Method, system, equipment and medium for analyzing EML4-ALK fusion gene type

Abstract

The invention discloses a method, a system, equipment and a medium for analyzing EML4-ALK fusion gene types, and belongs to the technical field of fusion gene detection. The method comprises the following steps: obtaining RNA sequencing data of a sample to be detected; obtaining a primer coverage area sequence file according to the primer combination coverage area; carrying out second comparison on the RNA sequencing data and the primer coverage area sequence file; and counting the quantity of the sequencing data which can be simultaneously compared to the exon sequences of the two genes. By utilizing the method and the system disclosed by the invention, the fusion gene of an unknown type can be accurately detected, and the development of downstream related action mechanism and function research on the fusion gene is more facilitated.

Description

[0001] Related patents This application is a divisional application of the Chinese invention patent application with application number 2024108311341, application date June 26, 2024, and invention name “A method, system, device and medium for analyzing fusion gene types based on RNA sequencing”. Technical Field

[0002] The present invention belongs to the technical field of fusion gene detection, and in particular, relates to a method, system, device and medium for analyzing the type of EML4-ALK fusion gene. Background Art

[0003] The incidence and mortality of lung cancer rank first among malignant tumors in my country, of which non-small cell lung cancer (NSCLC) accounts for about 85%, and >70% of patients are already in the advanced stage when diagnosed. Gene fusion (gene rearrangement) is one of the driving factors of non-small cell lung cancer. Fusion of the echinoderm microtubule associated protein link4 (EML4) gene and the anaplastic lymphoma kinase (ALK) gene is the most common type of ALK fusion. All EML4-ALK fusion genes have certain biological activity, which can lead to continuous high expression of ALK tyrosine kinase, thereby activating downstream PI3K / AKT, MAPK and other signaling pathways, thereby driving tumor occurrence and metastasis. The positive rate of ALK rearrangement (fusion) in NSCLC patients is about 3%~7%, and the positive rate in Chinese NSCLC patients is about 3%~11%. In particular, in patients with lung adenocarcinoma without mutations in EGFR and KRAS, the positive rate of ALK rearrangement (fusion) is as high as 30%~42%.

[0004] A large number of studies have shown that personalized molecular targeted therapy targeting driver genes has significant efficacy and high safety for NSCLC patients. For ALK fusion, currently recommended targeted drugs include ALK inhibitors Ceritinib, Alectinib, Crizotinib, and Brigatinib. Crizotinib, a targeted drug for ALK fusion, is already available in China.

[0005] At present, the main technologies used for fusion gene detection include fluorescence in situ hybridization (FISH), reverse transcription polymerase chain reaction (RT-PCR), immunohistochemistry (IHC), and next-generation sequencing (NGS). Traditional methods such as fluorescence in situ hybridization, immunohistochemistry, and RT-PCR have disadvantages such as low throughput and high operation requirements. Next-generation sequencing (NGS) has the advantages of high throughput, wide detection range, and the ability to analyze unknown types of fusion genes. It has gradually received attention and promotion in recent years.

[0006] Fusion gene detection can be performed at the DNA level or at the RNA level. Structural variations at the DNA level do not necessarily affect transcribed cancer-driving RNA, which in turn affects protein synthesis. RNA-level detection can accurately determine the type of fusion gene that is transcribed, and can also serve as a confirmation of the fusion results detected at the DNA level. Combining multiple PCR amplification and high-throughput sequencing methods, multiple types of fusion types can be detected at one time.

[0007] The raw data obtained by high-throughput sequencing needs to be analyzed to obtain the fusion gene type of RNA origin. The analysis process of high-throughput sequencing data generally includes steps such as data quality control, sequence alignment, and alignment result statistics; the key point of fusion gene analysis is to obtain the fusion gene and the site where the fusion occurs. Gene fusion has multiple subtypes, which may have certain similarities and differences in sequence. Different subtypes may have different biological and clinical significance, and they should be distinguished as much as possible in the analysis. However, there is currently a lack of effective analysis methods to make the detection of fusion gene subtypes more accurate. Summary of the invention

[0008] In order to solve at least one of the above technical problems, the technical solution adopted by the present invention is as follows: The first aspect of the present invention provides a method for analyzing fusion gene types based on RNA sequencing, comprising the following steps: Obtain RNA sequencing data of the sample to be tested; Obtaining a fusion gene reference sequence file based on a known type of fusion gene, including at least the name of the known type of fusion gene and a fusion reference sequence, wherein the fusion reference sequence is obtained by extending 60 to 75 bases forward and backward from the breakpoint, and thus, it can be known that the length of the fusion reference sequence is 120 bp to 150 bp; The RNA sequencing data is first compared with the fusion reference sequence file, and the following processing is performed: (1) If the base mismatch ratio between a sequencing data and the fusion reference sequence is less than 5%, the sequencing data will be retained; (2) If a sequencing data crosses the breakpoint on the fusion reference sequence and the number of bases covered on both sides of the breakpoint is greater than 20, then the sequencing data can be aligned to the fusion reference sequence. (3) If a sequencing data can be aligned to multiple fusion reference sequences in the fusion reference sequence file, only the result of the priority alignment is retained. The number of sequencing data that can be aligned to each fusion reference sequence is counted. If the number of sequencing data that can be aligned to a certain fusion reference sequence is greater than a preset threshold, the sample to be tested has undergone a corresponding type of gene fusion.

[0009] In the present invention, gene fusion refers to the fusion of the first part of the first gene and the second part of the second gene. The first gene is abnormally broken at a certain point and fused with the second gene to form a hybrid gene composed of two genes that were originally far apart, i.e., a fusion gene. Gene fusion is also called gene rearrangement, i.e., the order of gene arrangement on chromosomes changes.

[0010] In some embodiments of the present invention, the name of the known type of fusion gene in the fusion gene reference sequence file includes at least the first gene name, the exon number of the first gene where fusion occurs; and the second gene name, the exon number of the second gene where fusion occurs.

[0011] In some specific embodiments of the present invention, the first gene is the EML4 gene, and the second gene is the ALK gene. The fusion gene composed of EML4-ALK consists of two parts, EML4 provides a sequence from the beginning to a certain exon in the middle, and the middle position is not unique. ALK provides a sequence from a certain exon in the middle to the end, and the middle position is not unique. The connection site of the two genes is called a fusion site or a break site.

[0012] EML4 belongs to the echinoderm microtubule-associated protein family, including the WD-repeat region, the N-terminal Basic region and the HELP domain. They are all related to the tumorigenic potential of EML4-ALK, and the Basic region plays an important role in the dimerization of EML4-ALK. Removal of the Basic region can reduce the catalytic activity of the EML4-ALK fusion protein by 84%. It can be inferred that the Basic region may be the key region for the EML4-ALK fusion protein to function.

[0013] ALK is a member of the insulin receptor superfamily and can fuse with multiple genes such as ATIC-, TFG-, and CLTC-. Its structure includes: extracellular ligand binding region, transmembrane region, and intracellular tyrosine kinase region.

[0014] EML4 and ALK are located on the short arm of chromosome 2, but in opposite directions, 12Mb apart. When fused, one of EML4 or ALK must connect to the other in the opposite direction. The EML4-ALK gene subtype depends on the location of the breakage of the two. Therefore, the EML4 breakpoint is variable. The breakpoints that have been detected so far are exons 2, 6, 13, 14, 15, 17, 18, 20 and 23, which form at least 8 types of EML4-ALK fusion genes: EML4-ALK.E13:A20. COSF408, EML4-ALK.E6a:A20.COSF411, EML4-ALK.E6:A20.COSF1544, EML4-ALK.E6:A19.COSF1296, EML4-ALK .E20:A20.COSF409, EML4-ALK.E18:A20.COSF487, EML4-ALK.E14:A20.COSF491 and EML4-ALK.E2:A20.COSF478.

[0015] In some embodiments of the present invention, the reference sequences of the above 8 types of EML4-ALK fusion genes are shown as SEQ ID No. 1 to SEQ ID No. 8, respectively.

[0016] In some embodiments of the present invention, the RNA sequencing data of the sample to be tested is obtained by the following steps: Obtaining RNA samples of samples to be tested; performing multiplex PCR amplification on the RNA sample using a primer combination; The amplified product is subjected to high-throughput sequencing to obtain the RNA sequencing data.

[0017] In some embodiments of the present invention, the sample to be tested is a biological sample of a subject, and the biological sample includes but is not limited to paraffin-embedded tissue samples, pathological tissue samples, blood samples, pleural effusion samples and cerebrospinal fluid samples.

[0018] In some embodiments of the present invention, the step of performing quality control on RNA sequencing data is further included: (1) Removal of linker sequences; (2) Remove low-quality sequences, If the remaining data is greater than 200,000, the quality control is qualified.

[0019] In some embodiments of the present invention, the method for analyzing fusion gene types based on RNA sequencing further comprises: According to the exon sequences of the first gene and the second gene of the fusion gene corresponding to the primer combination coverage area, a primer coverage area sequence file is obtained, which at least includes the gene name, exon number and exon sequence of the first gene and the second gene; and it is saved in the fa file in the format of gene name_exon number, for example, G1_E4 represents exon 4 of the G1 gene.

[0020] The RNA sequencing data is compared with the primer coverage region sequence file for the second time, and the following processing is performed: (1) If a sequencing data can be aligned to multiple exon sequences in the primer coverage region sequence file, all alignment results are retained; (2) If a piece of sequencing data is aligned to both the exon sequence of the first gene and the exon sequence of the second gene, then the sequencing data is a fusion gene sequence: Furthermore, if the sequencing data is aligned to multiple exon sequences of the first gene, the exon with the largest serial number is recorded, for example, if it is aligned to exon 4 (exon4, E4) and exon 5 (exon5, E5) of the first gene at the same time, it is recorded as G1_E5; similarly, if the sequencing data is aligned to multiple exon sequences of the second gene, the exon with the smallest serial number is recorded, for example, if it is aligned to exon 18 (exon18, E18) and exon 19 (exon19, E19) of the second gene at the same time, it is recorded as G2_E18.

[0021] The number of sequencing data that can be simultaneously aligned to two gene exon sequences is counted. If the number of sequencing data that can be simultaneously aligned to two gene exon sequences is greater than a preset threshold, the sample to be tested has undergone a corresponding type of gene fusion. For example, if the number of sequencing data that can be simultaneously aligned to G1_E5 and G2_E18 is greater than a preset threshold, the sample to be tested has undergone a G1_E5-G2_E18 gene fusion, i.e., exon 5 of the G1 gene and exon 18 of the G2 gene have undergone a gene fusion.

[0022] In some embodiments of the present invention, if the type of the obtained fusion gene is known, the name of the corresponding known type of fusion gene is output. As mentioned above, the name of the known type of fusion gene at least includes the first gene name and the exon number of the first gene fusion; and the second gene name and the exon number of the second gene fusion.

[0023] In some embodiments of the present invention, the primer combination includes the nucleotide sequences shown in SEQ ID Nos. 9, 10, 12, 13, 15, 16, 18, 19, 21, and 22, and preferably, also includes the nucleotide sequences shown in SEQ ID Nos. 11, 14, 17, 20, and 23, which are used to block the wild-type amplification of the gene.

[0024] The primer coverage sequence file is designed according to the amplification region of the primer combination. Specifically, all fusion gene types that the primers can amplify are first obtained, and 50 to 70 bases are extended upstream and downstream of the break site of a certain type of fusion gene as the primer coverage region sequence of the type of fusion gene. The second aspect of the present invention provides a system for analyzing fusion gene types based on RNA sequencing, comprising the following modules: A data input module is used to input RNA sequencing data of samples to be tested; A first storage module is used to store a fusion gene reference sequence file obtained based on a known type of fusion gene, wherein the fusion gene reference sequence file at least includes the name of the known type of fusion gene and a fusion reference sequence, wherein the fusion reference sequence is obtained by extending 60 to 75 bases forward and backward from the breakpoint; A first comparison module is connected to the data input module and the first storage module respectively, and is used to perform a first comparison between the RNA sequencing data and the fusion reference sequence file and perform the following processing: (1) If the base mismatch ratio between a sequencing data and the fusion reference sequence is less than 5%, the sequencing data will be retained; (2) If a sequencing data crosses the breakpoint on the fusion reference sequence and the number of bases covered on both sides of the breakpoint is greater than 20, then the sequencing data can be aligned to the fusion reference sequence; (3) If a sequencing data can be aligned to multiple fusion reference sequences in the fusion reference sequence file, only the result of the priority alignment is retained. The known type analysis module of the fusion gene is connected to the first comparison module and is used to count the number of sequencing data that can be compared to each fusion reference sequence. If the number of sequencing data that can be compared to a certain fusion reference sequence is greater than a preset threshold, the sample to be tested has undergone a gene fusion of the corresponding type.

[0025] In some embodiments of the invention, the system further comprises: A second storage module is used to store a primer coverage region sequence file obtained according to the exon sequences of the first gene and the second gene of the fusion gene corresponding to the primer combination coverage region, wherein the primer coverage region sequence file at least includes a gene name, an exon number and an exon sequence; A second comparison module is connected to the data input module and the second storage module respectively, and is used to perform a second comparison between the RNA sequencing data and the primer coverage region sequence file and perform the following processing: (1) If a sequencing data can be aligned to multiple exon sequences in the primer coverage region sequence file, all alignment results are retained; (2) If a piece of sequencing data is aligned to both the exon sequence of the first gene and the exon sequence of the second gene, then the sequencing data is a fusion gene sequence: If the sequencing data is aligned to multiple exon sequences of the first gene, then the exon with the largest sequence number is recorded; similarly, if the sequencing data is aligned to multiple exon sequences of the second gene, then the exon with the smallest sequence number is recorded. The fusion gene all types analysis module is connected to the second comparison module and is used to count the number of sequencing data that can be simultaneously compared to two gene exon sequences. If the number of sequencing data that can be simultaneously compared to two gene exon sequences is greater than a preset threshold, the corresponding type of gene fusion occurs in the sample to be tested.

[0026] In some embodiments of the present invention, the system also includes a fusion gene type integrated analysis module, which is respectively connected to the fusion gene known type analysis module and the fusion gene all type analysis model. If the type of the obtained fusion gene is known, the name of the corresponding known type of fusion gene is output.

[0027] A third aspect of the present invention provides a computer device, comprising: Memory for storing computer programs; A processor is used to implement the steps of a method for analyzing fusion gene types based on RNA sequencing as described in any one of the first aspects of the present invention when executing the computer program.

[0028] The fourth aspect of the present invention provides a computer-readable storage medium, on which a computer program is stored. When the computer program is executed by a processor, the steps of a method for analyzing fusion gene types based on RNA sequencing as described in any one of the first aspects of the present invention are implemented.

[0029] A fifth aspect of the present invention provides a fusion gene, which is EML4_E6-ALK_E18, that is, a gene in which exon 6 of EML4 and exon 18 of ALK gene are fused.

[0030] In some specific embodiments of the present invention, the nucleotide sequence of the fusion gene EML4_E6-ALK_E18 is shown in SEQ ID No. 24.

[0031] In the present invention, primers can be designed based on sequences extending 60 to 75 bases upstream and downstream of the breakpoint of the fusion gene to amplify the fusion gene, thereby completing the detection of the fusion gene. In some specific embodiments of the present invention, the upstream and downstream primers are designed based on the nucleotide sequence shown in SEQ ID No. 25. Of course, those skilled in the art understand that the upstream and downstream primers are located before and after the breakpoint of the site, respectively.

[0032] Beneficial effects of the present invention Compared with the prior art, the present invention has the following beneficial effects: The method and system of the present invention can accurately detect known types of fusion genes, and can also detect unknown types of fusion genes, which is more conducive to the development of downstream research on the mechanism and function of fusion genes. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 A flow chart of a method for analyzing fusion gene types based on RNA sequencing according to Example 1 of the present invention is shown.

[0034] Figure 2 The method for determining whether a read sequence is from a fusion gene in Example 1 of the present invention is shown.

[0035] Figure 3 The comparison result of RNA sequencing data and primer coverage region file in Example 1 of the present invention is shown.

[0036] Figure 4 A schematic diagram of a system for analyzing known types of fusion genes based on RNA sequencing in Example 2 of the present invention is shown.

[0037] Figure 5 A schematic diagram of a system for analyzing all types of fusion genes based on RNA sequencing in Example 3 of the present invention is shown. DETAILED DESCRIPTION

[0038] In order to make the technical problems, technical solutions and beneficial effects solved by the present invention more clearly understood, the present invention is further described in detail below in conjunction with embodiments.

[0039] The following examples are used to demonstrate preferred embodiments of the present invention. It will be appreciated by those skilled in the art that the techniques disclosed in the following examples represent techniques discovered by the inventors that can be used to implement the present invention and therefore can be considered as preferred embodiments of the present invention. However, it will be appreciated by those skilled in the art based on this specification that many modifications may be made to the specific embodiments disclosed herein and still achieve the same or similar results without departing from the spirit or scope of the present invention.

[0040] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs, and the disclosure and materials cited therein are hereby incorporated by reference.

[0041] Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many technical equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the claims.

[0042] The experimental methods in the following examples are conventional methods unless otherwise specified. The instruments and equipment used in the following examples are conventional laboratory instruments and equipment unless otherwise specified; the experimental materials used in the following examples are purchased from conventional biochemical reagent stores unless otherwise specified.

[0043] Example 1 A method for analyzing EML4-ALK fusion gene types based on RNA high-throughput sequencing data The analysis process of this embodiment is as follows Figure 1 shown.

[0044] 1. EML4-ALK fusion gene reference sequence file The EML4-ALK fusion gene information was obtained and screened in the COSMIC database (https: / / cancer.sanger.ac.uk / cosmic) to prepare the fusion gene reference sequence file (fa file), which includes the fusion gene type name (GeneName), fusion gene chromosome position (chr), fusion gene chain information (strand), fusion gene ID (transID) from the COSMIS database, fusion start position (varStart), fusion end position (varEnd), breakpoint (breakPoint), length (len), and fusion reference sequence (fusionSeq) base information. The fusion reference sequence is obtained by extending 60 to 75 bases forward and backward from the breakpoint, with a length of 120 to 150 bp. Among them, the fusion gene name includes which exons of EML4 and ALK the reference sequence consists of, such as EML4-ALK.E13:A20.COSF408, which means that the 13th exon of EML4 and the 20th exon of ALK are fused. The known EML4-ALK fusion gene reference sequence files are shown in Table 1.

[0045] Table 1 Reference sequence files of known EML4-ALK fusion genes

[0046] The nucleotide sequences of each fusion reference sequence (fusionSeq) are as follows: EML4-ALK.E13:A20.COSF408(SEQ ID No. 1) GGAGATGTTCTTACTGGAGACTCAGGTGGAGTCATGCTTATATGGAGCAAAACTACTGTAGAGCCCACACCTGGGAAAGGACCTAAAGTGTACCGCCGGAAGCACCAGGAGCTGCAAGCCATGCAGATGGAGCTGCAGAGCCCT EML4-ALK.E6a:A20.COSF411(SEQ ID No. 2) CCCAAATTAATACCAAAAGTTACCAAAACTGCAGACAAGCATAAAGATGTCATCATCAACCAAGTGTACCGCCGGAAGCACCAGGAGCTGCAAGCCATGCAGATGGAGCTGCAGAGCCCT EML4-ALK.E6:A20.COSF1544(SEQ ID No. 3) CCCAAATTAATACCAAAAGTTACCAAAACTGCAGACAAGCATAAAGATGTCATCATCAACCAAGCTGACCACCCACCTGCAGTGTACCGCCGGAAGCACCAGGAGCTGCAAGCCATGCAGATGGAGCTGCAGAGCCCTGAGTACAAGC EML4-ALK.E6:A19.COSF1296(SEQ ID No. 4) CCCAAATTAATACCAAAAGTTACCAAAACTGCAGACAAGCATAAAGATGTCATCATCAACCAAGTGTCACCCACCCCGGAGCCACACCTGCCACTCTCGCTGATCCTCTCTGTGGTGACCTCTGCCCTCGTGGCCGCCCTGGTCCTGG EML4-ALK.E20:A20.COSF409(SEQ ID No. 5) ACATTCCAGCTACATCACACACCTTGACTGGTCCCCAGACAACAAGTATATAATGTCTAACTCGGGAGACTATGAAATATTGTACTTGTACCGCCGGAAGCACCAGGAGCTGCAAGCCATGCAGATGGAGCTGCAGAGCCCT EML4-ALK.E18:A20.COSF487 (SEQ ID No. 6) GGCAGGTGGTTTGTTCTGGATGCAGAAACCAGAGATCTAGTTTCTATCCACACAGACGGGAATGAACAGCTCTCTGTGATGCGCTACTCAATAGTGTACCGCCGGAAGCACCAGGAGCTGCAAGCCATGCAGATGGAGCTGCAGAGCCCT EML4-ALK.E14:A20.COSF491 (SEQ ID No. 7) AATAATTCTGTGGGATCATGATCTGAATCCTGAAAGAGAAATAGAGATATGCTGGATGAGCCCTGAGTACAAGCTGAGCAAGCTCCGCACCTCGACCATCATGACCGACTACAACCCCAACTACTGCTTTGCTGGCAAGACCT EML4-ALK.E2:A20.COSF478 (SEQ ID No. 8) CGTCTTGCAATCTCTGAAGATCATGTGGCCTCAGTGAAAAAATCAGTCTCAAGTAAAGTGTACCGCCGGAAGCACCAGGAGCTGCAAGCCATGCAGATGGAGCTGCAGAGCCCT 2. Primer Design In addition to targeting known types of fusion genes, the primer design of the present invention also seeks to discover unknown types of fusion genes. Primers are designed for fusion gene types of EML4_E13_ALK_E20 (i.e., fusion of exon 13 of the EML4 gene and exon 20 of the ALK gene), EML4_E6_ALK_E20, EML4_E20_ALK_E20, EML4_E18_ALK_E20, and EML4_E2_ALK_E20 (which can cover the above 8 types of fusion genes). Specifically, 50 to 70 bases are extended upstream and downstream of the break site as the primer coverage region, and upstream and downstream primers are designed for the two genes in the primer coverage region. By using the primer combination designed in this embodiment, as many fusion gene types as possible can be obtained using the least primer pairs. For example, the above-mentioned EML4-ALK.E6:A19.COSF1296 can be amplified using primers designed with the coverage region of the EML4_E6_ALK_E20 primer; for another example, EML4-ALK.E14:A20.COSF491 can be amplified using primers designed with the coverage region of the EML4_E13_ALK_E20 primer. Conversely, EML4_E6_ALK_E20 can obtain fusion genes of types such as EML4_E6_ALK_E20, EML4_E7_ALK_E20, EML4_E8_ALK_E20, EML4_E9_ALK_E20, EML4_E6_ALK_E19, EML4_E6_ALK_E18, and EML4_E6_ALK_E17. The final primer combination is shown in Table 2: Table 2 Targeted amplification primer combinations

[0047] In the table, the primers whose names end with P1 are blocker primers for wild-type amplification of the blocking gene.

[0048] According to the primers designed above, a primer coverage region sequence file is prepared, including the exon sequences of the EML4 gene and ALK gene covered by each primer.

[0049] 3. RNA Sequencing The samples to be tested were paraffin-embedded samples of surgically removed tissues from patients with non-small cell lung cancer, and RNA samples were extracted. The primers designed above were further used for multiplex PCR amplification to obtain sequencing libraries. The NexSeq CN500 sequencer was used for high-throughput sequencing data.

[0050] Perform data quality control on high-throughput sequencing data: remove adapter sequences, remove low-quality sequences, and if the remaining data is greater than 200,000, the quality control is qualified.

[0051] 4. Analysis of known types of EML4-ALK fusion genes based on RNA sequencing data This step analyzes known types of EML4-ALK fusion genes based on RNA high-throughput sequencing data, specifically: The quality-controlled high-throughput sequencing data were first aligned with the reference sequence file using the alignment software BWA, and the following processing was performed: (1) If the base mismatch ratio between a certain sequencing data (reads) and the fusion reference sequence is less than 5%, the sequencing data is retained; (2) If a sequencing data (read) spans the break site on the fusion reference sequence, and the number of bases covered on both sides of the break site is >20, then the sequencing data is considered to be able to be aligned to the fusion reference sequence. The alignment principle with the known types of fusion genes is as follows: Figure 2 As shown; (3) If the sequencing data (reads) can be aligned to multiple fusion reference sequences in the fusion reference sequence file, only the result of the priority alignment (the one with the highest alignment score) is retained, and the result of the secondary priority alignment is not counted. The number of sequencing data (reads) aligned to a certain fusion reference sequence was counted. If the normalized value was greater than the reference threshold (16), it was considered that this type of gene fusion had occurred in the sample. The statistical results are shown in Table 3.

[0052] Table 3 Comparison of the number of reads of known types of EML4-ALK fusion genes

[0053] As shown in Table 3, the number of reads that can be compared to EML4-ALK.E6a:A20.COSF734 reached 3768, exceeding the reference threshold, and the sample had a gene fusion of the EML4-ALK.E6a:A20.COSF7340 type.

[0054] 5. Analysis of all types of EML4-ALK fusion genes based on RNA sequencing data The above steps can only be used to analyze known types of EML4-ALK fusion genes, and corresponding analysis cannot be performed for unknown types. To this end, the inventors further implemented the following steps to complete the analysis of all types of fusion genes.

[0055] Use the alignment software BWA to perform a second alignment between the quality-controlled sequencing data and the primer coverage region sequence file to obtain the alignment results, such as Figure 3 As shown, the specific steps are as follows: (1) If the sequencing data (reads) can be aligned to multiple exon sequences in the primer coverage region sequence file, all alignment results are retained; (2) Simplify the results of the comparison: If a sequencing data (reads) is aligned to the exon sequences of EML4 and ALK at the same time, then this sequencing data is a fusion gene sequence. If this sequencing data is aligned to multiple exon sequences of multiple EML4, then the exon with the largest sequence number is recorded; if this sequence is aligned to multiple exon sequences of multiple ALK, then the exon with the smallest sequence number is recorded.

[0056] (3) Count the number of fusion gene sequences in the primer coverage region sequence file comparison results and mark them with exon combinations. If the normalized value is greater than the reference threshold, it is considered that this type of gene fusion has occurred in the sample. The statistical results are shown in Table 4.

[0057] Table 4 Comparison of read counts of all types of EML4-ALK fusion genes

[0058] As shown in Table 4, the number of reads that can be compared to EML4_E6_ALK_E20 reached 3740, and the number of reads that can be compared to EML4_E6_ALK_E18 reached 546, both exceeding the reference threshold. This sample has EML4_E6_ALK_E20 and EML4_E6_ALK_E18 type gene fusions.

[0059] 6. Merge analysis results The results of the analysis of known types of the EML4-ALK fusion gene and the results of the analysis of all types of the EML4-ALK fusion gene are combined and output as an analysis result.

[0060] If the predicted result contains a known type of gene fusion, the known type of gene fusion ID is output; if it does not contain a known type of gene fusion, the newly predicted gene fusion type is output. The final analysis results are shown in Table 5.

[0061] Table 5 Comparison of read counts of all types of EML4-ALK fusion genes

[0062] In this example, a new fusion gene, namely EML4_E6-ALK_E18, was obtained, and its full-length sequence is as follows: The sequence near the breakpoint is as follows: CCCAAATTAATACCAAAAGTTACCAAAACTGCAGACAAGCATAAAGATGTCATCATCAACCAAGTGATGGAAGGCCACGGGGAAGTGAATATTAAGCATTATCTAAACTGCAGTCACTGTGAGGTAGACGAATGTCACATGGACCCTG (SEQ ID No. 25) The sequence near the breakpoint can be further used to design primers to detect the above fusion gene.

[0063] Example 2 System for analyzing known types of fusion genes based on RNA sequencing Based on the method of Example 1, this embodiment provides a system for analyzing fusion gene types based on RNA sequencing, such as Figure 4 As shown, it includes the following modules: A data input module is used to input RNA sequencing data of samples to be tested; The first storage module is used to store a fusion gene reference sequence file obtained according to a known type of fusion gene, wherein the fusion gene reference sequence file includes the name of the known type of fusion gene and a fusion reference sequence, wherein the fusion gene is formed by fusing the first part of the first gene and the second part of the second gene together, and the fusion reference sequence is obtained by extending 60 to 75 bases forward and backward from the breakpoint; The first comparison module is connected to the data input module and the first storage module respectively, and is used to perform a first comparison between the RNA sequencing data and the fusion reference sequence file and perform the following processing: (1) If the base mismatch ratio between a sequencing data and the fusion reference sequence is less than 5%, the sequencing data will be retained; (2) If a sequencing data crosses the breakpoint on the fusion reference sequence and the number of bases covered on both sides of the breakpoint is greater than 20, then the sequencing data can be aligned to the fusion reference sequence; (3) If a sequencing data can be aligned to multiple fusion reference sequences in the fusion reference sequence file, only the result of the priority alignment is retained. The known type analysis module of the fusion gene is connected to the first comparison module and is used to count the number of sequencing data that can be compared to each fusion reference sequence. If the number of sequencing data that can be compared to a certain fusion reference sequence is greater than a preset threshold, the sample to be tested has undergone a gene fusion of the corresponding type.

[0064] Example 3 System for analyzing all types of fusion genes based on RNA sequencing Based on the method of Example 1, this example is improved on the basis of Example 2, such as Figure 5 As shown, specifically, the system in Example 2 further includes: The second storage module is used to store a primer coverage region sequence file obtained according to the exon sequence of the first gene and the second gene of the fusion gene corresponding to the primer combination coverage region, and the primer coverage region sequence file includes a gene name, an exon number and an exon sequence; The second comparison module is connected to the data input module and the second storage module respectively, and is used to perform a second comparison between the RNA sequencing data and the primer coverage region sequence file and perform the following processing: (1) If a sequencing data can be aligned to multiple exon sequences in the primer coverage region sequence file, all alignment results are retained; (2) If a piece of sequencing data is aligned to both the exon sequence of the first gene and the exon sequence of the second gene, then the sequencing data is a fusion gene sequence: If the sequencing data is aligned to multiple exon sequences of the first gene, then the exon with the largest sequence number is recorded; similarly, if the sequencing data is aligned to multiple exon sequences of the second gene, then the exon with the smallest sequence number is recorded. The fusion gene all types analysis module is connected to the second comparison module and is used to count the number of sequencing data that can be simultaneously compared to two gene exon sequences. If the number of sequencing data that can be simultaneously compared to two gene exon sequences is greater than a preset threshold, the corresponding type of gene fusion occurs in the sample to be tested.

[0065] It also includes a fusion gene type integrated analysis module, which is connected to the fusion gene known type analysis module and the fusion gene all type analysis model respectively. If the type of the obtained fusion gene is known, the name of the corresponding known type of fusion gene is output.

[0066] All documents mentioned in the present invention are cited as references in this application, just as each document is cited as reference individually. In addition, it should be understood that after reading the above teachings of the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the claims attached to this application.

Claims

1. A method for analyzing the type of EML4-ALK fusion gene, characterized in that: The following steps are involved: The RNA sequencing data of the sample to be tested is obtained by the following steps: Obtain RNA samples of the samples to be tested, The RNA samples were subjected to multiplex PCR amplification using a primer combination, wherein the primer combination was designed using the following method: Select EML4_E13_ALK_E20, EML4_E6_ALK_E20, EML4_E20_ALK_E20, EML4_E18_ALK_E20 and EML4_E2_ALK_E20 fusion gene types, extend 50 to 70 bases upstream and downstream of the break site of each fusion gene as the primer coverage region, design upstream and downstream primers on the two genes in the primer coverage region respectively, and obtain the primer combination, Performing high-throughput sequencing on the amplified product to obtain the RNA sequencing data; According to the exon sequences of the first gene and the second gene of the fusion gene covered by each primer, a sequence file of the primer-covered region is obtained, including the gene name, exon number and exon sequence; The RNA sequencing data is compared with the primer coverage region sequence file for the second time, and the following processing is performed: (1) If a sequencing data can be aligned to multiple exon sequences in the primer coverage region sequence file, all alignment results are retained; (2) If a piece of sequencing data is aligned to both the exon sequence of the first gene and the exon sequence of the second gene, then the sequencing data is a fusion gene sequence: If the sequencing data is aligned to multiple exon sequences of the first gene, then the exon with the largest sequence number is recorded; similarly, if the sequencing data is aligned to multiple exon sequences of the second gene, then the exon with the smallest sequence number is recorded. The number of sequencing data that can be simultaneously aligned to two gene exon sequences is counted. If the number of sequencing data that can be simultaneously aligned to two gene exon sequences is greater than a preset threshold, the corresponding type of gene fusion occurs in the sample to be tested.

2. A method for analyzing the EML4-ALK fusion gene type according to claim 1, characterized in that: The steps for quality control of RNA sequencing data are further included: (1) Removal of linker sequences; (2) Remove low-quality sequences, If the remaining data is greater than 200,000, the quality control is qualified.

3. A system for analyzing EML4-ALK fusion gene types, characterized in that: Includes the following modules: The data input module is used to input the RNA sequencing data of the sample to be tested, and the RNA sequencing data of the sample to be tested is obtained by the following steps: Obtain RNA samples of the samples to be tested, The RNA samples were subjected to multiplex PCR amplification using a primer combination, wherein the primer combination was designed using the following method: Select EML4_E13_ALK_E20, EML4_E6_ALK_E20, EML4_E20_ALK_E20, EML4_E18_ALK_E20 and EML4_E2_ALK_E20 fusion gene types, extend 50 to 70 bases upstream and downstream of the break site of each fusion gene as the primer coverage region, design upstream and downstream primers on the two genes in the primer coverage region respectively, and obtain the primer combination, Performing high-throughput sequencing on the amplified product to obtain the RNA sequencing data; A second storage module is used to store a primer coverage region sequence file obtained according to the exon sequences of the first gene and the second gene of the fusion gene corresponding to the primer coverage region, wherein the primer coverage region sequence file includes a gene name, an exon number and an exon sequence; A second comparison module is connected to the data input module and the second storage module respectively, and is used to perform a second comparison between the RNA sequencing data and the primer coverage region sequence file and perform the following processing: (1) If a sequencing data can be aligned to multiple exon sequences in the primer coverage region sequence file, all alignment results are retained; (2) If a piece of sequencing data is aligned to both the exon sequence of the first gene and the exon sequence of the second gene, then the sequencing data is a fusion gene sequence: If the sequencing data is aligned to multiple exon sequences of the first gene, then the exon with the largest sequence number is recorded; similarly, if the sequencing data is aligned to multiple exon sequences of the second gene, then the exon with the smallest sequence number is recorded. The fusion gene all types analysis module is connected to the second comparison module and is used to count the number of sequencing data that can be simultaneously compared to two gene exon sequences. If the number of sequencing data that can be simultaneously compared to two gene exon sequences is greater than a preset threshold, the corresponding type of gene fusion occurs in the sample to be tested.

4. A computer device, characterized in that: include: Memory for storing computer programs; A processor is used to implement the steps of a method for analyzing the EML4-ALK fusion gene type as described in any one of claims 1 to 3 when executing the computer program.

5. A computer-readable storage medium, characterized in that: The computer-readable storage medium stores a computer program, and when the computer program is executed by a processor, the steps of the method for analyzing the EML4-ALK fusion gene type according to any one of claims 1 to 2 are implemented.

6. A fusion gene obtained by using the method for analyzing the type of EML4-ALK fusion gene according to any one of claims 1 to 2 or the system for analyzing the type of EML4-ALK fusion gene according to claim 3, wherein the fusion gene is EML4_E6-ALK_E18.

7. The fusion gene according to claim 6, characterized in that The nucleotide sequence of the fusion gene is shown in SEQ ID No. 24.

Images