of the kits in Comparative Example 1, Comparative Example 3 and Comparative Example 4 could not effectively distinguish between Babesia gibsoni and Babesia canis, and the amplification of the internal reference ACTB was severely inhibited in Comparative Example 3 and Comparative Example 4. The primer-probes of the kits in Example 1 and Comparative Example 2 could effectively distinguish between Babesia gibsoni and Babesia canis. Therefore, Example 1 and Comparative Example 2 are preferred.

[0114] Example 3 Optimization of the amplification program in the detection method of the present application

[0115] 1. Test method

[0116] The kits of Example 1 and Comparative Example 2 were used. According to the following different amplification programs, the settings of the amplification system referred to Example 1, and 1 positive mixed sample of Babesia canis and Babesia gibsoni was used for comparative verification.

[0117] Program 1: It was a common fluorescence PCR amplification program. Pre-denaturation at 95°C for 5 min; denaturation at 95°C for 15 s, annealing at 60°C for 30 s (fluorescence collection), 40 cycles;

[0118] Program 2: Denaturation at 95°C for 2 s, annealing at 60°C for 5 s (fluorescence collection), 40 cycles;

[0119] Program 3: Denaturation at 90°C for 2 s, annealing at 60°C for 5 s (fluorescence collection), 40 cycles;

[0120] Program 4: Denaturation at 90°C for 2 s, annealing at 65°C for 5 s (fluorescence collection), 40 cycles;

[0121] 2. Experimental results and analysis:

[0122] As can be seen from the results in Table 5: The amplification results of Program 1 and Program 2 were not very different. Program 1 was a common ordinary PCR amplification program. Removing the pre-denaturation step from Program 1 in Program 2 had little impact on this kit; in Program 3, the denaturation temperature was reduced to 90°C, and Example 1 and Comparative Example 2 could still effectively amplify the positive samples, and there was no obvious difference from Program 1; in Program 4, the denaturation temperature was reduced to 90°C, and at the same time the annealing temperature was increased to 65°C. The samples in Example 1 could still be amplified and there was no obvious difference from Program 1, but the samples in Comparative Example 2 could not be amplified. Therefore, the primer-probe composition of Comparative Example 2 was not as good as that of Example 1 of the present application, and the kit of Example 1 of the present application was better.

[0123] In addition, the results in Table 5 also show that the solution of Embodiment 1 of the present application can be effectively amplified in Programs 2 to 4. The amplification effect has little difference from that of the conventional Program 1, but its amplification cycle is shorter and the efficiency is significantly improved.

[0124] Table 5 Comparison of Amplification in Different Programs

[0125]

[0126] Example 4 Screening and Optimization of Denaturing Promoters in Embodiment 1 of the Present Application

[0127] 1. Experimental Method:

[0128] (1) Reagent Preparation:

[0129] A: Prepare Reagent A by mixing 0.5 μM Gibba-F, 0.5 μM Gibba-R, 0.25 μM Gibba-P, 0.5 μM Canis-F, 0.5 μM Canis-R, 0.25 μM Canis-P, 0.5 μM ACTB-F, 0.5 μM ACTB-R, 0.25 μM ACTB-P; 0.6 μl Taq DNA polymerase, 2.5 μl of 10x buffer, 1 μl dNTPs, and 15% V / V% DMSO.

[0130] B: Prepare Reagent B by mixing 0.5 μM Gibba-F, 0.5 μM Gibba-R, 0.25 μM Gibba-P, 0.5 μM Canis-F, 0.5 μM Canis-R, 0.25 μM Canis-P, 0.5 μM ACTB-F, 0.5 μM ACTB-R, 0.25 μM ACTB-P; 0.6 μl Taq DNA polymerase, 2.5 μl of 10x buffer, 1 μl dNTPs, and 10% V / V% DMSO.

[0131] C: Prepare Reagent C by mixing 0.5 μM Gibba-F, 0.5 μM Gibba-R, 0.25 μM Gibba-P, 0.5 μM Canis-F, 0.5 μM Canis-R, 0.25 μM Canis-P, 0.5 μM ACTB-F, 0.5 μM ACTB-R, 0.25 μM ACTB-P; 0.6 μl Taq DNA polymerase, 2.5 μl of 10x buffer, 1 μl dNTPs, and 5% V / V% DMSO.

[0132] D: Prepare reagent D by adding 0.5 μM Giemsa - F, 0.5 μM Giemsa - R, 0.25 μM Giemsa - P, 0.5 μM Canine Babesia - F, 0.5 μM Canine Babesia - R, 0.25 μM Canine Babesia - P, 0.5 μM ACTB - F, 0.5 μM ACTB - R, 0.25 μM ACTB - P; 0.6 μl Taq DNA polymerase, 2.5 μl of 10x buffer, 1 μl dNTPs, and 15% V / V% formamide.

[0133] E: Prepare reagent E by adding 0.5 μM Giemsa - F, 0.5 μM Giemsa - R, 0.25 μM Giemsa - P, 0.5 μM Canine Babesia - F, 0.5 μM Canine Babesia - R, 0.25 μM Canine Babesia - P, 0.5 μM ACTB - F, 0.5 μM ACTB - R, 0.25 μM ACTB - P; 0.6 μl Taq DNA polymerase, 2.5 μl of 10x buffer, 1 μl dNTPs, and 15% W / V% betaine.

[0134] The ultra - fast fluorescence quantitative PCR amplification program is as follows: 90°C for 2 s; 65°C for 5 s (collect fluorescence); 40 cycles of amplification are carried out.

[0135] (2) Sample loading and running on the machine: According to the operation method of Example 1, use 2 known positive blood samples for comparative verification.

[0136] 2. Experimental results and analysis:

[0137] As can be seen from the experimental results in Table 6, compared with reagent A, the Ct value of sample amplification of reagent B is significantly delayed, affecting the detection limit (i.e., sensitivity) of the product. There is no amplification of the sample of reagent C, and the Ct value of sample amplification of reagent D and reagent E is slightly delayed. Therefore, reagent A is preferred.

[0138] Table 6 Optimization of different denaturants

[0139]

[0140] Example 5 Performance analysis experiment of the kit in Example 1

[0141] Operate the kit in Example 1 according to the detection method in Example 1, and conduct performance tests in multiple aspects such as sensitivity, precision, accuracy, specificity, and anti - interference.

[0142] (1) Sensitivity experiment

[0143] ① Experimental method:

[0144] Gradient - dilute the synthetic plasmid standards of Babesia canis, Babesia gibsoni, and the synthetic plasmid standard of the canine internal reference gene ACTB respectively, and the dilution concentration is 1x101 ~1×10 6 copies / μl. For each dilution gradient, the kit of Example 1 of the present invention was used for detection and analysis. The standard products of each lowest detection limit were repeatedly detected 20 times to evaluate the sensitivity of the kit, and a standard curve was made to evaluate the linearity of the kit.

[0145] ② Experimental results and analysis

[0146] A. The experimental results show that the kit has high sensitivity to Babesia canis, up to 1×10 1 copies / μl. As shown in the results of Figure 4 Using the above kit to detect Babesia canis plasmid diluted in the gradient of 1×10 1 ~1×10 6 copies / μl, the lowest detection limit is 1×10 1 copies / μl. The standard products of each lowest detection limit were repeatedly detected 20 times, and the positive detection rate was 100%. The verification results are shown in Table 7 below.

[0147] B. Figure 5 This is the fluorescence quantitative amplification result of detecting Babesia gibsoni plasmid diluted in the gradient of 1×10 1 ~1×10 6 copies / μl using the above kit. It can be seen from the results that it has high sensitivity to the detection of Babesia gibsoni and can detect up to 1×10 1 copies / μl.

[0148] C. Figure 6 This is the fluorescence quantitative amplification result of detecting the canine reference gene ACTB plasmid diluted in the gradient of 1×10 1 ~1×10 6 copies / μl using the above kit. It can be seen from the results that the kit has high sensitivity to the detection of the canine reference gene ACTB and can detect up to 1×10 1 copies / μl.

[0149] Table 7 Sensitivity detection results

[0150]

[0151]

[0152] (2) Precision (repeatability)

[0153] ① Experimental method:

[0154] The plasmid standards of Babesia gibsoni and Babesia canis were respectively diluted to 1×10 4 copies / μl and 1×102 copies / ul, perform 10 repeated detections respectively, calculate their coefficient of variation and standard deviation, and evaluate the repeatability performance.

[0155] ② Experimental results:

[0156] As shown in Table 8, the standard deviations of the Ct values detected for different concentrations of Babesia gibsoni were 0.21 and 0.30 respectively, and the coefficients of variation were 0.80% and 0.89% respectively; the standard deviations of the Ct values detected for different concentrations of Babesia canis were 0.03 and 0.25 respectively, and the coefficients of variation were 0.13% and 0.75% respectively; the standard deviations of the Ct values detected for different concentrations of canine internal reference ACTB were 0.16 and 0.38 respectively, and the coefficients of variation were 0.58% and 1.12% respectively. The above results indicate that the kit has good repeatability in the detection of Babesia gibsoni, Babesia canis and canine internal reference ACTB.

[0157] Table 8 Precision verification results of Babesia gibsoni, Babesia canis and canine internal reference ACTB

[0158]

[0159]

[0160] (3) Accuracy

[0161] ① Experimental method

[0162] Use the above kit to detect the clinical Babesia gibsoni samples G1, G2, G3, G4 and G5, and Babesia canis samples C1, C2, C3, C4 and C5 that have been confirmed positive by sequencing respectively, and evaluate the accuracy of the kit. ② Experimental results:

[0163] The verification results are shown in Table 9. From this result, it can be seen that the positive detection rate of the kit is 100%, and the negative detection rate is 100%, indicating that the detection accuracy of the kit is high.

[0164] Table 9 Accuracy test results of the kit

[0165]

[0166]

[0167] (4) Specificity

[0168] ① Experimental method

[0169] The analytical specificity of the kit was evaluated using the above-mentioned kit to detect negative reference samples N1 - N8 (the samples were determined by sequencing to be negative for Babesia canis and Babesia gibsoni, and positive for other pathogens). The detection method was referred to Example 1. Among them, negative reference sample N1 was Leptospira, N2 was Toxoplasma gondii, N3 was Mycoplasma haemofelis, N4 was Hepatozoon canis, N5 was Anaplasma phagocytophilum, N6 was Ehrlichia canis, N7 was Borrelia burgdorferi, and N8 was Dirofilaria immitis.

[0170] ② Experimental results:

[0171] The experimental results showed that the detection results of negative reference samples N1 - N8 were all negative without cross-reactivity. This result indicated that the kit had strong detection specificity.

[0172] (5) Anti-interference

[0173] ① Experimental method

[0174] The common interfering substances that inhibit PCR in blood were detected using the kit of the present invention, including: 60 g / L albumin, 37 mmol / L triglyceride, 342 μmol / L bilirubin, and 200 g / L hemoglobin. The interfering substances were respectively added to positive samples for detection. The anti-interference ability of the kit was evaluated.

[0175] ② Experimental results:

[0176] The experimental results were shown in Table 10. The above-mentioned common blood interfering substances (albumin, triglyceride, bilirubin, and hemoglobin) had no interference on the detection results. This result indicated that the kit had strong anti-interference ability.

[0177] Table 10

[0178]

[0179]

[0180] It can be understood that for those of ordinary skill in the art, equivalent substitutions or changes can be made according to the technical solution of the present invention and the inventive concept of the present invention, and all such changes or substitutions should fall within the protection scope of the appended claims of the present invention.

Claims

1. A primer-probe composition for differentiating Babesia canis and Babesia gibsoni, characterized in that, Comprising: Primer probes for detecting the specific gene TRAP of Babesia gibsoni: the upstream primer Gibba-F with the sequence shown in SEQ ID NO.1, the downstream primer Gibba-R with the sequence shown in SEQ ID NO.2, and the fluorescent probe Gibba-P with the sequence shown in SEQ ID NO.3; Primer probes for detecting 18s rRNA of Babesia canis: the upstream primer Canis-F with the sequence shown in SEQ ID NO.4, the downstream primer Canis-R with the sequence shown in SEQ ID NO.5, and the fluorescent probe Canis-P with the sequence shown in SEQ ID NO.6; The 5' end of the fluorescent probe is labeled with a fluorescent reporter group, and the 3' end of the fluorescent probe is labeled with a fluorescent quenching group.

2. The primer-probe composition for differentiating Babesia canis and Babesia gibsoni according to claim 1, wherein It also includes primer probes for detecting the internal reference gene ACTB: the upstream primer ACTB-F with the sequence shown in SEQ ID NO.7, the downstream primer ACTB-R with the sequence shown in SEQ ID NO.8, and the fluorescent probe ACTB-P with the sequence shown in SEQ ID NO.

9.

3. The primer-probe composition for differentiating Babesia canis and Babesia gibsoni according to claim 1, characterized in that, The fluorescent reporter group is selected from FAM, HEX, CY5, ROX, VIC; the fluorescent quenching group is selected from BHQ1, BHQ2, BHQ3.

4. A detection kit for differentiating Babesia canis and Babesia gibsoni, characterized in that, Comprising the primer probe composition according to any one of claims 1 to 3.

5. The detection kit for differentiating Babesia canis and Babesia gibsoni according to claim 4, wherein Comprising a freeze-dried PCR reagent, which is prepared by freeze-drying a PCR mixture, and the PCR mixture includes: the primer probe composition according to claim 1, DNA polymerase, dNTP, buffer, and a freeze-drying protectant.

6. The detection kit for differentiating Babesia canis and Babesia gibsoni according to claim 5, characterized in that, The PCR mixture further includes: a PCR denaturation promoter, and the PCR denaturation promoter is a combination of one or more of the following components: 1%-15% W / V% betaine, 1%-15% V / V% DMSO, and 1%-15% V / V% formamide.

7. The detection kit for differentiating Babesia canis and Babesia gibsoni according to claim 5, wherein, The PCR mixture further includes: a nucleic acid releasing agent; the nucleic acid releasing agent includes the following components at the following concentrations: 100 mM KOH, 5 mM EDTA, 100 mM Tris-HCl, and 5% W / V% sorbitol.

8. The detection kit for differentiating Babesia canis and Babesia gibsoni according to claim 5, wherein, It also includes: Positive control and negative control, the positive control is a mixture of Babesia gibsoni plasmid, Babesia canis plasmid, and canine ACTB internal reference plasmid, and the ratio of the three is 1:1:1; the negative control is sterile deionized water.

9. The detection kit for differentiating Babesia canis and Babesia gibsoni according to claim 5, characterized in that, The preparation method of the freeze-dried PCR reagent includes the following steps: mixing all components and then performing freeze-drying through a multi-stage freeze-drying program, and the multi-stage freeze-drying program is: Pre-freezing stage: -45°C, maintaining for 2 h; primary sublimation drying: heating to -30°C, simultaneously turning on the vacuum pump to quickly evacuate to 1 mbar, maintaining for 2 h; then heating to -15°C, maintaining for 2 h; secondary sublimation drying: continuing to heat to 10°C, maintaining for 2 h; after completion, heating to 25°C, maintaining for 2 h; capping: after the freeze-drying program runs to completion, filling with nitrogen to balance to atmospheric pressure, and then performing capping and sealing of the eight-well row tubes to complete freeze-drying.

Images