Primer probe composition for rapidly detecting DON-producing fusarium based on MIRA, kit and application

Abstract

The invention provides a primer probe composition for rapidly detecting DON-producing fusarium based on MIRA, a kit and application, and belongs to the technical field of biosafety. The MIRA detection technology is applied to detection of the DON-producing fusarium for the first time, by comparing Tri toxin-producing gene clusters of the main DON-producing fusarium, a highly homologous sequence is screened out to serve as a specific amplification target, a primer and probe combination is designed to be used for real-time fluorescence MIRA detection, and the obtained primer and probe combination for detecting the DON-producing fusarium is high in specificity and sensitivity. The method for detecting the DON-producing fusarium by using the primer and probe composition for detecting the DON-producing fusarium has the advantages of simple operation, portable corollary equipment, short time consumption, high sensitivity, automatic result interpretation and the like, the amplification detection is only about 20 minutes, the on-site rapid detection can be realized, the pollution risk of the DON-producing fusarium can be found in time, the intervention is carried out in advance, and the detection time is shortened. And risk occurrence or torsion loss is avoided.

Description

Technical Field

[0001] The present invention relates to the field of biosafety technology, and in particular to a primer-probe combination, a kit and an application thereof for rapid detection of DON-producing Fusarium based on MIRA. Background Art

[0002] Mycotoxins are the main risk factors threatening food security. Among them, deoxynivalenol (DON), also known as vomitoxin, is the most common mycotoxin in wheat contamination. It is mainly a secondary metabolite produced by Fusarium graminearum and Fusarium culmorum. It has cytotoxic, teratogenic and immunosuppressive effects and has been classified as a Class 3 carcinogen by the World Health Organization's International Agency for Research on Cancer.

[0003] Wheat DON contamination is a global problem. Related studies have shown that monitoring the total amount of DON-producing Fusarium organisms carried by wheat at different growth stages will help to achieve early warning of DON contamination risks. However, existing laboratory detection methods are time-consuming and labor-intensive, and the bacteria are prone to change during sample transportation, resulting in deviations in test results. Therefore, it is urgent to establish a rapid on-site detection method for DON-producing Fusarium to timely grasp its contamination status, identify risks and take efficient intervention measures to ensure wheat yield and quality. At the same time, it also provides data support for the study of the mechanism of toxin-producing fungus contamination and the factors affecting toxin production, which is helpful to accurately construct a pre-production wheat DON contamination prediction model.

[0004] Rapid detection technologies based on nucleic acid polymerase chain reaction (PCR), such as real-time quantitative PCR (qPCR) and digital PCR (dPCR), have been widely used in multiple detection fields due to their high detection specificity and sensitivity. However, such technologies rely on complex and precise variable temperature equipment, which limits their application in resource-scarce areas and detection sites. Isothermal amplification technology has developed rapidly in recent years. Due to its single temperature requirement, it can work in ordinary constant temperature instruments, such as water baths, metal baths, and even thermos cups, completely abandoning the requirements of nucleic acid amplification for temperature and expensive instruments. In addition, this technology has strong specificity, high sensitivity, simple operation steps, and does not require professional technicians. It is very suitable for grassroots laboratories and on-site rapid detection.

[0005] Commonly used isothermal amplification techniques mainly include strand displacement amplification (SDA), rolling circle amplification (RCA), loop-mediated isothermal amplification (LAMP), recombinase polymerase amplification (RPA), and multienzyme isothermal rapid amplification (MIRA). Among them, the LAMP method is the most widely used and most published method in isothermal amplification technology because it only requires one enzyme and has high amplification efficiency. However, it has disadvantages such as complex primer design, high false positive rate, and high reagent price. In addition, due to the protection of Japanese intellectual property rights, its transformation and application in China is relatively limited. MIRA relies on the synergistic effect of multiple functional proteins at room temperature to achieve rapid amplification of nucleic acids. It is a truly portable on-site rapid nucleic acid detection technology. Its detection reagents are owned by my country with independent intellectual property rights, with relatively low cost, convenient purchase, and can ensure the timeliness of detection. In addition, the existing methods are difficult to achieve on-site nucleic acid extraction and purification, and cannot meet the needs of on-site rapid detection throughout the process.

[0006] MIRA is a thermostatic amplification technology that has emerged in recent years. It relies on three core enzymes including DNA polymerase, single-stranded DNA binding protein and recombinase to assist DNA amplification. It does not require complex temperature control equipment and has a short amplification reaction time. By designing specific primers and probes with modified groups, the fluorescence detection results can be interpreted. The key to the operation of this type of detection method is to design appropriate primers and probes. The selection of primers will affect the detection speed, sensitivity and specificity.

[0007] Therefore, finding a method to quickly detect DON-producing Fusarium on site is crucial for monitoring and early warning of wheat DON toxin contamination. Summary of the invention

[0008] The purpose of the present invention is to provide a primer-probe combination, a kit and an application for rapid detection of DON-producing Fusarium based on MIRA, which has the advantages of simple operation, short time consumption, automatic result interpretation, etc., has good detection sensitivity and specificity for DON-producing Fusarium in field wheat samples, and can meet the needs of rapid on-site detection.

[0009] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0010] The present invention provides a primer-probe combination for rapid detection of DON-producing Fusarium based on MIRA, characterized in that the primer-probe combination for rapid detection of DON-producing Fusarium based on MIRA consists of the following sequences:

[0011] Forward primer MIRA-Fus-F9, SEQ ID NO.9:

[0012] CTGTTGTGCCTCGATCCATCGCTCAGGCTTGAACT;

[0013] Reverse primer MIRA-Fus-R4, SEQ ID NO.15:

[0014] CAGTCCACCTATTTCATGCACACCGATCCCAAGA;

[0015] Probe MIRA-Fus-Pr1, SEQ ID NO.20:

[0016] GTTGTGCCTCGATCCATCGCTCAGGCTTGAACT / FAM / Spacer / BHQ1 / CGGGCTCGGGGAAA / C3-Spacer.

[0017] Furthermore, the front part of the probe MIRA-Fus-Pr1 sequence partially overlaps with the forward primer sequence, and the rear part of the probe sequence does not overlap with the reverse primer sequence; the probe MIRA-Fus-Pr1 has a total of 4 modification sites: the 34th base is labeled with a fluorescent group, the 35th base is labeled with tetrahydrofuran, the 36th base is labeled with a quenching group, and the 3' end is modified with a blocking group.

[0018] The present invention also provides a DON-producing Fusarium detection kit, characterized in that the DON-producing Fusarium detection kit comprises the primer-probe combination for rapid detection of DON-producing Fusarium based on MIRA according to any one of claims 1-2.

[0019] The present invention also provides an application of a DON-producing Fusarium detection kit in detecting DON-producing Fusarium.

[0020] Furthermore, the reaction system for detecting DON-producing Fusarium is based on 25 μL:

[0021] Buffer solution 14.7μL, 10μM forward primer 1μL, 10μM reverse primer 1μL, 10μM probe 0.3μL, lyophilized enzyme powder 2.5mg, DNA or plasmid solution 1-5μL, 175mM magnesium acetate solution 2μL, ddH2O to make the volume up to 25μL.

[0022] Furthermore, the reaction temperature for detecting DON-producing Fusarium is 42° C. and the reaction time is 10 to 30 minutes.

[0023] The beneficial effects of the present invention compared with the prior art are:

[0024] (1) The present invention applies MIRA detection technology to DON-producing Fusarium detection for the first time. By comparing the Tri toxin-producing gene clusters of the main DON-producing Fusarium - Fusarium graminearum (F.graminearum), Fusarium asiaticum (F.asiaticum), Fusarium pseudograminearum (F.pseudograminearum) and Fusarium culmorum (F.culmorum), highly homologous sequences are screened as specific amplification targets, and primer-probe combinations are designed for real-time fluorescent MIRA detection to obtain primer and probe combinations for detecting DON-producing Fusarium. The primer and probe combination for detecting DON-producing Fusarium in the present application has strong specificity and high sensitivity.

[0025] (2) The method for detecting DON-producing Fusarium using the primer and probe combination for detecting DON-producing Fusarium of the present invention has the advantages of simple operation, portable supporting equipment, short time consumption, high sensitivity, automatic result interpretation, etc. The amplification detection only takes about 20 minutes, which can realize rapid on-site detection, timely discover the risk of DON-producing Fusarium contamination, intervene in advance, avoid the risk or reverse the loss. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative labor.

[0027] Figure 1 is the forward primer amplification result in Example 1;

[0028] Figure 2 is the reverse primer amplification result in Example 1;

[0029] Figure 3 The probe amplification result in Example 1;

[0030] Figure 4 The amplification temperature verification result in Example 2;

[0031] Figure 5 This is the specificity verification result in Experimental Example 1;

[0032] Figure 6 This is the sensitivity result of plasmid detection in Experimental Example 2;

[0033] Figure 7 This is the sensitivity result of genomic DNA detection in Experimental Example 2. DETAILED DESCRIPTION

[0034] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0035] It should be understood that the terms described in the present invention are only for describing special embodiments and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. Each smaller range between the intermediate value in any stated value or stated range and any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0036] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0037] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to the skilled artisan. The present invention description and examples are exemplary only.

[0038] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0039] In the present invention, a highly homologous base sequence (SEQ ID NO.22) that can meet the requirements of primer probe design is:

[0040] TACTTCTTGAGAGGGATACCCTTCTGTTGTGCCTCGATCCATCGCTCAGGCTTGAACTTTTCGGGCTCGGGGAAATTTCTTGGGATCGGTGTGCATGAAATAGGTGGACTGAGAAATGGGAGTCTGTGACAATTGTTAGTACGCATAGATATAGAGAGATAGAAAATAAACCTACTCCTTTAGGGATGACATGCTCCTTGTACTTCAAGTTCTCCTGAGTAGCCACACGTCCCGAGCGAGAAAT.

[0041] Example 1

[0042] In Example 1 of the present invention, MIRA forward and reverse primers and probes for detecting DON Fusarium were prepared, and the specific method was as follows:

[0043] (1) Target sequence selection

[0044] The MIRA detection primer probe was designed with the Tri toxin-producing gene cluster sequence as the target, and the Tri toxin-producing gene cluster sequences of different DON-producing Fusarium species were obtained from the NCBI website. After Blast comparison, a highly homologous base sequence that met the requirements for primer probe design was screened and confirmed (see sequence SEQ ID NO.23).

[0045] (2) Primer and probe design

[0046] Probe design:

[0047] The probe triggers the fluorescence reaction by specifically binding to the amplification product, thereby achieving result determination. In order to achieve the best effect, the length of the MIRA detection probe should be between 46 and 52 nucleotides. Specifically, there should be at least 30 nucleotides from the 5' end of the probe to the tetrahydrofuran labeling site, and at least 15 nucleotides from the 3' end to the same labeling site. The probe should include a flanking dT-fluorophore, usually fluorescein, an abasic nucleotide analog-tetrahydrofuran [THF] residue, a dT-quencher, generally a black hole quencher [BHQ], and a 3'-modification group to prevent further extension of the probe. In the probe design process, the key is to find two T nucleotide residues that are very close to each other (only 1 to 5 nucleotides away). One of the T residues is replaced by a dT-fluorophore, the other is replaced by a dT-quencher, and at any position between the two residues, it is replaced by a tetrahydrofuran [THF] residue. The probe is shown in the sequences SEQ ID NO.20 and SEQ ID NO.21 in Table 1.

[0048] Primer design:

[0049] Multiple primers are designed in the upstream and downstream regions of the probe, and the length should be between 30 and 36 bases. It is particularly important to note that the primers in the opposite direction to the probe should avoid overlapping with the probe sequence to prevent the formation of primer dimers. For primers in the same direction as the probe, they can overlap with the 5' end of the probe, but the overlapping region must exclude the tetrahydrofuran [THF] site and the sequence after it. The primers are shown in the sequences SEQ ID NO.1 to SEQ ID NO.20 in Table 1.

[0050] Table 1 Primer and probe sequences

[0051]

[0052]

[0053] (3) Establishment of detection methods

[0054] Standard plasmid construction:

[0055] Primers were designed according to the target DNA sequence, and the target sequence was obtained by PCR amplification. The target sequence was connected to the PUC57 vector and transformed into Escherichia coli competent cells for enrichment culture. Positive clones were picked for sequencing verification, and standard plasmids were obtained after plasmid extraction.

[0056] Standard plasmid target sequences:

[0057] GATACCCTTCTGTTGTGCCTCGATCCATCGCTCAGGCTTGAACTTT TCGGGCTCGGGGAAATTTCTGGGATCGGTGTGCATGAAATAGGTGGAC TGAGAA (SEQ ID NO. 23, 100bp)

[0058] Primer probe screening:

[0059] First, a forward primer and probe MIRA-Fus-Pr1 were fixed, and paired with 8 reverse primers (SEQ ID NO.12 to SEQ ID NO.19) respectively, and amplification reaction was carried out according to the amplification system in Table 2. By analyzing the intensity, peak onset time and peak shape of the fluorescence signal, MIRA-Fus-R4 was screened out as the optimal reverse primer; then, this forward primer and probe MIRA-Fus-Pr1 were paired with 11 forward primers (SEQ ID NO.1 to SEQ ID NO.11) respectively, and amplification reaction was carried out according to the amplification system in Table 2, and based on the same analysis criteria, MIRA-Fus-F9 was determined to be the best forward primer; finally, the working performance of the two probes was compared, and MIRA-Fus-Pr1 was confirmed to be the best probe sequence. The results are shown in FIG. Figure 1 , 2 、3.

[0060] The buffer solution in Table 2 was purchased from Amp Future, 24022901C; the freeze-dried enzyme powder was purchased from Amp Future, 24022901C; and the magnesium acetate solution was purchased from Amp Future, 24022901C.

[0061] Table 2 Amplification reaction system

[0062]

[0063] Example 2

[0064] Example 2 of the present invention detected the influence of different amplification temperatures on the amplification effect, and the specific method is as follows:

[0065] TE buffer was added to the plasmid prepared in step (3) of Example 1, and gradient dilution was performed to obtain a concentration of 3.9×10 4 copies / μL of standard plasmid solution. According to the system in Table 2, add 1μL of standard plasmid solution, 2.3μL of primer-probe mixture and 5μL of ddH2O to 14.7μL of buffer solution, mix well and transfer all to a 2.5mg freeze-dried enzyme powder tube. Invert several times until the enzyme powder is completely dissolved, add 2μL of magnesium acetate solution and mix well. Place in a constant temperature amplification fluorescence detector at 37℃, 38℃, 39℃, 40℃, 41℃ and 42℃ for amplification. Set the reaction time to 20min. After the reaction, determine the optimal reaction temperature to be 42℃ based on the fluorescence signal, peak time and peak shape. The results are shown in the figure. Figure 4 .

[0066] Test Example 1

[0067] Test Example 1 of the present invention detects the specificity of the probe and primer in Example 1, and the specific method is as follows: Fusarium graminearum, F. asiaticum, F. pseudograminearum, F. culmorum, F. verticillioides, F. fujikuroi, F. proliferatum, F. equiseti, F. tricinctum, F. oxysporum, Acremonium sp, Acremonium alternatum, Aspergillus flavus, A. niger, A. versicolor, A. amstelodami, Alternaria alternata, Alternaria alternata, tenuissima), Talaromyces assiutensis, Chaetomium globosum, Penicillium aurantiogriseum, P. Chrysogenum, P. aurantiogriseum, using the reverse primer MIRA-Fus-R4, forward primer MIRA-Fus-F9, and probe MIRA-Fus-Pr1 of Example 1, the reaction system of the above 23 strains was configured according to the amplification reaction system shown in Table 2, and the reaction time was set to 20 min and the reaction temperature was set to 42°C. MIRA detection was performed on the above strains, and the results were as follows Figure 5 shown.

[0068] Depend on Figure 4 It can be seen that only four strains of Fusarium graminearum, Fusarium asiatica, Fusarium pseudograminearum and Fusarium genus showed amplification curves (positive), while other strains had no amplification curves (negative), which confirmed that this method has good detection specificity.

[0069] Test Example 2

[0070] Experimental Example 2 of the present invention detected the specificity of the probe and primers in Example 1, and the specific method was as follows:

[0071] (1) Plasmid detection sensitivity

[0072] The plasmid constructed in Example 1 was diluted in series, and 6 dilutions were selected. The amplification test was performed using the method of Experimental Example 1. Each dilution was repeated 3 times. The results are as follows: Figure 6 The detection limit of plasmid was 19.5 copies / μL.

[0073] (2) DNA detection sensitivity

[0074] The mixed DNA solution of Fusarium graminearum, Fusarium asiatica, Fusarium pseudograminearum and Fusarium leucoderma was diluted in a gradient manner, and amplification detection was performed using the method of Experimental Example 1. Each concentration was repeated 3 times. The results are as follows: Figure 7 The DNA detection limit was 15 fg / μL.

[0075] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A primer-probe combination for rapid detection of DON-producing Fusarium based on MIRA, characterized in that: The primer-probe combination for rapid detection of DON-producing Fusarium based on MIRA consists of the following sequences: Forward primer MIRA-Fus-F9, SEQ ID NO.9: CTGTTGTGCCTCGATCCATCGCTCAGGCTTGAACT; Reverse primer MIRA-Fus-R4, SEQ ID NO.15: CAGTCCACCTATTTCATGCACACCGATCCCAAGA; Probe MIRA-Fus-Pr1, SEQ ID NO.20: GTTGTGCCTCGATCCATCGCTCAGGCTTGAACT / FAM / Spacer / BHQ1 / CGGGCTCGGGGAAA / C3-Spacer.

2. The primer-probe composition for rapid detection of DON-producing Fusarium based on MIRA according to claim 1, characterized in that: The front part of the probe MIRA-Fus-Pr1 sequence partially overlaps with the forward primer sequence, and the rear part of the probe sequence does not overlap with the reverse primer sequence; the probe MIRA-Fus-Pr1 has a total of 4 modification sites: the 34th base is labeled with a fluorescent group, the 35th base is labeled with tetrahydrofuran, the 36th base is labeled with a quenching group, and the 3' end is modified with a blocking group.

3. A DON-producing Fusarium detection kit, characterized in that The DON-producing Fusarium detection kit comprises the primer-probe combination for rapid detection of DON-producing Fusarium based on MIRA according to any one of claims 1-2.

4. Application of a DON-producing Fusarium detection kit in detecting DON-producing Fusarium.

5. Use of the DON-producing Fusarium detection kit according to claim 4 in detecting DON-producing Fusarium, characterized in that: The reaction system for detecting DON-producing Fusarium is based on 25 μL: Buffer solution 14.7 μL, 10 μM forward primer 1 μL, 10 μM reverse primer 1 μL, 10 μM probe 0.3 μL, lyophilized enzyme powder 2.5 mg, DNA or plasmid solution 1-5 μL, 175 mM magnesium acetate solution 2 μL, and add ddH2O to make the volume 25 μL.

6. Use of the DON-producing Fusarium detection kit according to claim 4 in detecting DON-producing Fusarium, characterized in that: The reaction temperature for detecting DON-producing Fusarium is 42° C. and the reaction time is 10 to 30 min.

Images