Method for screening cool-sensing substances by TRPM8 stably transfected cell strain and construction of cell model of TRPM8 stably transfected cell strain

Abstract

The invention belongs to the technical field of gene engineering, and particularly relates to a method for screening cool-sensing substances from a TRPM8 stably transfected cell strain and construction of a cell model of the TRPM8 stably transfected cell strain. Wherein the cell model comprises a carrier, the carrier comprises a TRPM8 gene, and the nucleotide sequence of the TRPM8 gene is shown as SEQ ID No: 1. The invention provides an application of a TRPM8 gene in evaluation of a cool-sensing substance, and the application adopts the TRPM8 gene to construct a cell model, then adopts the cool-sensing substance to process the cell model, and detects the relative value of the fluorescence intensity of the cell model to evaluate the cool-sensing substance.

Description

Technical Field

[0001] The present invention belongs to the field of genetic engineering and relates to activation TRPM8 The invention relates to cooling substances of ion channels, and specifically relates to a method for screening cooling substances by using a TRPM8 stably transfected cell line and the construction of a cell model thereof. Background Art

[0002] TRPM8 Transient receptor potential (TRP) transient receptor potential, TRP ) channel family, which contains multiple subfamilies, divided into TRPC, TRPM, TRPV, TRPA, TRPP and TRPM Sub-tribe. Most TRP The channel is located in the plasma membrane, and some channel proteins can be located on the membrane of endosomes and lysosomes to play their functions, such as TRPM Subfamily proteins. TRPM Subfamily also TRP The largest subfamily of the family, including TRPM1 - 8 . TRPM8 It is called the cold receptor, which is activated once the temperature drops below 26°C. In addition to temperature, it can also be triggered by voltage, pH changes, and a variety of chemicals. David Julius, winner of the 2021 Nobel Prize in Physiology, used the chemical menthol to identify TRPM8 ,after TRPM8 Also called menthol receptor. When the temperature is below 26°C or menthol is present, TRPM8 The channel opens, allowing positively charged particles such as calcium ions to enter the cell. When activated, it allows sodium ions, potassium ions, cesium ions, and calcium ions to enter the cell, which causes the cell to depolarize and generate an action potential, which ultimately causes the organism to feel cold. Research has found that TRPM8 Activation not only has good efficacy in treating Sjögren's syndrome, oral ulcers, herpes, asthma, and cough, but also has great prospects in the preparation of anti-pulmonary hypertension drugs.

[0003] Cooling substances are also called cooling agents, which are a general term for compounds that can make people feel cool. Menthol is a well-known cooling substance, which can activate TRPM8 , which causes Ca 2+ Flowing into cold-sensitive neurons, the resulting electrical signals are ultimately perceived as a cooling sensation. However, the minty flavor of menthol is very distinct, and it tastes sweet and spicy when used in large quantities, but the cooling effect is not obvious when used in low quantities. Excessively high concentrations of menthol are not only highly volatile, but also highly irritating to the eyes, and these defects seriously restrict its effectiveness. Of course, the current market for cooling agents is still large, and isomenthone, menthyl acetate, menthyl lactate, WS-2, WS13, etc. are excellent substitutes for menthol, but there is a lack of methods for rapid screening of cooling agents.

[0004] Prior art CN108473484A discloses a TRPM8 The compound of the conditioning agent belongs to the technical field of cooling agents, and provides a variety of TRPM8 The preparation of the compounds of the regulators and the classification of the uses of the various regulators are also carried out. In particular, there are many compounds of cooling agents, but the specific cooling effects on the human body cannot be compared.

[0005] Judging whether a cooling agent can achieve a good cooling effect only by sensory perception is not only time-consuming, but may also have various effects on the human body. Therefore, developing a model for screening cooling substances is crucial to people's cooling experience. Summary of the invention

[0006] In order to solve the above problems, the present invention provides the following technical solutions: The present invention provides a TRPM8 Application of genes in the evaluation of cooling substances, the TRPM8 sequence number is NM_024080.5, and the nucleic acid sequence is shown in SEQ ID No: 1.

[0007] SEQ ID No: 1:

[0008] Specifically, the application adopts TRPM8 A cell model is constructed by gene, and then the cell model is treated with cooling substances and the relative value of the fluorescence intensity of the cell model is detected to evaluate the cooling substances.

[0009] Furthermore, the evaluation includes screening or quality control.

[0010] In some embodiments, the cooling substance comprises menthol or menthol nicotinate.

[0011] The present invention provides a model for screening cooling substances, wherein the model is a cell model, wherein the cell model includes a carrier, and the carrier includes TRPM8 Gene, described TRPM8 The nucleotide sequence of the gene is shown in SEQ ID No:1.

[0012] Furthermore, the vector is a lentiviral vector, and the cell model is based on HEK293.

[0013] Furthermore, the cell model can also be based on SH-SY5Y and HaCaT.

[0014] In another aspect, a method for constructing a cell model is provided, comprising: TRPM8 Construction and characterization of recombinant plasmids containing genes TRPM8 The recombinant plasmid stably transformed cell line.

[0015] Furthermore, the recombinant plasmid is inserted TRPM8 Lentiviral vectors for gene fragments.

[0016] The construction method described therein comprises the following steps: (1) Cloning using human cDNA as template TRPM8 Gene fragments; (2) Cloning TRPM8 Insertion of gene fragment XbaI and EcoRI Double restriction endonuclease lentiviral vector pcSLenti - EF1 - EGFP - P2A - Puro - CMV - MCS - 3xFLAG - WPRE ; (3) Construct stable cell lines by transfecting cells with lentiviral vectors.

[0017] Furthermore, in step (1), cloning TRPM8 The primers for the gene fragments are: CMV-F: CGCAAATGGGCGGTAGGCGTG; WPRE-R: CATAGCGTAAAAGGAGCAACA.

[0018] Furthermore, in step (2), the lentiviral vector is derived from the target virus ( pcSLenti - EF1 - EGFP - P2A - Puro - CMV - TRPM8 - 3xFLAG - WPRE and meta-construct H37273), using restriction endonucleases XbaI and EcoRI The vector was digested with enzymes, and the digested product was recovered using a gel recovery kit.

[0019] Furthermore, in step (2), the lentiviral vector carries an EGFP tag and a Flag tag.

[0020] Furthermore, in step (2), the cloned TRPM8 The gene fragments were ligated to the digested vector using T4 ligase.

[0021] In another aspect, the cell model is used in the evaluation of cooling substances.

[0022] In another aspect, a method for evaluating a cooling substance is provided by detecting a relative value of fluorescence intensity of a cell model. Further, the fluorescence intensity reflects the influx of calcium ions labeled by a fluorescent probe.

[0023] Furthermore, the calcium ion fluorescent probe includes but is not limited to Rhod-2 reagent.

[0024] In summary, the present invention successfully constructs a method for TRPM8 A model for screening cooling substances using stable cell lines.

[0025] The beneficial effects of the present invention include: The present invention provides a stable overexpression TRPM8 Cells with the gene can be frozen and revived for a long time, maintaining a high expression state, which is conducive to the screening of cooling substances. pcSLenti - EF1 - EGFP - P2A - Puro - CMV - MCS - 3xFLAG - WPRE Contains both EGFP and Flag tags, which is beneficial for overexpression TRPM8 Observation and screening of stably transfected cells. The virus can also infect SH-SY5Y and HaCaT cells, meeting the toxicity screening of cells from different sources. Finally, the screening of cooling substances can be achieved and objective relative values ​​can be given. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art are briefly introduced below.

[0027] Figure 1 for pcSLenti - EF1 - EGFP - P2A - Puro - CMV - MCS - 3xFLAG - WPRE Plasmid map; Figure 2 is the recombinant plasmid map; Figure 3This is the result of fluorescence screening of stable cell lines; Figure 4 For WB detection TRPM8 Expression results of stable cell lines. DETAILED DESCRIPTION

[0028] The present invention is further described in detail below in conjunction with embodiments and drawings, but the embodiments of the present invention are not limited thereto.

[0029] Experimental reagents and instruments:

[0030] The present invention will be further described below in conjunction with embodiments: Example 1 Construction of a cell model for evaluating cooling substances 1. TRPM8 Construction of recombinant plasmids (1) NCBI database search TRPM8 Gene sequence (NM_024080.5), primer5.0 software design TRPM8 Primers containing the gene CDS sequence and restriction site sequences. TRPM8 T clone of gene fragment. PCR primer sequences are as follows: Upstream primer: CAGCACTGGCACCTGAAAAC; Downstream primer: GGACTGCGCGATGTAGATGA.

[0031] The PCR reaction system is as follows: Table 1 PCR reaction system

[0032] The PCR reaction conditions are as follows: Table 2 PCR reaction program conditions

[0033] The PCR amplification product was subjected to agarose gel electrophoresis and the PCR product was recovered using a gel recovery kit to obtain XbaI and EcoRI TRPM8 gene fragment with double restriction enzyme cutting sites.

[0034] (2) XbaI and EcoRI Double restriction endonuclease lentiviral vector pcSLenti - EF1 - EGFP - P2A - Puro - CMV - MCS - 3xFLAG - WPRE , digested at 37℃ for 2h, and the digested products were recovered by kit.

[0035] The enzyme digestion system is as follows: Table 3 Enzyme digestion system

[0036] (3) Ligation using T4 ligase TRPM8 The gene fragment and the restriction vector were ligated and competent cells were added to the product. The recombinant lentiviral plasmid was sequenced, and the sequencing results confirmed that the sequence of the recombinant lentiviral plasmid was completely correct.

[0037] (4) Culture HEK293 cells in DMEM complete medium in advance, control the cell density at the time of transfection to 70-80%, inoculate the cells into the cell culture dish, remove the original cell culture medium, add 10mL of Opti-MEM™ I reduced serum medium (purchased from Gibco, catalog number 31985070), and return the cells to the incubator. Add the transfection reagent diluent to the plasmid diluent, mix well and place at room temperature for 20 minutes to allow the DNA and transfection reagent to fully combine to form a stable transfection complex. Add the prepared transfection complex to the cell culture plate and return it to the incubator for culture. 48 hours after transfection, collect the virus for the first time and collect the culture medium into a 50mL centrifuge tube. 72 hours after transfection, collect the virus for the second time, add DPBS to each tube according to the amount of precipitation, 80μL-120μL / tube, seal the tube mouth with sealing film, and dissolve the precipitation at 4℃ overnight. For the same virus, collect the virus to the last tube using the tube-by-tube collection method, then collect it twice with 100 μL DPBS, collect all of it into a 1.5 mL EP tube, package the virus as required, and store it in a -80°C refrigerator.

[0038] (5) Take a TRPM8 stable cell line with good growth status, extract the cell genomic DNA, and perform a real-time PCR experiment to determine the titer. Quantification was completed on ABI7500, and SYBR Master Mixture was from TAKARA. In this study, a pair of specific primers and housekeeping gene primers were designed and synthesized, and the sequences are shown below.

[0039] Table 4 Primer sequences

[0040] Table 5 PCR program

[0041] According to the above procedure, the results showed that the average titer of the virus was 3.74*10 7 mL.

[0042] (6) TRPM8 Screening of stable transfectants. After 72 hours of infection of HEK293 cells, add puromycin at a final concentration of 2 μg / mL. Replace the culture medium with fresh puromycin at a final concentration of 2 μg / mL every 2-3 days. After drug screening, take fluorescent photos and the results show TRPM8The stable transfection efficiency is 80%. Alternatively, the membrane protein was extracted using the Bio-Tech membrane protein extraction kit, and the membrane protein expression level was verified using WB antibodies (Flag, primary antibody dilution concentration was 1:1000; Goat Anti-mouse IgG, secondary antibody dilution concentration was 1:5000, overnight incubation). The sample loading conditions are shown in Table 6. Figure 4 The results showed that TRPM8 protein was detected in HEK293-H37273 samples.

[0043] Table 6 Sample addition of WB experimental samples

[0044] Example 2 TRPM8 Stable cell lines (cell models) for screening of cooling substances In this example, the cell model constructed in Example 1 was used to screen for cooling substances. The cell model described below is a cell model that stably expresses TRPM8 As a specific example, this embodiment uses menthol and menthol nicotinate as evaluation objects.

[0045] The cell model was cultured in a 96-well plate using DMEM liquid culture medium containing 2 μg / mL puromycin, with each well containing 10 4 The cell models and the volume of culture medium in each well were the same, and each well was divided into a zero adjustment group, a negative group, a menthol group (1mM), and a menthol nicotinate group (0.1%). Only culture medium was added to the negative group; there were no cells in the zero adjustment group (equivalent to the blank control). After the menthol group and the menthol nicotinate group were treated with the corresponding cooling substances for 30 minutes, the culture medium was discarded, HBSS (without calcium and magnesium ions) was washed three times, 30μL of calcium ion fluorescent probe Rhod-2 reagent was added, and the fluorescence intensity was detected after incubation at room temperature (37°C) for 30 minutes. The excitation light was 549nm and the emission light was 578nm. The results are as follows: Table 7 Fluorescence intensity of different groups

[0046] In Table 7, the relative fluorescence intensity refers to the relative negative group (i.e., cells not treated with cooling substances). The above results show that the cell model constructed by the present invention can be used to evaluate the cooling effect of cooling substances.

[0047] Example 3 Refer to Example 2, except that the amount of fluorescent reagent Rhod-2 added is 25 μL; The final concentrations of menthol and menthol nicotinate were 1 mM and 0.1%, respectively; The test results are as follows: Table 8 Fluorescence intensity of different groups

[0048] The results in Table 8 indicate that reducing the amount of fluorescent reagent Rhod-2 added will affect the cooling effect of menthol and menthol nicotinate.

[0049] Example 4 Referring to Example 2, the difference is that the cooling substances are WS-3 and WS-5 known on the market, and the final concentrations are 3.7 μM and 4.3 μM respectively. The test results are: Table 9 Fluorescence intensity of different groups

[0050] The results in Table 9 show that under the negative control group, WS-3 has a better cooling effect than WS-5, which is consistent with the fact that commercially available WS-3 has a better cooling effect than WS-5.

[0051] Comparative Example 1 The calcium ion fluorescent probe Rhod-2 in Example 2 was replaced with Fluo3 to conduct experiments and statistically analyze the results.

[0052] Table 10 Fluorescence intensity of different groups

[0053] Comparative Example 2 Referring to Example 2, the final concentration of menthol was adjusted to 3 mM.

[0054] Table 11 Fluorescence intensity of different groups

[0055] Comparative Example 3: Referring to Example 2, the incubation time of the fluorescent probe was adjusted to 40 min.

[0056] Table 12 Fluorescence intensity of different groups

[0057] The results in Tables 10, 11 and 12 show that changing the fluorescent probe, menthol concentration and fluorescent probe incubation time does not have as good a technical effect as Example 2 of the present application.

[0058] Finally, it should be noted that the above content is only used to illustrate the technical solution of the present invention, rather than to limit the scope of protection of the present invention. Simple modifications or equivalent substitutions of the technical solution of the present invention by ordinary technicians in this field do not deviate from the essence and scope of the technical solution of the present invention.

Claims

1. TRPM8 The application of genes in the evaluation of cooling substances is characterized in that: The TRPM8 The nucleotide sequence of the gene is as shown in SEQ ID No: 1, and the application is: using TRPM8 A cell model is constructed by gene, and then the cell model is treated with cooling substances and the relative value of the fluorescence intensity of the cell model is detected to evaluate the cooling substances.

2. The use according to claim 1, characterized in that: Said evaluation includes screening or quality control.

3. The use according to claim 1, characterized in that: The cooling substance includes menthol or menthol nicotinate.

4. A model for screening cooling substances, characterized in that: The model is a cell model, and the cell model includes a carrier, and the carrier includes TRPM8 Gene, described TRPM8 The nucleotide sequence of the gene is shown in SEQ ID No:

1.

5. The model according to claim 4, characterized in that The vector is a lentiviral vector, and the cell model is based on HEK293.

6. The method for constructing a model according to any one of claims 4 to 5, characterized in that: The construction method comprises TRPM8 Construction and characterization of recombinant plasmids containing genes TRPM8 The recombinant plasmid stably transformed cell line.

7. The construction method according to claim 6, characterized in that: The recombinant plasmid is inserted TRPM8 The lentiviral vector of the gene fragment; the construction method comprises the following steps: cloning TRPM8 Insertion of gene fragment Xgf and EcoRI Double enzyme digestion of lentiviral vector; lentiviral vector transfected cells to construct a stable cell line, thus obtaining a cell model.

8. Use of the model described in any one of claims 4 to 5 or the construction method described in any one of claims 6 to 7 in the evaluation of cooling substances.

9. A method for evaluating a cooling substance, characterized in that: The method comprises treating the cell model according to any one of claims 4 to 5 with a cooling substance, and then detecting the relative value of the fluorescence intensity of the cell model for evaluation.

10. The method according to claim 9, characterized in that The fluorescence intensity reflects the influx of calcium ions labeled with the fluorescent probe.

11. The method according to claim 10, characterized in that Fluorescent probes include, but are not limited to, the calcium ion fluorescent probe Rhod-2.

Images