An expression regulator of HMGB1; prophylactic or therapeutic agent for acute lung injury, acute respiratory distress syndrome or sepsis, or method for improving same

Abstract

The present invention relates to a novel HMGB1 expression regulating agent, in which the expression regulating agent comprises microparticles containing miRNA having a gene related to the expression of HMGB1 as a target gene, the expression regulating agent for HMGB1 can regulate the expression of HMGB1 using the miRNA from the microparticles; a prophylactic or therapeutic agent for acute lung injury, acute respiratory distress syndrome or septicemia; and a method for improving acute lung injury, acute respiratory distress syndrome or septicemia. The microparticles are preferably exosomes.

Description

Technical Field

[0001] The present invention relates to: an HMGB1 expression regulator; a preventive or therapeutic drug for acute lung injury, acute respiratory distress syndrome or sepsis; and a method for improving acute lung injury, acute respiratory distress syndrome or sepsis. Background Art

[0002] HMGB1 (High-Mobility Group Box 1) protein is released to the extracellular space by dendritic cells, macrophages, etc. when all nucleated cells die or when the activity of living cells is normalized. HMGB1 is usually mostly accumulated in the nucleus, but it is released into the cytoplasm when cells are stimulated by lipopolysaccharide or infected by bacteria, and is released to the extracellular space during inflammatory response or infection.

[0003] Research on microRNA (miRNA) has been conducted, and the functions and target genes of miRNA related to HMGB1 have been clarified (see Non-Patent Documents 1 and 2).

[0004] Non-Patent Document 1 describes that miR-142-3p inhibits the NF-kB signaling pathway mediated by HMGB1, thereby inhibiting chondrocyte apoptosis and inflammation in osteoarthritis.

[0005] Non-patent document 2 records that the expression of miR-22-3p is negatively correlated with the expression of HMGB1 in human arteriosclerosis obliterans (ASO) tissues; and that miR-22-3p is an important molecule that regulates the proliferation and metastasis of human arterial smooth muscle cells (HASMC) by targeting HMGB1, and miR-22-3p and HMGB1 become therapeutic targets in the treatment of human arteriosclerosis obliterans (ASO).

[0006] Here, HMGB1 is known to be associated with acute lung injury or sepsis. For example, Non-Patent Document 3 describes that HMGB1 is a late inflammatory mediator associated with sepsis, malignant tumors, and immune diseases, and that HMGB1 and autophagy are associated with the etiology of various lung diseases including acute lung injury (ALI).

[0007] On the other hand, it is known that isolated exosomes are associated with acute lung injury, acute respiratory distress syndrome (ARDS) or sepsis. For example, Patent Document 1 describes an isolated exosome that (i) contains one or more markers selected from ALIX, TSG101, TGFBR2, SMAD1, SMAD2, SMAD3, SMAD5 and CD105; and / or (ii) does not contain one or more markers selected from FLOT1, CD9, CD81, CAV1, EGFR, AKT1 and AKT2.

[0008] Prior art literature

[0009] Patent Literature

[0010] Patent document 1: Japanese Patent Application Publication No. 2021-020908;

[0011] Non-patent literature

[0012] Non-patent literature 1: Inflammation, (2016) 39, 1718-1728;

[0013] Non-patent literature 2: Cell. Physiol. Biochem., (2017) 42, 2492-2506;

[0014] Non-patent literature 3: Med Sci Monit, (2019) 25: 1828-1837. Summary of the invention

[0015] Problems to be solved by the invention

[0016] Patent Document 1 does not describe HMGB1.

[0017] Non-patent documents 1 and 2 describe the functions and target genes of HMGB1 miRNAs related to vasculitis, but do not describe the administration of these miRNAs as therapeutic agents for acute lung injury, acute respiratory distress syndrome, or sepsis.

[0018] Non-patent document 3 describes the correlation between HMGB1 and acute lung injury, acute respiratory distress syndrome, or sepsis, but does not describe its relationship with microparticles or miRNA.

[0019] The problem to be solved by the present invention is to provide a novel HMGB1 expression regulator that can regulate HMGB1 expression using microparticle-derived miRNA.

[0020] Means for solving problems

[0021] The present inventors have discovered that microparticles containing specific microRNAs can regulate (inhibit or inhibit, etc.) the expression of HMGB1 protein and / or HMGB1 gene (Hmgb1).

[0022] Specifically, the present invention and preferred configurations of the present invention are as follows.

[0023] [1] An expression regulator of HMGB1, wherein the expression regulator comprises microparticles,

[0024] The microparticles contain miRNAs that target genes related to HMGB1 expression.

[0025] [2] The HMGB1 expression regulator described in [1], wherein the microparticles are exosomes.

[0026] [3] The HMGB1 expression regulating agent according to [1], wherein the miRNA targeting a gene related to HMGB1 expression comprises at least one of the following HMGB1-related miRNA groups.

[0027] HMGB1-related miRNA group:

[0028] hsa-let-7b-5p、hsa-let-7e-5p、hsa-let-7g-5p、hsa-miR-100-5p、hsa-miR-103a-3p、hsa-miR-106b-5p、hsa-miR-107、hsa-miR-1179、hsa-miR-1183、hsa-miR-1236-3p、hsa-miR-1237-3p、hsa-miR-1247-3p、hsa-miR-129-5p、hsa-miR-1304-3p、hsa-miR-1307-3p、hsa-miR-141-3p、hsa-miR-142-3p、hsa-miR-142-5p、hsa-miR-145-5p、hsa-miR-148a-3p、hsa-miR-148b-3p、hsa-miR-150-5p、hsa-miR-17-5p、hsa-miR-181d-5p、hsa-miR-186-3p、hsa-miR-186-5p、hsa-miR-18a-3p、hsa-miR-1913、hsa-miR-193b-3p、hsa-miR-1976、hsa-miR-204-5p、hsa-miR-205-5p、hsa-miR-206、hsa-miR-20a-5p、hsa-miR-20b-5p、hsa-miR-211-5p、hsa-miR-212-5p、hsa-miR-218-5p、hsa-miR-22-3p、hsa-miR-24-3p、hsa-miR-26b-5p、hsa-miR-300、hsa-miR-302c-3p、hsa-miR-324-3p、hsa-miR-328-3p、hsa-miR-329-3p、hsa-miR-340-5p、hsa-miR-34a-5p、hsa-miR-362-3p、hsa-miR-373-3p、hsa-miR-381-3p、hsa-miR-410-3p、hsa-miR-4275、hsa-miR-4284、hsa-miR-4324、hsa-miR-4460、hsa-miR-4532、hsa-miR-4638-5p、hsa-miR-4673、hsa-miR-4691-5p、hsa-miR-4707-3p、hsa-miR-4727-3p、hsa-miR-4793-5p、hsa-miR-495-3p、hsa-miR-505-3p、hsa-miR-512-3p、hsa-miR-5193、hsa-miR-5196-3p、hsa-miR-520a-3p, hsa-miR-520d-3p, hsa-miR-520h, hsa-miR-539-3p, hsa-miR-582-5 p, hsa-miR-652-3p, hsa-miR-660-3p, hsa-miR-665, hsa-miR-92a-3p, hsa-miR-93-5p. ,

[0029] [4] The HMGB1 expression regulator described in [1], wherein the miRNA targeting a gene related to HMGB1 expression comprises at least one of hsa-let-7b-5p, hsa-miR-100-5p, hsa-miR-129-5p, hsa-miR-142-3p, hsa-miR-22-3p, hsa-miR-34a-5p and hsa-miR-92a-3p.

[0030] [5] The HMGB1 expression regulator described in [1], wherein the miRNA targeting a gene related to HMGB1 expression contains at least hsa-let-7b-5p.

[0031] [6] The HMGB1 expression regulator according to [1], wherein the microparticles contain miRNA at a higher concentration than that in the culture supernatant of dental pulp-derived stem cells, and the miRNA targets a gene related to HMGB1 expression.

[0032] [7] The HMGB1 expression regulator described in [1], wherein the microparticles are microparticles purified and separated from the culture supernatant of stem cells derived from dental pulp,

[0033] The microparticles do not contain components obtained by removing exosomes from the culture supernatant of dental pulp-derived stem cells.

[0034] [8] A preventive or therapeutic drug for acute lung injury, acute respiratory distress syndrome or sepsis, comprising the HMGB1 expression regulator described in [1] as an active ingredient.

[0035] [9] A method for improving acute lung injury, acute respiratory distress syndrome or sepsis, comprising: administering an effective amount of the HMGB1 expression regulator described in [1] or an effective amount of the preventive or therapeutic drug for acute lung injury, acute respiratory distress syndrome or sepsis described in [8] to a subject suffering from acute lung injury, acute respiratory distress syndrome or sepsis.

[0036] Effects of the Invention

[0037] According to the present invention, a novel HMGB1 expression regulator can be provided, which can regulate the expression of HMGB1 using miRNA derived from microparticles. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] [ Figure 1 ] Figure 1 This is a heat map showing the expression levels of miRNAs that target genes related to HMGB1 expression and are expressed in exosomes purified from the culture supernatant of dental pulp-derived stem cells (the HMGB1 expression regulator of Example 1).

[0039] [ Figure 2 ] Figure 2 This is a graph showing the quantitative expression level of HMGB1 gene in each case. DETAILED DESCRIPTION

[0040] Hereinafter, the present invention will be described in detail. The description of the constituent elements described below is sometimes based on representative embodiments or specific examples, but the present invention is not limited to such embodiments. It should be noted that in this specification, the numerical range represented by "to" means a range including the numerical values ​​described before and after "to" as the lower limit and the upper limit.

[0041] [HMGB1 expression regulator]

[0042] The HMGB1 expression regulator of the present invention is an HMGB1 expression regulator, and the expression regulator comprises microparticles, and the microparticles comprise miRNA targeting a gene related to HMGB1 expression as a target gene.

[0043] The HMGB1 expression regulator of the present invention can regulate the expression of HMGB1 using microparticle-derived miRNA. As a result, the HMGB1 expression regulator of the present invention can preferably improve, more preferably prevent or treat acute lung injury, acute respiratory distress syndrome or sepsis.

[0044] Hereinafter, preferred embodiments of the HMGB1 expression regulating agent of the present invention will be described.

[0045] <Acute lung injury, acute respiratory distress syndrome, sepsis>

[0046] Acute lung injury (ALI) and acute respiratory distress syndrome (ARDS) refer to a condition in which shortness of breath or dyspnea suddenly occurs during sepsis or pneumonia, or after aspiration or multiple trauma (a state in which multiple parts of the body are damaged), and shadows (infiltration) are seen in the left and right lungs on chest X-rays. The oxygen partial pressure in arterial blood decreases (hypoxemia), and depending on the degree of hypoxia, it is called acute lung injury or acute respiratory distress syndrome.

[0047] Sepsis is a condition in which bacteria enter the blood and multiply due to viral or bacterial infection, and is a disease that can cause organ damage and lead to death. An effective treatment for sepsis has not yet been established.

[0048] <Microparticles>

[0049] The HMGB1 expression regulating agent of the present invention comprises microparticles.

[0050] In the present invention, the microparticles contain miRNA that targets a gene related to HMGB1 expression.

[0051] Microparticles are derived from stem cells from the dental pulp, etc., and leached, released or fallen into the cell culture medium, for example, by secretion, budding or dispersion of mesenchymal stem cells such as stem cells from the dental pulp. Microparticles are preferably contained in the culture supernatant of stem cells from the dental pulp, etc., and more preferably microparticles derived from the culture supernatant of stem cells from the dental pulp. However, microparticles derived from the culture supernatant of stem cells from the dental pulp do not necessarily need to be obtained from the culture supernatant of stem cells from the dental pulp. For example, even if microparticles are obtained by separating microparticles inside stem cells from the dental pulp by any method, as long as they are the same microparticles as those that can be separated from the culture supernatant of stem cells from the dental pulp, they can be called microparticles derived from the culture supernatant of stem cells from the dental pulp.

[0052] The microparticles derived from the culture supernatant of dental pulp-derived stem cells or the like may be used in a state contained in the culture supernatant or in a state purified from the culture supernatant. The microparticles are preferably microparticles purified from the culture supernatant.

[0053] The source of the microparticles can be determined by known methods. For example, the method described in J Stem Cell Res Ther (2018) 8:2 can be used to determine whether the microparticles are derived from dental pulp stem cells, adipose stem cells, bone marrow stem cells, umbilical cord stem cells, etc. Specifically, the source of each microparticle can be determined based on the miRNA pattern of the microparticles.

[0054] (miRNA)

[0055] In the present invention, the microparticles contain miRNA that targets a gene related to HMGB1 expression.

[0056] In the present invention, miRNA (microRNA) is, for example, an RNA molecule of 21 to 25 bases (nucleotides). MiRNA can regulate gene expression by degradation of target gene mRNA or inhibition in the decoding stage.

[0057] In the present invention, miRNA may be, for example, single-stranded (monomer) or double-stranded (dimer). In the present invention, miRNA is preferably a mature miRNA obtained by cleavage by ribonucleases such as Dicer.

[0058] It should be noted that the sequence of the miRNA recorded in this specification such as hsa-let-7b-5p is associated with the accession number and is registered in a known database (such as the miRBase database), and a person skilled in the art can uniquely determine the sequence. For example, the accession number of hsa-let-7b-5p is MIMAT0000063, and a sequence is registered in the miRBase database. Below, the accession number of each miRNA is omitted.

[0059] However, the miRNA in this specification also includes variants with 1 to 5 bases different from mature miRNAs such as hsa-let-7b-5p. In addition, each miRNA in this specification includes a polynucleotide having the function of the miRNA in the present invention, which is a polynucleotide consisting of a base sequence having the same identity as the base sequence of each miRNA (e.g., hsa-let-7b-5p), or a polynucleotide consisting of their complementary base sequences. "Identity" refers to the degree of identity when the sequences to be compared are appropriately aligned with each other, meaning the correct consistent occurrence rate (%) of the amino acids between the above sequences. Alignment can be performed using any algorithm such as BLAST, for example. The identity is, for example, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or about 99%. A polynucleotide consisting of a base sequence having the same identity may have a point mutation, a deletion and / or an addition in the base sequence of the miRNA, for example. The number of bases of the above-mentioned point mutations, etc. is, for example, 1 to 5, 1 to 3, 1 to 2 or 1. In addition, the polynucleotide consisting of the complementary base sequence, for example, includes a polynucleotide having the function of the miRNA in the present invention, which is a polynucleotide hybridized with a polynucleotide consisting of the base sequence of the miRNA under strict conditions. As stringent conditions, there are no particular limitations, and for example, the conditions described in

[0028] of Japanese Patent Publication No. 2017-184642 can be cited, and the contents of the publication are incorporated into this specification by reference.

[0060] In the present invention, the microparticles preferably contain miRNA at a concentration higher than that in the culture supernatant of dental pulp-derived stem cells, the miRNA targeting a gene related to HMGB1 expression. Preferred embodiments of the miRNA contained in the microparticles are described below.

[0061] -miRNAs targeting genes related to HMGB1 expression-

[0062] HMGB1 is released from dendritic cells, macrophages, etc. to the extracellular space when all nucleated cells die or when the activity of living cells is normalized. HMGB1 released outside the cell is believed to induce biological defense responses such as natural immunity and hemostasis in local and temporary situations, and also plays an important role in repair. However, if HMGB1 exerts a systemic effect, it becomes a mediator of shock or disseminated intravascular coagulation syndrome (DIC).

[0063] HMGB1 is mainly present in the nucleus and has been identified as a protein that plays a role in stabilizing the structure of chromatin and in gene transcription reactions. A portion of HMGB1 is also present in the cytoplasm and is related to the recognition of nucleic acids taken from outside the cell or the induction of autophagy. Moreover, HMGB1 is released from the nucleus to the outside of the cell by inflammatory stimulation such as lipopolysaccharide or with cell death. In particular, HMGB1 released outside the cell is recognized by natural immune receptors represented by Toll-like receptors, and is therefore related to inflammation during sepsis or autoimmune diseases, ischemic reperfusion or organ transplantation. In fact, the administration of HMGB1 neutralizing antibodies can alleviate these disease states. HMGB1 in the cytoplasm is important for inhibiting sepsis and Listeria infection induced by lipopolysaccharide induction (LPS) (PNAS (2013) Vol. 110, no. 51, 20699-20704).

[0064] Here, miR-142-3p blocks the NF-kB signaling pathway mediated by HMGB1, thereby inhibiting chondrocyte apoptosis and inflammation in osteoarthritis (inflammation, (2016) 39, 1718-1728).

[0065] The expression of miR-22-3p is negatively correlated with the expression of HMGB1 in human arteriosclerosis obliterans (ASO) tissues. miR-22-3p is an important molecule that regulates the proliferation and metastasis of human arterial smooth muscle cells (HASMC) by targeting HMGB1. miR-22-3p and HMGB1 have become therapeutic targets in the treatment of human arteriosclerosis obliterans (ASO) (Cell. Physiol. Biochem., (2017) 42, 2492-2506).

[0066] HMGB1, an inflammatory mediator, is a direct target of miR-129-5p. miR-129-5p inhibits apoptosis and inflammatory responses via the HMGB1 / / TLR4 / NF-κB pathway (Biosci Rep. (2020) 40(3)).

[0067] On the other hand, non-patent document 3 (Med Sci Monit, (2019) 25: 1828-1837) states that HMGB1 is a late inflammatory mediator associated with sepsis, malignant tumors, and immune diseases, and that HMGB1 and autophagy are related to the etiology of various lung diseases including acute lung injury (ALI). Therefore, an inhibitor of HMGB1 expression can be used as a preventive or therapeutic drug for acute lung injury and acute respiratory distress syndrome.

[0068] Sepsis begins when pathogens invade the body and cause systemic inflammation. This inflammatory response involves "the keyhole (RAGE) in which AGE, a glycosylated protein, is embedded." The invasion of pathogens causes the production of HMGB1 and stimulates RAGE, so sepsis develops. That is, if infected with pathogens or viruses, the HMGB1 produced in the body binds to the keyhole (RAGE) and sepsis occurs. Substances called RAGE aptamers cover RAGE to block the keyhole, and cover RAGE to hinder the binding of HMGB1 to RAGE, thereby inhibiting the death of animals due to sepsis (Oxidative Medicine and Cellular Longevity, (2021) Article ID 9932311).

[0069] Plasma histidine-rich glycoprotein (HRG) strongly inhibits the release of HMGB1 and suppresses the production of excessive inflammatory cytokines. The protective effect of HRG on endothelial cells is related to the development of treatment methods for sepsis (J.isci. (2020) Vol. 23, Issue 6, 101180).

[0070] Therefore, an inhibitor of HMGB1 expression can be used as a preventive or therapeutic drug for sepsis.

[0071] Based on the above, miRNAs targeting genes related to HMGB1 expression (hereinafter referred to as HMGB1-related miRNA group) are also effective as therapeutic drugs for vasculitis, and therefore are also effective as preventive or therapeutic drugs for acute lung injury, acute respiratory distress syndrome, or sepsis.

[0072] HMGB1-related miRNA group:

[0073] hsa-let-7b-5p、hsa-let-7e-5p、hsa-let-7g-5p、hsa-miR-100-5p、hsa-miR-103a-3p、hsa-miR-106b-5p、hsa-miR-107、hsa-miR-1179、hsa-miR-1183、hsa-miR-1236-3p、hsa-miR-1237-3p、hsa-miR-1247-3p、hsa-miR-129-5p、hsa-miR-1304-3p、hsa-miR-1307-3p、hsa-miR-141-3p、hsa-miR-142-3p、hsa-miR-142-5p、hsa-miR-145-5p、hsa-miR-148a-3p、hsa-miR-148b-3p、hsa-miR-150-5p、hsa-miR-17-5p、hsa-miR-181d-5p、hsa-miR-186-3p、hsa-miR-186-5p、hsa-miR-18a-3p、hsa-miR-1913、hsa-miR-193b-3p、hsa-miR-1976、hsa-miR-204-5p、hsa-miR-205-5p、hsa-miR-206、hsa-miR-20a-5p、hsa-miR-20b-5p、hsa-miR-211-5p、hsa-miR-212-5p、hsa-miR-218-5p、hsa-miR-22-3p、hsa-miR-24-3p、hsa-miR-26b-5p、hsa-miR-300、hsa-miR-302c-3p、hsa-miR-324-3p、hsa-miR-328-3p、hsa-miR-329-3p、hsa-miR-340-5p、hsa-miR-34a-5p、hsa-miR-362-3p、hsa-miR-373-3p、hsa-miR-381-3p、hsa-miR-410-3p、hsa-miR-4275、hsa-miR-4284、hsa-miR-4324、hsa-miR-4460、hsa-miR-4532、hsa-miR-4638-5p、hsa-miR-4673、hsa-miR-4691-5p、hsa-miR-4707-3p、hsa-miR-4727-3p、hsa-miR-4793-5p、hsa-miR-495-3p、hsa-miR-505-3p、hsa-miR-512-3p、hsa-miR-5193、hsa-miR-5196-3p、hsa-miR-520a-3p, hsa-miR-520d-3p, hsa-miR-520h, hsa-miR-539-3p, hsa-miR-582-5 p, hsa-miR-652-3p, hsa-miR-660-3p, hsa-miR-665, hsa-miR-92a-3p, hsa-miR-93-5p. ,

[0074] In the HMGB1-related miRNA group, in addition to the above-mentioned miR-142-3p, miR-22-3p and hsa-miR-129-5p, the following specific miRNAs are known to improve vasculitis and are therefore also effective as preventive or therapeutic drugs for acute lung injury, acute respiratory distress syndrome or sepsis.

[0075] (1-1) hsa-let-7b-5p related

[0076] Overexpression of let-7a and let-7b inhibits endothelial cell apoptosis, NO deficiency, excessive production of reactive oxygen species, increased expression of LOX-1, and downregulation of endothelial nitric oxide synthase (eNOS) caused by oxLDL. Let-7a and let-7b have a protective effect against endothelial cell damage caused by oxidized low-density lipoprotein (Plos one (2014) 9, (9): e106540).

[0077] The secreted exosomal miRs (miR-210, miR-23a-3p, miR-424, let-7f, miR-30b, miR-30c, miR-126, miR-21, miR-132, miR-130a-3p, miR-214, miR-378, miR-126, miR-133, let-7b-5p) induce angiogenesis and vascular regeneration in the heart, thereby increasing blood flow to the ischemic myocardium and protecting against myocardial ischemia (Heart Failure Revies, (2021) 26(1), 205-213).

[0078] (1-2) hsa-miR-100-5p related

[0079] miR-100-5p concentrated in hucMSC-exo inhibits FOXO3 expression to inhibit the activation of NLRP3 inflammasome and cytokine release, thereby protecting cardiomyocytes from H / R-induced cell pyrolysis and damage (Front. Bioeng. Biotechnol. (2021) 8.615850).

[0080] miR-100-5p targets FZD5 and negatively regulates its expression. hUCMSC-Ex-miR-100-5p inhibits cell proliferation and inflammatory response by regulating FZD5 of eosinophils. hUCMSC-Ex-miR-100-5p inhibits cell proliferation and inflammatory response mediated by the Wnt / β-catenin pathway of eosinophils. hUCMSC-Ex-miR-100-5p reduces the area of ​​atherosclerotic plaques and inflammation in mice (Acta.Biochim.Biophys.sin.(2021)53(9):1166-1176).

[0081] (1-3) hsa-miR-92a-3p related

[0082] miR-92a-3p targets SIRT6. Knockdown of miR-92a-3p promotes SIRT6 expression and inactivates the MAPK signaling pathway. miR-92a-3p promotes ox-LDL-induced apoptosis of HUVECs by regulating the SIRT6 / MAPK signaling pathway (Brazilian Journal of Medical and Biological Research (2021) 54(3): e9386).

[0083] Under conditions of vascular damage, it is speculated that pro-atheroma stimulation triggers the release of EMVs containing miR-92a-3p as messengers carrying regenerative signals, which are then taken up into target cells further downstream in the blood, promoting angiogenesis (Circ. Res. (2019); 124: 575-587).

[0084] If miR-92a is overexpressed in endothelial cells, angiogenesis is inhibited in vitro and in vivo. In mouse models of limb ischemia or myocardial infarction, systemic administration of antagomir designed to inhibit miR-92a promotes blood vessel growth and is associated with functional recovery of damaged tissues (Science (2009) 324 (5935): 1710-1713).

[0085] Inhibition of miR-92a increases endothelial proliferation and migration in vitro and inhibits neointimal proliferation after vascular injury in vivo (Basic Res. Cardiol. (2012) 107: 296).

[0086] (1-4) hsa-miR-34a-5p related

[0087] MiR-34a induces senescence by inhibiting Sirt1 and inhibits angiogenesis of EPC (endothelial progenitor cells) (Am. J. Physiol. Endocrinol. Metab. (2010) 299: E110-E116).

[0088] By inhibiting miR-34a, cardiomyocyte cell death and functional decline caused by aging are suppressed in vivo. After acute myocardial infarction, miR-34a is induced, and this inhibition promotes the recovery of myocardial contractility after acute myocardial infarction (Nature (2013) 495, 107-110).

[0089] In the present invention, when the microparticles contain miRNA targeting a gene related to HMGB1 expression (preferably HMGB1 gene), the microparticles preferably function as expression regulators of the gene related to HMGB1 expression. More preferably, the microparticles are HMGB1 expression inhibitors.

[0090] In this case, in the present invention, the microparticles preferably contain at least one of hsa-let-7b-5p, hsa-miR-100-5p, hsa-miR-129-5p, hsa-miR-142-3p, hsa-miR-22-3p, hsa-miR-34a-5p and hsa-miR-92a-3p, more preferably contain at least hsa-let-7b-5p, and particularly preferably contain hsa a-let-7b-5p, hsa-miR-100-5p and hsa-miR-92a-3p, and more particularly preferably all of hsa-let-7b-5p, hsa-miR-100-5p, hsa-miR-129-5p, hsa-miR-142-3p, hsa-miR-22-3p, hsa-miR-34a-5p and hsa-miR-92a-3p.

[0091] The microparticles preferably contain at least one of miRNAs with a gene related to the expression of HMGB1 as a target gene at a Log2Ratio of 2.0 or more, more preferably 4.0 or more, and particularly preferably 6.0 or more of the read counts obtained by IMOTA analysis. The microparticles preferably contain hsa-let-7b-5p, hsa-miR-100-5p, hsa-miR-129-5p, hsa-miR-142-3p, hsa-miR-22-3p, hsa-miR-34a-5p, and hsa-miR-92a-3p, each independently at a Log2Ratio of 4.0 or more, more preferably 10.0 or more, particularly preferably 12.0 or more, and particularly preferably 15.0 or more of the read counts obtained by IMOTA analysis. It is more preferred that hsa-let-7b-5p, hsa-miR-100-5p and hsa-miR-92a-3p are all contained at 12.0 or above.

[0092] The expression level of hsa-let-7b-5p in the microparticles is preferably 1.1 times or more, more preferably 1.5 times or more, and particularly preferably 2 times or more, compared to exosomes obtained from the culture supernatant of adipose-derived stem cells or exosomes obtained from the culture supernatant of umbilical cord-derived stem cells.

[0093] The HMGB1 expression inhibitor can suppress the expression of the HMGB1 gene in any cell preferably to 0.8 times or less of the normal level (in the case of untreated cells), more preferably to 0.6 times or less, and particularly preferably to 0.55 times or less.

[0094] (Types of miRNA)

[0095] Here, in the microparticles derived from the culture supernatant of stem cells from dental pulp, about 2,600 small RNAs are contained. About 1,800 of them are miRNAs. Among these miRNAs, there are 180 to 200 types of miRNAs with high content. The characteristic of the high content of miRNAs in microparticles derived from stem cells from dental pulp is that there are many microRNAs related to the treatment of cranial nerve diseases or vasculitis, which was previously unknown and is a newly discovered insight of the inventors. This feature is very different from the types of high content of miRNAs in microparticles of other mesenchymal stem cells. For example, among the high content of miRNAs in microparticles of stem cells from fat or microparticles of stem cells from the umbilical cord, there are almost no microRNAs related to the treatment of cranial nerve diseases or vasculitis.

[0096] The microparticles preferably contain two or more miRNAs targeting genes related to HMGB1 expression, more preferably 10 or more, more preferably 30 or more, particularly preferably 50 or more, and even more preferably 100 or more.

[0097] (Type of particles)

[0098] The microparticles are preferably at least one selected from exosomes, microvesicles, membrane particles, membrane vesicles, ectosomes, exovesicles, or microvesicles, and are more preferably exosomes.

[0099] The diameter of the fine particles is preferably 10 to 1000 nm, more preferably 30 to 500 nm, and particularly preferably 50 to 150 nm.

[0100] In addition, it is desirable that molecules called tetraspanins such as CD9, CD63, and CD81 exist on the surface of the microparticles. These molecules may be CD9 alone, CD63 alone, CD81 alone, or any combination of two or three of them.

[0101] Hereinafter, a preferred embodiment in the case of using exosomes as microparticles is sometimes described, but the microparticles used in the present invention are not limited to exosomes.

[0102] Exosomes are preferably extracellular vesicles released from cells when multivesicular bodies fuse with the plasma membrane.

[0103] The surface of exosomes preferably contains lipids and proteins derived from the cell membrane of dental pulp-derived stem cells.

[0104] The interior of the exosome preferably contains intracellular substances derived from dental pulp stem cells, such as nucleic acids (microRNA, messenger RNA, DNA, etc.) and proteins.

[0105] Exosomes are known to be used for cell-to-cell communication by transporting genetic information from one cell to another. Exosomes can be easily tracked and can be targeted to specific areas.

[0106] (Content of particles)

[0107] There is no particular limitation on the content of the microparticles in the microparticle composition. The microparticle composition preferably contains 0.5×10 8 More than 1.0×10 8 More than 2.0×10 8 More preferably, it contains 2.5×10 8 More preferably, it contains 1.0×109 More than one.

[0108] In addition, there is no particular limitation on the concentration of the fine particles in the fine particle composition. The fine particle composition preferably contains 1.0×10 8 More preferably, the particles contain 2.0×10 8 pcs / mL or more, particularly preferably 4.0×10 8 More preferably, it contains 5.0×10 8 More preferably, it contains 2.0×10 9 More than pcs / mL.

[0109] A preferred embodiment of the HMGB1 expression regulating agent of the present invention can maintain the amount of miRNA targeting a gene related to HMGB1 expression at a high level by containing the microparticles in such a large amount or at a high concentration.

[0110] <Other ingredients>

[0111] In addition to the microparticles, the microparticle composition may contain other ingredients, depending on the type of animal to be administered or the purpose, within the range that does not impair the effects of the present invention. Examples of other ingredients include nutrients, antibiotics, cytokines, protective agents, carriers, excipients, disintegrants, buffers, emulsifiers, suspending agents, analgesics, stabilizers, preservatives, preservatives, and the like.

[0112] Examples of nutritional components include fatty acids and vitamins.

[0113] Examples of the antibiotics include penicillin, streptomycin, and gentamicin.

[0114] Examples of the carrier include materials known as pharmaceutically acceptable carriers.

[0115] The microparticle composition may be the culture supernatant of dental pulp-derived stem cells or microparticles themselves, or may be a pharmaceutical composition further comprising a pharmaceutically acceptable carrier or excipient, etc. The purpose of the pharmaceutical composition is to facilitate administration of microparticles to a subject.

[0116] The pharmaceutically acceptable carrier is preferably a carrier (including a diluent) that does not cause significant irritation to the subject of administration and does not inhibit the biological activity and properties of the administered compound. Examples of carriers are: propylene glycol; (physiological) saline; emulsion; buffer; culture medium, such as DMEM or RPMI; and cryopreservation medium containing a component that removes free radicals.

[0117] The microparticle composition may contain the active ingredient of a conventionally known therapeutic drug for acute lung injury, acute respiratory distress syndrome or sepsis, and may be appropriately modified by a person skilled in the art in accordance with the intended use or the subject of administration.

[0118] On the other hand, the microparticle composition preferably does not contain the specified substance.

[0119] For example, the microparticle composition preferably does not contain stem cells from dental pulp.

[0120] In addition, the microparticle composition preferably does not contain MCP-1. However, cytokines other than MCP-1 may be included. As other cytokines, cytokines described in

[0014] to

[0020] of Japanese Patent Publication No. 2018-023343 can be cited.

[0121] In addition, the microparticle composition preferably does not contain Siglec-9. However, other sialic acid-binding immunoglobulin-like lectins besides Siglec-9 may be included.

[0122] It should be noted that the microparticle composition preferably does not substantially contain serum (fetal bovine serum, human serum, goat serum, etc.) In addition, the microparticle composition preferably does not substantially contain conventional serum substitutes such as knockout serum replacement (KSR).

[0123] The fine particle composition preferably contains the above-mentioned other components in an amount (solid content) of 1% by mass or less, more preferably 0.1% by mass or less, and particularly preferably 0.01% by mass or less.

[0124] <Method for producing fine particles>

[0125] There is no particular limitation on the method for producing the microparticles.

[0126] The culture supernatant of stem cells from dental pulp or the like can be prepared, and then the microparticles can be purified from the culture supernatant of stem cells from dental pulp to prepare the HMGB1 expression regulator of the present invention. Alternatively, the microparticles can be purified from the culture supernatant of stem cells from dental pulp purchased commercially to prepare the HMGB1 expression regulator of the present invention. Furthermore, a composition containing the culture supernatant of stem cells from dental pulp that has been discarded can also be received (or the composition can be appropriately purified), and the microparticles can be purified therefrom to prepare the HMGB1 expression regulator of the present invention.

[0127] (Method for preparing culture supernatant of dental pulp-derived stem cells, etc.)

[0128] The culture supernatant of dental pulp-derived stem cells and the like is not particularly limited.

[0129] The culture supernatant of dental pulp-derived stem cells or the like preferably contains substantially no serum. For example, the culture supernatant of dental pulp-derived stem cells or the like preferably has a serum content of 1% by mass or less, more preferably 0.1% by mass or less, and particularly preferably 0.01% by mass or less.

[0130] Dental pulp-derived stem cells may be derived from humans or animals other than humans. Examples of animals other than humans include the same animals (biological species) as those to be administered with the HMGB1 expression regulating agent of the present invention described below, preferably mammals.

[0131] There is no particular limitation on the dental pulp stem cells used for the culture supernatant. Dental pulp stem cells from exfoliated deciduous teeth, or dental pulp stem cells from deciduous teeth obtained by other methods, or dental pulp stem cells from permanent teeth (dental pulp stem cells; DPSC) can be used. In addition to human deciduous tooth dental pulp stem cells or human permanent tooth dental pulp stem cells, dental pulp stem cells from animals other than humans, such as porcine deciduous tooth dental pulp stem cells, can also be used.

[0132] In addition to exosomes, dental pulp stem cells can also produce various cytokines such as vascular endothelial growth factor (VEGF), hepatocyte growth factor (HGF), insulin-like growth factor (IGF), platelet-derived growth factor (PDGF), transforming growth factor-β (TGF-β)-1 and -3, TGF-α, KGF, HBEGF, SPARC, other growth factors, chemokines, etc. In addition, they can also produce a variety of other physiologically active substances.

[0133] In the present invention, the dental pulp-derived stem cells used in the culture supernatant of dental pulp-derived stem cells are preferably dental pulp-derived stem cells containing a large amount of protein, and deciduous tooth dental pulp stem cells are preferably used. That is, in the present invention, the culture supernatant of deciduous tooth dental pulp stem cells is preferably used.

[0134] The dental pulp-derived stem cells used in the present invention may be natural stem cells or genetically modified stem cells as long as they can achieve the target treatment.

[0135] In particular, immortalized stem cells derived from dental pulp stem cells can be used in the present invention. By using immortalized stem cells that can proliferate indefinitely in essence, the amount and composition of biological factors contained in the culture supernatant of stem cells can be stabilized for a long time. There are no particular limitations on the immortalized stem cells that are stem cells derived from dental pulp. The immortalized stem cells are preferably immortalized stem cells that are not cancerous. The immortalized stem cells derived from dental pulp stem cells can be modulated by adding the following small molecule compounds (inhibitors) to the stem cells derived from dental pulp alone or in combination for culturing.

[0136] The TGFβ receptor inhibitor is not particularly limited as long as it is a substance that has an effect of inhibiting the function of the transforming growth factor (TGF) β receptor, and examples thereof include 2-(5-benzo[1,3]dioxol-4-yl-2-tert-butyl-1H-imidazol-4-yl)-6-methylpyridine, 3-(6-methylpyridin-2-yl)-4-(4-quinolyl)-1-phenylthiocarbamoyl-1H-pyrazole (A- A-83-01), 2-[(5-chloro-2-fluorophenyl)pteridin-4-yl]pyridin-4-ylamine (SD-208), 3-[(pyridin-2-yl)-4-(4-quinone)]-1H-pyrazole, 2-(3-(6-methylpyridin-2-yl)-1H-pyrazol-4-yl)-1,5-naphthyridine (all from Merck), SB431542 (Sigma-Aldrich), etc. Preferably, A-83-01 is mentioned.

[0137] As a ROCK inhibitor, there is no particular limitation as long as it is a substance that has the function of inhibiting the function of Rho binding kinase. As a ROCK inhibitor, for example, GSK269962A (Axonmedchem), fasudil hydrochloride (TocrisBioscience), Y-27632, H-1152 (all from Fujifilm Wako Pure Chemical Industries, Ltd.) and the like can be cited. Preferably, Y-27632 can be cited.

[0138] The GSK3 inhibitor is not particularly limited as long as it is a substance that inhibits GSK-3 (Glycogen Synthase Kinase 3), and examples thereof include A1070722, BIO, and BIO-acetone oxime (all from TOCRIS).

[0139] MEK inhibitors are not particularly limited as long as they are substances that have the effect of inhibiting the function of MEK (MAP kinase-ERK kinase), and examples thereof include AZD6244, CI-1040 (PD184352), PD0325901, RDEA119 (BAY86-9766), SL327, U0126-EtOH (all from Selleck), PD98059, U0124, U0125 (all from Cosmo Bio Co., Ltd.), and the like.

[0140] When the HMGB1 expression regulator of the present invention is used in regenerative medicine, based on the requirements of the law on safety assurance of regenerative medicine, etc., the following embodiment is adopted: the composition containing the culture supernatant of dental pulp-derived stem cells or immortalized stem cells thereof or microparticles derived therefrom does not contain other somatic stem cells other than dental pulp-derived stem cells, etc. The microparticle composition may contain mesenchymal stem cells or other somatic stem cells other than dental pulp-derived stem cells, etc., but preferably does not contain them.

[0141] Examples of somatic stem cells other than mesenchymal stem cells include stem cells from the dermal system, digestive system, bone marrow system, nervous system, etc., but are not limited to these. Examples of somatic stem cells of the dermal system include epithelial stem cells, hair follicle stem cells, etc. Examples of somatic stem cells of the digestive system include pancreatic (whole) stem cells, liver stem cells, etc. Examples of somatic stem cells of the bone marrow system (other than mesenchymal stem cells) include hematopoietic stem cells, etc. Examples of somatic stem cells of the nervous system include neural stem cells, retinal stem cells, etc.

[0142] The microparticle composition may contain stem cells other than somatic stem cells, but preferably does not contain any of them. Stem cells other than somatic stem cells include embryonic stem cells (ES cells), induced pluripotent stem cells (iPS cells), and embryonic carcinoma cells (EC cells).

[0143] The method for preparing the culture supernatant of dental pulp-derived stem cells or immortalized stem cells thereof is not particularly limited, and conventional methods can be employed.

[0144] The culture supernatant of dental pulp stem cells or the like is a culture fluid obtained by culturing dental pulp stem cells. For example, by separating and removing cell components after culturing dental pulp stem cells, a culture supernatant that can be used in the present invention can be obtained. A culture supernatant that has been appropriately subjected to various treatments (e.g., centrifugation, concentration, solvent replacement, dialysis, freezing, drying, freeze drying, dilution, desalting, storage, etc.) can be used.

[0145] The dental pulp stem cells used to obtain the culture supernatant of dental pulp stem cells can be screened by conventional methods, and can be screened based on the size or morphology of the cells or as adherent cells. The dental pulp cells collected from the deciduous teeth or permanent teeth can be screened as adherent cells or their passage cells. In the culture supernatant of dental pulp stem cells, the culture supernatant obtained by culturing the selected stem cells can be used.

[0146] It should be noted that the "culture supernatant of dental pulp-derived stem cells, etc." is preferably a culture medium that does not contain the cells themselves obtained by culturing dental pulp-derived stem cells, etc. The culture supernatant of dental pulp-derived stem cells used in the present invention preferably does not contain cells (regardless of the cell type) as a whole in one embodiment. The composition of this embodiment naturally distinguishes the dental pulp-derived stem cells themselves from various compositions containing dental pulp-derived stem cells based on this feature. A typical example of this embodiment is a composition that does not contain dental pulp-derived stem cells and consists only of the culture supernatant of dental pulp-derived stem cells.

[0147] The culture supernatant of dental pulp-derived stem cells used in the present invention may contain the culture supernatants of both stem cells from deciduous tooth pulp and stem cells from adult dental pulp. The culture supernatant of dental pulp-derived stem cells used in the present invention preferably contains the culture supernatant of stem cells from deciduous tooth pulp as an effective ingredient, more preferably contains 50% by mass or more, and preferably contains 90% by mass or more. The culture supernatant of dental pulp-derived stem cells used in the present invention is more preferably a composition consisting only of the culture supernatant of stem cells from deciduous tooth pulp.

[0148] In the culture solution for obtaining the stem cells from the dental pulp of the culture supernatant, a basal medium or a medium in which serum or the like is added to the basal medium can be used. It should be noted that, as a basal medium, in addition to Dulbecco's modified Eagle medium (DMEM), Iscove's modified Dulbecco's medium (IMDM) (GIBCO, etc.), HamF12 medium (HamF12) (SIGMA, GIBCO, etc.), RPMI1640 medium, etc. can also be used. In addition, as examples of components that can be added to the culture medium, serum (fetal bovine serum, human serum, sheep serum, etc.), serum substitutes (knockout serum substitute (KSR), etc.), bovine serum albumin (BSA), antibiotics, various vitamins, and various minerals can be listed.

[0149] However, in order to prepare a serum-free "culture supernatant of dental pulp-derived stem cells", a serum-free medium can be used for the entire process or the last or several subcultures from the last. For example, by culturing dental pulp-derived stem cells with a serum-free medium (serum-free medium), a serum-free culture supernatant of dental pulp-derived stem cells can be prepared. By performing one or more subcultures, and culturing the last or several subcultures from the last with a serum-free medium, a serum-free culture supernatant of dental pulp-derived stem cells can also be obtained. On the other hand, by removing serum from the recovered culture supernatant using dialysis or column-based solvent replacement, a serum-free culture supernatant of dental pulp-derived stem cells can also be obtained.

[0150] In the culture of dental pulp-derived stem cells for obtaining the culture supernatant, the conditions commonly used can be directly applied. Regarding the method for preparing the culture supernatant of dental pulp-derived stem cells, except for appropriately adjusting the separation and selection steps of stem cells according to the type of stem cells, it can be carried out in the same manner as the cell culture method described later. Those skilled in the art can appropriately separate and select dental pulp-derived stem cells according to the type of dental pulp-derived stem cells.

[0151] In addition, in the culture of dental pulp-derived stem cells, special conditions may be applied to mass-produce microparticles such as exosomes, and examples of special conditions include co-culture conditions with any stimulant such as low temperature conditions, low oxygen conditions, and microgravity conditions.

[0152] In the present invention, the culture supernatant of dental pulp-derived stem cells used for preparing microparticles such as exosomes may contain other components in addition to the culture supernatant from which the dental pulp-derived stem cells have been removed, but preferably does not contain substantially any other components.

[0153] However, various additives for preparing exosomes may be added to the culture supernatant of dental pulp-derived stem cells before storage.

[0154] (Modulation of Particles)

[0155] Microparticles can be prepared by purifying the microparticles from the culture supernatant of dental pulp-derived stem cells or the like.

[0156] The purification of the microparticles is preferably performed by isolating a fraction containing the microparticles from the culture supernatant of the dental pulp-derived stem cells, and more preferably by isolating the microparticles.

[0157] Microparticles can be separated from non-associated components by separation based on properties of the microparticles. For example, microparticles can be separated based on molecular weight, size, morphology, composition, or biological activity.

[0158] In the present invention, the microparticles can be purified by fractionating a specific fraction (e.g., a precipitate) containing a large amount of microparticles obtained by centrifuging the culture supernatant of stem cells from dental pulp. Unnecessary components (insoluble components) of fractions other than the specified fractions can be removed. The removal of the solvent and the dispersion medium and the unnecessary components from the microparticle composition may not be complete. If the conditions for the centrifugation are exemplified, it is performed at 100 to 20,000 g for 1 to 30 minutes.

[0159] In the present invention, microparticles can be purified by filtering the culture supernatant of stem cells from dental pulp or its centrifuged product. Unnecessary components can be removed by filtering. In addition, if a filter membrane with an appropriate pore size is used, the removal of unnecessary components and sterilization can be performed at the same time. There is no particular limitation on the material, pore size, etc. of the filter membrane used for filtering. Filtration can be performed using a filter membrane with an appropriate molecular weight or size cutoff according to a known method. From the viewpoint of easy fractionation and separation of exosomes, the pore size of the filter membrane is preferably 10 to 1000 nm, more preferably 30 to 500 nm, and particularly preferably 50 to 150 nm.

[0160] In the present invention, the culture supernatant of dental pulp stem cells or its centrifuged product or its filtered product can be separated by further separation methods such as column chromatography. For example, high performance liquid chromatography (HPLC) using various columns can be used. The column can be a size exclusion column or a binding column.

[0161] In each fraction at each stage of the treatment, one or more properties or biological activities of the microparticles can be used to track the microparticles (or their activity). For example, light scattering, refractive index, dynamic light scattering, or UV-visible detectors can be used to track the microparticles. Alternatively, specific enzyme activities can be used to track the activity in each fraction.

[0162] As a method for purifying microparticles, the method described in

[0034] to

[0064] of JP-A-2019-524824 can be used, and the contents of this publication are incorporated herein by reference.

[0163] There is no particular limitation on the final form of the microparticle composition. For example, the microparticle composition may be a form in which microparticles are filled into a container together with a solvent or a dispersion medium; a form in which microparticles are gelled together with a gel and filled into a container; a form in which microparticles are frozen and / or dried to solidify to form a preparation or filled into a container, etc. Examples of containers include tubes suitable for frozen storage, centrifugal sedimentation tubes, bags, etc. The freezing temperature may be, for example, -20°C to -196°C.

[0164] Compared with the compositions that can be used as therapeutic or preventive drugs for acute lung injury, acute respiratory distress syndrome or sepsis in the past, the HMGB1 expression regulator of the present invention has the following advantages: it is easy to mass produce, and the culture medium of stem cells that was previously discarded as industrial waste can be used and utilized, reducing the cost of discarding the stem cell culture medium. In particular, when the culture supernatant of stem cells from dental pulp is the culture supernatant of stem cells from human dental pulp, it also has the following advantages: when the HMGB1 expression regulator of the present invention is applied to humans, it is highly safe from the perspective of immunology and the like, and there are fewer ethical issues. When the culture supernatant of stem cells from dental pulp is the culture supernatant of stem cells from dental pulp of patients with acute lung injury, acute respiratory distress syndrome or sepsis, when the HMGB1 expression regulator of the present invention is applied to the patient, the safety is further improved and the ethical issues are reduced.

[0165] In the case where the HMGB1 expression regulator of the present invention is derived from the culture supernatant of stem cells from dental pulp, it can also be used for restorative medical purposes. In particular, a composition containing microparticles derived from the culture supernatant of stem cells from dental pulp is preferably used for restorative medical purposes. Here, it is known that in regenerative medicine based on stem cell transplantation, stem cells are not the protagonist of regeneration, but the liquid components produced by stem cells repair organs together with their own stem cells. Difficult problems such as carcinogenesis, standardization, administration method, preservation, and culture method associated with previous stem cell transplantation have been solved, and restorative medicine has become possible by using a composition of culture supernatant of stem cells from dental pulp or microparticles derived therefrom. Compared with stem cell transplantation, since cell transplantation is not performed when using the HMGB1 expression regulator of the present invention, it is not easy to cause tumorization, etc., and it can be said to be safer. In addition, the HMGB1 expression regulator of the present invention has the advantage that a regulator of a certain standardized quality can be used. Since mass production or an effective administration method can be selected, it can be used at a low cost.

[0166] [Preventive or therapeutic drugs for acute lung injury, acute respiratory distress syndrome or sepsis]

[0167] The preventive or therapeutic drug for acute lung injury, acute respiratory distress syndrome or sepsis of the present invention contains the HMGB1 expression regulator of the present invention as an active ingredient.

[0168] In this specification, "prevention" means preventing the onset of a disease (acute lung injury, acute respiratory distress syndrome or sepsis in this specification) before it occurs. In addition, in this specification, "treatment" means alleviating, inhibiting or preventing the progression of symptoms of an already developed disease, as well as improving symptoms.

[0169] [Methods for improving acute lung injury, acute respiratory distress syndrome or sepsis]

[0170] The method for improving acute lung injury, acute respiratory distress syndrome or sepsis of the present invention comprises administering an effective amount of the HMGB1 expression regulator of the present invention or an effective amount of the preventive or therapeutic drug for acute lung injury, acute respiratory distress syndrome or sepsis of the present invention to a subject suffering from acute lung injury, acute respiratory distress syndrome or sepsis.

[0171] The step of administering the HMGB1 expression regulating agent of the present invention to a subject suffering from acute lung injury, acute respiratory distress syndrome or sepsis is not particularly limited.

[0172] The method of administration can be listed as spray or suction, drip, topical administration, nasal drops, etc. to the oral cavity, nasal cavity or respiratory tract, preferably a method with few invasions. As a method for topical administration, injection is preferred. In addition, electroporation is also preferred, which temporarily opens fine holes on the cell membrane by applying voltage (electric pulse) to the skin surface, so that the active ingredient penetrates into the dermis that cannot be reached in conventional care. In the case of topical administration, intravenous administration, intraarterial administration, portal vein administration, intradermal administration, subcutaneous administration, intramuscular administration, intraperitoneal administration, etc. can be listed, more preferably intraarterial administration, intravenous administration, subcutaneous administration or intraperitoneal administration.

[0173] In addition, various formulation techniques can be used to modify the in vivo distribution of the microparticles. Various methods for modifying in vivo distribution are known to those skilled in the art. Examples of such methods include protection of exosomes in vesicles composed of substances such as proteins, lipids (e.g., liposomes), carbohydrates, or synthetic polymers.

[0174] The HMGB1 expression regulator of the present invention administered to a subject suffering from acute lung injury, acute respiratory distress syndrome or sepsis can circulate in the body of the subject and reach a predetermined tissue.

[0175] There is no particular restriction on the number of administrations and the interval between administrations. The number of administrations can be set to be once or more per week, preferably 5 or more times, more preferably 6 or more times, and particularly preferably 7 or more times. The interval between administrations is preferably 1 hour to 1 week, more preferably half a day to 1 week, and particularly preferably 1 day (once a day). However, it can be appropriately adjusted according to the biological species of the subject or the symptoms of the subject.

[0176] The HMGB1 expression regulator of the present invention is preferably used for the following purposes: administering microparticles to subjects suffering from acute lung injury, acute respiratory distress syndrome or sepsis more than once a week during the effective treatment period. When the subject is a human, the administration frequency is preferably high, preferably more than 5 times a week during the effective treatment period, and preferably daily.

[0177] The concentration used was 2.0×109 In the case of a culture supernatant of dental pulp-derived stem cells at a concentration of cells / ml, in a mouse model, the amount is preferably 0.1 to 5 ml, more preferably 0.3 to 3 ml, and particularly preferably 0.5 to 1 ml per mouse (about 25 g).

[0178] The concentration used was 0.1×10 8 In the case of microparticles of the invention having a concentration of 1 μg / μg, in a mouse model, the dosage is preferably 1 to 50 μg, more preferably 3 to 30 μg, and particularly preferably 5 to 25 μg per mouse (about 25 g).

[0179] The preferred range of the dosage per unit body weight for other animals can be calculated in a proportional relationship from the dosage per unit body weight (about 25 g) for model mice, but can be appropriately adjusted according to the symptoms of the subject.

[0180] There is no particular limitation on the target animal (biological species) to which the HMGB1 expression regulator of the present invention is administered. The target animal to which the HMGB1 expression regulator of the present invention is administered is preferably a mammal, a bird (chicken, quail, duck, etc.), or a fish (salmon, trout, tuna, bonito, etc.). As a mammal, it can be a human or a non-human mammal, but a human is particularly preferred. As a non-human mammal, it is more preferably a cow, a pig, a horse, a goat, a sheep, a monkey, a dog, a cat, a mouse, a rat, a guinea pig, or a hamster.

[0181] The HMGB1 expression regulator of the present invention can be used in combination with a conventionally known therapeutic drug for acute lung injury, acute respiratory distress syndrome or sepsis. Specifically, for example, it can be used in combination with conventionally known steroids, immunosuppressants, biological agents (tocilizumab, TNF inhibitors, etc.), antiplatelet drugs, antihistamines / antiallergic drugs, NSAIDs (nonsteroidal anti-inflammatory drugs), etc.

[0182] Example

[0183] Below, enumerate embodiment and comparative example or reference example, further specifically illustrate feature of the present invention.Material, usage amount, ratio, processing content, processing sequence etc. shown in the following embodiment can be appropriately changed as long as do not depart from the purpose of the present invention.Therefore, the scope of the present invention should not be interpreted restrictively by the specific examples shown below.

[0184] [Example 1]

[0185] <Preparation of culture supernatant of dental pulp-derived stem cells>

[0186] DMEM medium was used instead of DMEM / HamF12 mixed medium, and the culture supernatant of human deciduous dental pulp stem cells was prepared according to the method described in Example 6 of Japanese Patent No. 6296622, and the culture supernatant was fractionated. Fetal bovine serum (FBS) was added to the primary culture for culture, and the supernatant of the subculture medium obtained by culture in the subculture using the primary culture medium was fractionated to make it free of FBS, and the culture supernatant of deciduous dental pulp stem cells was prepared. It should be noted that DMEM is Dulbecco's modified Eagle medium, and F12 is Ham's F12 medium.

[0187] <Exosome Modulation>

[0188] Exosomes derived from dental pulp stem cells were purified from the obtained culture supernatant of dental pulp stem cells by the following method.

[0189] After filtering the culture supernatant (100 mL) of deciduous dental pulp stem cells with a filter having a pore size of 0.22 μm, the solution was centrifuged at 100,000 × g for 60 minutes at 4°C. The supernatant was decanted and the exosome concentrated particles were resuspended in phosphate-buffered saline (PBS). The resuspended sample was centrifuged at 100,000 × g for 60 minutes. The particles were recovered from the bottom of the centrifuge tube as a concentrated sample again (about 100 μl). The protein concentration was determined by a micro BSA protein assay kit (Pierce, Rockford, IL). The composition containing exosomes (concentrated solution) was stored at -80°C.

[0190] A composition containing exosomes purified from the culture supernatant of dental pulp-derived stem cells was used as the expression regulator of Example 1 (microparticle composition sample).

[0191] The average particle size and concentration of the microparticles contained in the expression regulating agent of Example 1 were evaluated using NanoSight, a nanoparticle analysis system (manufactured by Quantum Design Japan Inc.).

[0192] The average particle size of the microparticles contained in the expression regulating agent of Example 1 is 50 to 150 nm.

[0193] The expression regulator of Example 1 is 1.0×10 9 A high concentration of exosome solution of more than 2.0×10 9 / ml high concentration exosome solution.

[0194] In addition, the components of the expression regulator of Example 1 obtained were analyzed by a known method. As a result, it was found that the expression regulator of Example 1 did not contain stem cells from dental pulp stem cells, MCP-1, or Siglec-9. Therefore, it was found that the active ingredient different from MCP-1 and Siglec-9 and their analogs, which are active ingredients of the culture supernatant of mesenchymal stem cells, is the active ingredient of the expression regulator of Example 1.

[0195] [Comparative Example 1]

[0196] <Preparation of culture supernatant of umbilical cord-derived stem cells>

[0197] A composition containing exosomes purified from umbilical cord stem cells was prepared according to Example 1 except that human umbilical cord-derived stem cells were used instead of deciduous tooth pulp stem cells (microparticle composition of Comparative Example 1).

[0198] [Test Example 1]: MicroRNA expressed in exosomes

[0199] The microRNAs contained in the microparticle composition of Example 1 were analyzed by next generation sequencing (NGS) analysis. By NGS analysis, 1787 miRNAs contained in the microparticle composition (exosomes derived from dental pulp stem cells) of Example 1 were identified. The obtained results are shown in Table 1 below.

[0200] [Table 1]

[0201]

[0202]

[0203] [Test Example 2]: Exploration of disease-related microRNAs

[0204] Disease-related microRNAs were explored. IMOTA (Interactive Multi-Omics-Tissue Atlas) was used to extract disease-related microRNAs. IMOTA is a conversational multi-omics atlas that can study the interactions or expression levels of miRNAs, mRNAs, and proteins in various tissues or cells (Nucleic Acids Research, Vol. 46, Issue D1, 4 January 2018, pp. D770-D775, "IMOTA: an interactive multi-omics tissue atlas for the analysis of human miRNA-target interactions"). Here, it was explored whether microRNAs that regulate proteins and / or genes associated with acute lung injury or sepsis are included, or whether microRNAs that regulate proteins and / or genes that become targets of therapeutic drugs are included. In this Experimental Example 2, miRNAs with genes related to the expression of HMGB1 as target genes were explored.

[0205] The miRNAs that target genes related to HMGB1 expression and are expressed in exosomes purified from the culture supernatant of dental pulp-derived stem cells are the following HMGB1-related miRNA group (78 types).

[0206] HMGB1-related miRNA group:

[0207] hsa-let-7b-5p、hsa-let-7e-5p、hsa-let-7g-5p、hsa-miR-100-5p、hsa-miR-103a-3p、hsa-miR-106b-5p、hsa-miR-107、hsa-miR-1179、hsa-miR-1183、hsa-miR-1236-3p、hsa-miR-1237-3p、hsa-miR-1247-3p、hsa-miR-129-5p、hsa-miR-1304-3p、hsa-miR-1307-3p、hsa-miR-141-3p、hsa-miR-142-3p、hsa-miR-142-5p、hsa-miR-145-5p、hsa-miR-148a-3p、hsa-miR-148b-3p、hsa-miR-150-5p、hsa-miR-17-5p、hsa-miR-181d-5p、hsa-miR-186-3p、hsa-miR-186-5p、hsa-miR-18a-3p、hsa-miR-1913、hsa-miR-193b-3p、hsa-miR-1976、hsa-miR-204-5p、hsa-miR-205-5p、hsa-miR-206、hsa-miR-20a-5p、hsa-miR-20b-5p、hsa-miR-211-5p、hsa-miR-212-5p、hsa-miR-218-5p、hsa-miR-22-3p、hsa-miR-24-3p、hsa-miR-26b-5p、hsa-miR-300、hsa-miR-302c-3p、hsa-miR-324-3p、hsa-miR-328-3p、hsa-miR-329-3p、hsa-miR-340-5p、hsa-miR-34a-5p、hsa-miR-362-3p、hsa-miR-373-3p、hsa-miR-381-3p、hsa-miR-410-3p、hsa-miR-4275、hsa-miR-4284、hsa-miR-4324、hsa-miR-4460、hsa-miR-4532、hsa-miR-4638-5p、hsa-miR-4673、hsa-miR-4691-5p、hsa-miR-4707-3p、hsa-miR-4727-3p、hsa-miR-4793-5p、hsa-miR-495-3p、hsa-miR-505-3p、hsa-miR-512-3p、hsa-miR-5193、hsa-miR-5196-3p、hsa-miR-520a-3p, hsa-miR-520d-3p, hsa-miR-520h, hsa-miR-539-3p, hsa-miR-582-5 p, hsa-miR-652-3p, hsa-miR-660-3p, hsa-miR-665, hsa-miR-92a-3p, hsa-miR-93-5p. ,

[0208] Therefore, it was found that the expression regulating agent of the present invention is useful as an expression regulating agent of HMGB1.

[0209] The results of comparing the expression levels of miRNAs expressed in exosomes from dental pulp stem cells are shown in Figure 1 The concentration of the heat map is expressed as the log ratio of the read count values.

[0210] Depend on Figure 1 It is known that the expression inhibitor of the present invention contains miRNA related to HMGB1 at a high concentration. Therefore, the expression inhibitor of the present invention can regulate the expression of HMGB1 and / or the HMGB1 gene (Hmgb1).

[0211] [Test Example 3]: Confirmation of inhibition of HMGB1 expression

[0212] Using the human umbilical vein endothelial cell (HUVEC) vasculitis model, the suppression of HMGB1 expression was confirmed by the following method.

[0213] After inoculation, HUVEC cells were cultured for 18 hours at 37°C and 5% CO. Then, HUVEC cells were sealed in a BBL GasPak™ anaerobic system (Becton Dickinson Microbiology Systems, Cockeysville, MD, USA) and cultured under hypoxia for 24 hours. Thus, the oxygen concentration of the culture environment of HUVEC cells was 2%.

[0214] 24 hours later, 10,000 exosomes of the expression regulator of Example 1 (exosomes purified from dental pulp-derived stem cells) or the microparticle composition prepared in Comparative Example 1 (exosomes purified from umbilical cord-derived stem cells) were administered per HUVEC cell.

[0215] After 48 hours, the expression level of the HMGB1 gene was quantified by qPCR using the following primer set.

[0216] HMGB1:

[0217] HMG1 (HMGB1) Human qPCR Primer Pair (NM_002128)

[0218] GCGAAGAAACTGGGAGAGATGTG / GCATCAGGCTTCCTTT AGCTCG.

[0219] [Reference Example 1]: Hypoxia Untreated

[0220] The HMGB1 gene expression level was quantified by qPCR in the same manner as in Example 1, except that the HUVEC cells were cultured under 37°C, 5% CO for 24 hours and no microparticle composition was added, instead of culturing the cells under hypoxia for 24 hours.

[0221] [Reference Example 2]: No particles after hypoxic culture

[0222] The HMGB1 gene expression level was quantified by qPCR in the same manner as in Example 1 except that the microparticle composition was not added.

[0223] Figure 2 : is a graph showing the quantitative expression level of HMGB1 gene in each case. Figure 2 It was found that the HMGB1 expression inhibitor of the present invention can significantly inhibit the expression level of the HMGB1 gene.

Claims

1. HMGB1 expression regulator, wherein The expression regulator comprises microparticles, The microparticles contain miRNA targeting a gene related to HMGB1 expression. 2 . The HMGB1 expression regulating agent according to claim 1 , wherein the microparticles are exosomes.

3. The HMGB1 expression regulating agent according to claim 1, wherein the miRNA targeting a gene related to HMGB1 expression comprises at least one of the following HMGB1-related miRNA groups: HMGB1-related miRNA group: hsa-let-7b-5p、hsa-let-7e-5p、hsa-let-7g-5p、hsa-miR-100-5p、hsa-miR-103a-3p、hsa-miR-106b-5p、hsa-miR-107、hsa-miR-1179、hsa-miR-1183、hsa-miR-1236-3p、hsa-miR-1237-3p、hsa-miR-1247-3p、hsa-miR-129-5p、hsa-miR-1304-3p、hsa-miR-1307-3p、hsa-miR-141-3p、hsa-miR-142-3p、hsa-miR-142-5p、hsa-miR-145-5p、hsa-miR-148a-3p、hsa-miR-148b-3p、hsa-miR-150-5p、hsa-miR-17-5p、hsa-miR-181d-5p、hsa-miR-186-3p、hsa-miR-186-5p、hsa-miR-18a-3p、hsa-miR-1913、hsa-miR-193b-3p、hsa-miR-1976、hsa-miR-204-5p、hsa-miR-205-5p、hsa-miR-206、hsa-miR-20a-5p、hsa-miR-20b-5p、hsa-miR-211-5p、hsa-miR-212-5p、hsa-miR-218-5p、hsa-miR-22-3p、hsa-miR-24-3p、hsa-miR-26b-5p、hsa-miR-300、hsa-miR-302c-3p、hsa-miR-324-3p、hsa-miR-328-3p、hsa-miR-329-3p、hsa-miR-340-5p、hsa-miR-34a-5p、hsa-miR-362-3p、hsa-miR-373-3p、hsa-miR-381-3p、hsa-miR-410-3p、hsa-miR-4275、hsa-miR-4284、hsa-miR-4324、hsa-miR-4460、hsa-miR-4532、hsa-miR-4638-5p、hsa-miR-4673、hsa-miR-4691-5p、hsa-miR-4707-3p、hsa-miR-4727-3p、hsa-miR-4793-5p、hsa-miR-495-3p、hsa-miR-505-3p、hsa-miR-512-3p、hsa-miR-5193、hsa-miR-5196-3p、hsa-miR-520a-3p, hsa-miR-520d-3p, hsa-miR-520h, hsa-miR-539-3p, hsa-miR-582-5p, hsa-miR-652-3p, hsa-miR-660-3p, hsa-miR-665, hsa-miR-92a-3p, and hsa-miR-93-5p.

4. The HMGB1 expression regulator according to claim 1, wherein the miRNA targeting a gene related to HMGB1 expression comprises at least one of hsa-let-7b-5p, hsa-miR-100-5p, hsa-miR-129-5p, hsa-miR-142-3p, hsa-miR-22-3p, hsa-miR-34a-5p and hsa-miR-92a-3p. 5 . The HMGB1 expression regulator according to claim 1 , wherein the miRNA targeting a gene related to HMGB1 expression comprises at least hsa-let-7b-5p. 6 . The HMGB1 expression regulating agent according to claim 1 , wherein the microparticles contain the miRNA targeting a gene related to HMGB1 expression at a higher concentration than that in a culture supernatant of dental pulp-derived stem cells.

7. The HMGB1 expression regulating agent according to claim 1, wherein the microparticles are microparticles purified and separated from the culture supernatant of dental pulp-derived stem cells. The microparticles do not contain components obtained by removing the exosomes from the culture supernatant of the dental pulp-derived stem cells.

8. A preventive or therapeutic drug for acute lung injury, acute respiratory distress syndrome or sepsis, comprising the HMGB1 expression regulator according to claim 1 as an active ingredient.

9. A method for improving acute lung injury, acute respiratory distress syndrome or sepsis, comprising administering an effective amount of the HMGB1 expression regulator according to claim 1 or an effective amount of the preventive or therapeutic drug for acute lung injury, acute respiratory distress syndrome or sepsis according to claim 8 to a subject suffering from acute lung injury, acute respiratory distress syndrome or sepsis.

Images