Antibody oligonucleotide conjugate compositions and methods for inducing DMD exon 44 hopping

Abstract

Disclosed herein are antibody oligonucleotide conjugates and pharmaceutical compositions that induce alterations in incorrectly spliced myotrophic protein mRNA transcripts to induce exon 44 skipping. The content described herein also includes methods for treating muscular dystrophy, including Duchenne muscular dystrophy, comprising administering an antibody oligonucleotide conjugate or pharmaceutical composition that induces alteration in an incorrectly spliced dystrophin mRNA transcript to induce exon 44 skipping.

Description

[0001] Cross-references

[0002] This application claims the benefit of U.S. Provisional Application No. 63 / 327,725, filed on April 5, 2022, which is incorporated herein by reference in its entirety. Background Art

[0003] Duchenne muscular dystrophy (DMD) is a rare X-linked neuromuscular disease that occurs primarily in boys, affecting approximately 1:5000-10,000 male births worldwide. There are approximately 300,000 DMD patients worldwide. DMD is a monogenic disease; it is progressive, severe and irreversible. The disease is caused by mutations in the DMD gene, which is the longest gene in the human genome (79 exons) and encodes dystrophin (430 kDa). The central domain of dystrophin (called the rod domain) is formed by 24 spectrin repeats that act as shock absorbers and protect the muscle fiber membrane from damage during movement.

[0004] DMD is caused by mutations (changes) within the dystrophin gene. The deletion of one or more exons is the most common type of mutation. Since there are 79 exons in the dystrophin gene, many different deletions can occur. However, certain regions of the gene are more likely to be deleted, and these regions are called "hot spots". Non-randomly distributed deletions in the DMD gene and many larger gene deletions that occur in the DMD gene can be detected in specific hot spot regions of the gene. These hot spots are concentrated in two main regions: about 20% of the deletions occur in the 5' proximal part of the gene (exons 1, 3, 4, 5, 8, 13, 19); and about 80% of the deletions occur in the mid-distal region (i.e. 42-45, 47, 48, 50-53) (Den Dunnen et al. Am J Hum Genet. 1989; 45 (6): 835-847). The mutated DMD gene cannot produce any functional dystrophin, and the lack of functional dystrophin can lead to progressive muscle weakness caused by muscle damage, repair, inflammatory changes and paralysis.

[0005] Current research into DMD treatments includes stem cell replacement therapy, analog upregulation, gene replacement, and exon skipping. Exon skipping uses DNA structural analogs called antisense oligonucleotides to help cells skip specific exons during RNA splicing. These antisense oligonucleotides allow the faulty portion of the dystrophin gene to be skipped when it is transcribed into RNA for protein production, allowing muscle cells to produce a still truncated but more functional version of dystrophin.

[0006] Several antisense oligonucleotides have been approved for use in patients with DMD who are amenable to skipping exons 45, 51, or 53. An antisense oligonucleotide called Eteplirsen has been approved in the U.S. for the treatment of mutations amenable to skipping dystrophin exon 51. An antisense oligonucleotide called Golodirsen was approved for medical use in the U.S. in 2019 for the treatment of cases that would benefit from skipping exon 53 of the dystrophin transcript. An antisense oligonucleotide called Casimersen was approved in the U.S. in February 2021 for the treatment of patients with confirmed DMD gene mutations amenable to skipping exon 45.

[0007] Although exon skipping has been extensively studied for exon 44 (U.S. Pat. No. 9,447,417, U.S. Pat. No. 8,461,325, and U.S. Pat. No. 8,361,979), there are currently no FDA-approved exon skipping therapies for DMD patients who are suitable for exon 44 skipping. Approximately 6% of the DMD patient population are suitable for exon 44 skipping, and the majority of these DMD patients are also likely to have exon 45 deletions of the DMD transcript.

[0008] A new class of therapeutic agents, called antibody-oligonucleotide conjugates (AOCs), improves the delivery of antisense oligonucleotides. These AOCs target and deliver antisense oligonucleotides to specific tissues and cell types, including muscle cells. These AOCs are being developed for potential breakthrough therapies for DMD patients, including those suitable for exon 44 skipping. There is a need to provide a therapy for DMD patients suitable for exon 44 skipping. Summary of the invention

[0009] In certain aspects, disclosed herein is a phosphorodiamidate morpholino oligonucleotide (PMO) conjugate comprising an anti-transferrin receptor antibody or an antigen-binding fragment thereof conjugated to a PMO molecule, wherein the PMO molecule comprises a sequence selected from SEQ ID NO: 100-133. In some aspects, the PMO molecule hybridizes to an acceptor splice site, a donor splice site, or an exon splicing enhancer element of a pre-mRNA transcript of a DMD gene, and induces exon 44 skipping in the pre-mRNA transcript to generate an mRNA transcript encoding a truncated DMD protein. In some aspects, the length of the PMO molecule is at least about 10 to about 30 nucleotides. In some aspects, the PMO molecule is delivered to a muscle cell. In some aspects, the PMO molecule hybridizes to an acceptor splice site of exon 44 of the pre-mRNA transcript of the DMD gene in the pre-mRNA transcript to generate an mRNA transcript encoding a truncated dystrophin. In some aspects, the anti-transferrin receptor antibody or its antigen binding fragment includes a humanized antibody or its antigen binding fragment, a chimeric antibody or its antigen binding fragment, a monoclonal antibody or its antigen binding fragment, a monovalent Fab', a bivalent Fab2, a single chain variable fragment (scFv), a double antibody, a mini antibody, a nano antibody, a single domain antibody (sdAb) or a camelid antibody or its antigen binding fragment. In some aspects, the PMO molecule is conjugated to the anti-transferrin receptor antibody or its antigen binding fragment via a joint. In some aspects, the joint is a cleavable joint. In some aspects, the joint is a non-cleavable joint. In some aspects, the joint is selected from a heterobifunctional joint, a homobifunctional joint, a maleimide group, a dipeptide moiety, a benzoic acid group or its derivative, a C1-C6 alkyl group and a combination thereof. In some aspects, the PMO molecule to antibody ratio (DAR) of the PMO conjugate is about 1: 1, 2: 1, 3: 1, 4: 1, 5: 1, 6: 1, 7: 1, 8: 1 or higher. In some aspects, the average DAR of the PMO conjugate is about 1, 2, 3, 4, 5, 6, 7, 8 or higher. In some aspects, the average DAR of the PMO conjugate ranges from 3.5-4.5. In some aspects, the average DAR of the PMO conjugate ranges from 7.5-8.5. In some aspects, the average DAR of the PMO conjugate is about 4. In some aspects, the average DAR of the PMO conjugate is about 8. In some aspects, the DAR of the PMO conjugate is about 4. In some aspects, the DAR of the PMO conjugate is about 8. In some aspects, the PMO conjugate is formulated for parenteral administration. In some aspects, muscular dystrophy is regulated by truncated dystrophin. In some aspects, muscular dystrophy is Duchenne muscular dystrophy or Becker muscular dystrophy.

[0010] In certain aspects, the present invention also discloses a method for treating muscular dystrophy in a subject in need thereof, the method comprising administering to the subject a phosphorodiamidate morpholino oligonucleotide (PMO) conjugate comprising an anti-transferrin receptor antibody or an antigen-binding fragment thereof conjugated to a PMO molecule (which comprises a sequence selected from SEQ ID NO: 100-133); wherein the PMO molecule hybridizes to an acceptor splice site, a donor splice site, or an exon splicing enhancer element of a pre-mRNA transcript of a DMD gene, and induces exon 44 skipping in the pre-mRNA transcript to generate an mRNA transcript encoding a truncated dystrophin. In some aspects, the PMO molecule is delivered to a muscle cell. In some aspects, the anti-transferrin receptor antibody or an antigen-binding fragment thereof comprises a humanized antibody or an antigen-binding fragment thereof, a chimeric antibody or an antigen-binding fragment thereof, a monoclonal antibody or an antigen-binding fragment thereof, a monovalent Fab', a bivalent Fab2, a single chain variable fragment (scFv), a diabody, a minibody, a nanobody, a single domain antibody (sdAb), or a camelid antibody or an antigen-binding fragment thereof. In some aspects, the length of the PMO molecule is at least about 10 to about 30 nucleotides. In some aspects, the PMO molecule is conjugated to an anti-transferrin receptor antibody or its antigen-binding fragment via a joint. In some aspects, the joint is a cleavable joint. In some cases, the joint is a non-cleavable joint. In some aspects, the joint is selected from a heterobifunctional joint, a homobifunctional joint, a maleimide group, a dipeptide moiety, a benzoic acid group or its derivative, a C1-C6 alkyl group and a combination thereof. In some aspects, the average PMO molecule to antibody ratio (DAR) of the PMO conjugate is about 1: 1, 2: 1, 3: 1, 4: 1, 5: 1, 6: 1, 7: 1 or 8: 1. In some aspects, the average DAR of the PMO conjugate is in the range of 3.5-4.5. In some aspects, the average DAR of the PMO conjugate is in the range of 7.5-8.5. In some aspects, the average DAR of the PMO conjugate is about 4. In some aspects, the average DAR of the PMO conjugate is about 8. In some aspects, the PMO conjugate is administered parenterally. In some aspects, muscular dystrophy is modulated by truncated dystrophin. In some aspects, the muscular dystrophy is Duchenne muscular dystrophy or Becker muscular dystrophy.

[0011] In certain aspects, also disclosed herein is a method for inducing exon 44 skipping in a targeted pre-mRNA transcript of a DMD gene, the method comprising: (a) contacting a muscle cell with a phosphodiamidate morpholino oligonucleotide (PMO)-antibody conjugate, wherein the PMO-antibody conjugate comprises an anti-transferrin receptor antibody or an antigen-binding fragment thereof and a PMO molecule that targets an acceptor splice site, a donor splice site, or an exonic splicing enhancer element of a targeted pre-mRNA transcript of a DMD gene; wherein the PMO molecule induces exon 44 skipping in the targeted pre-mRNA transcript, and wherein the PMO-antibody conjugate is preferentially delivered to the muscle cell; (b) hybridizing the PMO molecule to the targeted pre-mRNA transcript to induce exon 44 skipping in the targeted pre-mRNA transcript; and (c) translating in the muscle cell an mRNA transcript produced from the targeted pre-mRNA transcript processed in step b) to produce a truncated dystrophin protein. In some aspects, the anti-transferrin receptor antibody or its antigen-binding fragment comprises a humanized antibody or its antigen-binding fragment, a chimeric antibody or its antigen-binding fragment, a monoclonal antibody or its antigen-binding fragment, a monovalent Fab', a bivalent Fab2, a single-chain variable fragment (scFv), a diabody, a mini-antibody, a nano-antibody, a single-domain antibody (sdAb) or a camelid antibody or its antigen-binding fragment. In some aspects, the length of the PMO molecule is at least about 10 to about 30 nucleotides. In some aspects, the PMO molecule has at least 90%, 95%, 99% or 100% sequence identity with a sequence selected from SEQ ID NO: 100-133. In some aspects, the PMO molecule targets the receptor site of exon 44. In some aspects, the PMO molecule is conjugated to the anti-transferrin receptor antibody or its antigen-binding fragment via a joint. In some aspects, the joint is a cleavable joint. In some aspects, the joint is a non-cleavable joint. In some aspects, the linker is selected from a heterobifunctional linker, a homobifunctional linker, a maleimide group, a dipeptide moiety, a benzoic acid group or a derivative thereof, a C1-C6 alkyl group, and a combination thereof. In some aspects, the average PMO to antibody ratio (DAR) of the PMO conjugate is about 1: 1, 2: 1, 3: 1, 4: 1, 5: 1, 6: 1, 7: 1, 8: 1 or higher. In some aspects, the DAR of the PMO conjugate is about 1, 2, 3, 4, 5, 6, 7, 8 or higher. In some aspects, the average DAR of the PMO conjugate ranges from 3.5-4.5. In some aspects, the average DAR of the PMO conjugate ranges from 7.5-8.5. In some aspects, the average DAR of the PMO conjugate is about 4. In some aspects, the average DAR of the PMO conjugate is about 8. In some aspects, the method is an in vivo method.

[0012] In certain aspects, also disclosed herein is a method of inducing exon 44 skipping in a DMD subject in need thereof, the method comprising administering to the subject a phosphodiamidate morpholino oligonucleotide (PMO) conjugate comprising an anti-transferrin receptor antibody or an antigen-binding fragment thereof conjugated to a PMO molecule comprising a sequence selected from SEQ ID NOs: 100-133; wherein the PMO molecule hybridizes to an exon 44 acceptor splice site of a pre-mRNA transcript of a DMD gene and induces exon 44 skipping in the pre-mRNA transcript to generate an mRNA transcript encoding a truncated dystrophin protein.

[0013] In certain aspects, also disclosed herein is a method of restoring dystrophin in a DMD subject in need thereof, the method comprising administering to the subject a phosphodiamidate morpholino oligonucleotide (PMO) conjugate comprising an anti-transferrin receptor antibody or an antigen-binding fragment thereof conjugated to a PMO molecule comprising a sequence selected from SEQ ID NOs: 100-133; wherein the PMO molecule hybridizes to an exon 44 acceptor splice site of a pre-mRNA transcript of a DMD gene and induces exon 44 skipping in the pre-mRNA transcript to generate an mRNA transcript encoding a truncated dystrophin.

[0014] In certain aspects, also disclosed herein is a method of producing a truncated dystrophin protein in a DMD subject in need thereof, the method comprising administering to the subject a phosphodiamidate morpholino oligonucleotide (PMO) conjugate comprising an anti-transferrin receptor antibody or an antigen-binding fragment thereof conjugated to a PMO molecule comprising a sequence selected from SEQ ID NOs: 100-133; wherein the PMO molecule hybridizes to an exon 44 acceptor splice site of a pre-mRNA transcript of a DMD gene and induces exon 44 skipping in the pre-mRNA transcript to generate an mRNA transcript encoding a truncated dystrophin protein. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 is a graph comparing predicted values ​​of exon 44 skipping activity in response to 25-mer and 30-mer phosphorodiamidate morpholino oligomers (PMOs) with experimental values ​​for exon 44 skipping.

[0016] Figure 2 is a graph of dose response curves for relative levels of exon 44 skipping in human immortalized myoblasts in response to increasing concentrations of 12 different 30-mer PMOs.

[0017] Figure 3is a dose response graph of the relative levels of exon 44 skipping in response to increasing concentrations of 3 different PMOs: hEx44_Ac7_26, hEx44_Ac5_27, and hEx44_Ac4_28.

[0018] Figure 4A-4C Shown is a graph of a dose response curve of relative levels of exon 44 skipping in myotube cells in response to increasing concentrations of hEx44_Ac7_26. Figure 4A is a graph of dose response curves of relative levels of exon 44 skipping in healthy primary and immortalized cells in response to increasing concentrations of hEx44_Ac7_26. Figure 4B is a graph of a dose response curve of relative levels of exon 44 skipping in DMD primary cells derived from DMD patients in response to increasing concentrations of hEx44_Ac7_26. Figure 4C is a graph of a dose response curve of relative levels of exon 44 skipping in DMD immortalized cells in response to increasing concentrations of hEx44_Ac7_26.

[0019] Figure 5A-5C Depicted are dystrophin levels in cultured myotubes derived from DMD patients in response to increasing concentrations of hEx44_Ac7_26. Figure 5A Shown are images of immunofluorescence staining of dystrophin-positive fibers in healthy human cells and in cultured myotubes derived from DMD patients transfected with hEx44_Ac7_26. Figure 5B is a dose response graph of relative dystrophin levels in cultured myotubes derived from DMD patients quantified by immunofluorescence staining in response to increasing concentrations of hEx44_Ac7_26. Figure 5C is a bar graph quantifying dystrophin levels in healthy cultured myotubes as well as cultured myotubes derived from DMD patients in response to increasing concentrations of hEx44_Ac7_26 by Jess capillary assay.

[0020] Figure 6A-6C is a graph of the dose response of relative levels of exon 44 skipping in non-human primate myotubes in response to increasing concentrations of hEx44_Ac7_26. Fig. 6A is a dose response graph of the relative levels of exon 44 skipping in non-human primate myotubes in response to increasing concentrations of hEx44_Ac7_26. Figure 6B is a bar graph quantifying the number of copies of exon 44 that are skipped in non-human primate myotubes in response to increasing concentrations of hEx44_Ac7_26. Figure 6C is a bar graph quantifying the total number of dystrophin copies in non-human primate myotubes in the presence of increasing concentrations of hEx44_Ac7_26.

[0021] Figure 7 is a graph illustrating the binding assay of DAR8 hEx44_Ac7_26AOC or unmodified anti-transferrin receptor monoclonal antibody to transferrin receptor by ELISA.

[0022] Figure 8 is a bar graph illustrating the number of exon 44 skipped copies in muscle and non-muscle tissues obtained on day 43 / 44 from cynomolgus monkeys administered a dose of 159.9 mg / kg of hEx44_Ac7_26-AOC as a single infusion on day 0. DETAILED DESCRIPTION

[0023] In some aspects, disclosed herein are antibody-polynucleic acid conjugate compositions for treating muscular dystrophy. In some aspects, disclosed herein are methods for treating muscular dystrophy caused by incorrectly spliced ​​DMD mRNA transcripts in subjects in need thereof, the methods comprising: administering an antibody-polynucleic acid conjugate to a subject; wherein the antibody-polynucleic acid conjugate induces changes in incorrectly spliced ​​pre-mRNA dystrophy transcripts to induce exon 44 skipping of DMD mRNA transcripts, thereby generating fully processed DMD mRNA transcripts; and wherein the fully processed DMD mRNA transcripts encode functional and truncated dystrophin, thereby treating a disease or disorder of a subject. As used herein, the term "polynucleic acid" may be used interchangeably with the term "oligonucleotide".

[0024] In some aspects, disclosed herein are antibody-antisense oligonucleotide (ASO) conjugates or antibody-phosphodiamidate morpholino oligomer (PMO) conjugate compositions for treating muscular dystrophy. Also disclosed herein are methods for treating muscular dystrophy caused by incorrectly spliced ​​DMD mRNA transcripts in subjects in need thereof, the methods comprising: administering an antibody-ASO conjugate or an antibody-PMO conjugate to the subject; wherein the ASO or PMO induces changes in the incorrectly spliced ​​pre-mRNA dystrophy transcript to induce exon 44 skipping of the DMD mRNA transcript, thereby generating a fully processed DMD mRNA transcript; and wherein the fully processed DMD mRNA transcript encodes a functional and truncated dystrophin, thereby treating the disease or disorder of the subject.

[0025] In some cases, such an area of ​​use of antibody-polynucleic acid conjugates is used to treat muscular dystrophy. Muscular dystrophy encompasses several diseases that affect muscles. Duchenne muscular dystrophy is a severe form of muscular dystrophy and is caused by mutations in the DMD gene. In some cases, mutations in the DMD gene disrupt the translation reading frame and produce non-functional dystrophin.

[0026] In certain aspects, methods and compositions related to nucleic acid therapy are described herein, which induce insertions, deletions, duplications or changes in incorrectly spliced ​​mRNA transcripts to induce exon skipping or exon inclusion for restoring the translation reading frame. In some aspects, the description herein also includes methods and compositions for treating diseases or disorders characterized by incorrectly processed mRNA transcripts, wherein after removing the exons, the mRNA is able to encode a functional protein, thereby treating the disease or disorder. In other aspects, the description herein includes pharmaceutical compositions and kits for treating the disease or disorder.

[0027] RNA processing

[0028] RNA plays a central role in regulating gene expression and cell physiology. The correct processing of RNA is very important for the translation of functional proteins. Changes in RNA processing (such as the result of incorrect splicing of RNA) can cause disease. For example, a sudden change in a splice site leads to the exposure of premature termination codons, the loss of exons or the inclusion of introns. In some cases, the changes in RNA processing cause insertions, deletions or repetitions. In some cases, the changes in RNA processing cause insertions, deletions or repetitions of exons. In some cases, the changes in RNA processing cause insertions, deletions or repetitions of introns.

[0029] Exon skipping

[0030] As used herein, the term "pre-mRNA" refers to a transcription product comprising both exons (coding sequences) and introns (non-coding sequences). Exon skipping is a form of RNA splicing. In some cases, exon skipping occurs when exons are skipped in pre-mRNA transcripts or spliced ​​out from processed mRNA. Due to exon skipping, processed mRNA does not contain skipped exons. In some cases, exon skipping causes expression of altered transcripts and / or mRNA products. For example, when exon 44 is skipped in pre-mRNA transcripts or spliced ​​out from processed DMD mRNA, exon 44 skipping occurs. Due to exon 44 skipping, processed DMD mRNA does not contain skipped exon 44. In some cases, exon 44 skipping causes expression of truncated dystrophin. In some cases, exon 44 skipping causes expression of functional dystrophin. In some cases, exon 44 skipping causes expression of truncated and functional dystrophin.

[0031] In some cases, morpholino or phosphorodiamidate morpholino oligonucleotide (PMO)-antibody conjugate (PMO-AOC) is used to induce exon skipping. In some cases, morpholino or phosphorodiamidate morpholino oligonucleotide (PMO)-antibody conjugate is used to deliver PMO to induce exon skipping (e.g., in cells, preferably in muscle cells, etc.). In some cases, the delivered PMO is used to induce exon skipping. For example, PMO binds splice sites or exon enhancers. In some cases, the combination of PMO and specific mRNA or pre-mRNA sequences generates double-stranded regions. In some cases, PMO binds to acceptor or donor splice sites at the beginning and / or end of exons. In some cases, morpholino or phosphorodiamidate morpholino oligonucleotide (PMO)-antibody conjugate is used to induce exon 44 skipping. In some cases, morpholino or phosphorodiamidate morpholino oligonucleotide (PMO)-antibody conjugate is used to deliver PMO to induce exon 44 skipping. The delivered PMO is used to induce exon 44 skipping. For example, the delivered PMO binds to at least one of the splice sites or exon enhancers of exon 44. In some cases, the binding of PMO to a specific mRNA or pre-mRNA sequence generates a double-stranded region. In some cases, PMO binds to an acceptor or donor splice site at the beginning and / or end of exon 44. In some cases, PMO binds to an acceptor splice site at the beginning of exon 44. In some cases, PMO binds to a donor splice site at the beginning of exon 44. In some cases, antisense oligonucleotides (AON, ASO) are used to induce exon skipping. As used herein, the term "AON" can be used interchangeably with the term "ASO" and both refer to antisense oligonucleotides. In some cases, AON is a short nucleic acid sequence that binds to a specific mRNA or pre-mRNA sequence. For example, AON binds to a splice site or an exon enhancer. In some cases, binding of the AON to a particular mRNA or pre-mRNA sequence generates a double-stranded region. In some cases, formation of the double-stranded region occurs at a site where the spliceosome or a protein associated with the spliceosome would normally bind to an exon and cause the exon to be skipped. In some cases, skipping of the exon results in restoration of the transcript reading frame and allows production of at least partially functional dystrophin.

[0032] Indications

[0033] In some aspects, the polynucleic acid molecules (oligonucleotides, such as PMOs, ASOs, etc.) described herein or pharmaceutical compositions comprising the polynucleic acid molecules are used to treat diseases or disorders characterized by defective mRNA. In some aspects, the polynucleic acid molecules (oligonucleotides, such as PMOs, ASOs, etc.) described herein or pharmaceutical compositions comprising the polynucleic acid molecules are used to treat diseases or disorders by inducing insertions, deletions, duplications or changes in incorrectly spliced ​​mRNA transcripts to induce exon skipping or exon inclusion.

[0034] A large percentage of human protein coding genes are alternatively spliced. In some cases, mutations produce inappropriately spliced ​​or partially spliced ​​mRNAs. For example, mutations can occur in at least one of a splice site, a silencer or enhancer sequence, an exon sequence, or an intron sequence in a protein coding gene. In some cases, mutations cause abnormal gene function. In some cases, mutations cause diseases or conditions.

[0035] In some cases, improperly spliced ​​or partially spliced ​​mRNAs lead to neuromuscular diseases or disorders. Exemplary neuromuscular diseases include muscular dystrophy, such as Duchenne muscular dystrophy, Becker muscular dystrophy, facioscapulohumeral muscular dystrophy, congenital muscular dystrophy, or myotonic dystrophy. In some cases, muscular dystrophy is hereditary. In some cases, muscular dystrophy is caused by spontaneous mutations. Becker muscular dystrophy and Duchenne muscular dystrophy have been shown to involve mutations in the DMD gene encoding dystrophin.

[0036] In some cases, improperly spliced ​​or partially spliced ​​mRNA leads to Duchenne muscular dystrophy. Duchenne muscular dystrophy causes severe muscle weakness and is caused by a mutation in the DMD gene that prevents the production of functional dystrophin. In some cases, Duchenne muscular dystrophy is caused by a mutation in exon 44 in the DMD gene. In some cases, multiple exons are mutated / deleted. For example, mutations in exons 44 and 45 are common in Duchenne muscular dystrophy patients. In some cases, Duchenne muscular dystrophy is caused by a mutation in exon 44. In some cases, Duchenne muscular dystrophy is caused by a mutation in exon 44 and a deletion in exon 45.

[0037] In some cases, a polynucleic acid-antibody conjugate as described herein or a pharmaceutical composition comprising the polynucleic acid-antibody conjugate is used to treat muscular dystrophy. In some cases, a polynucleic acid-antibody conjugate as described herein or a pharmaceutical composition comprising the polynucleic acid-antibody conjugate is used to treat Duchenne muscular dystrophy, Becker muscular dystrophy, facioscapulohumeral muscular dystrophy, congenital muscular dystrophy, or myotonic dystrophy. In some cases, a polynucleic acid-antibody conjugate as described herein or a pharmaceutical composition comprising the polynucleic acid-antibody conjugate is used to treat Duchenne muscular dystrophy. In some cases, a PMO-antibody conjugate as described herein or a pharmaceutical composition comprising the PMO-antibody conjugate is used to induce exon 44 skipping to treat muscular dystrophy. In some cases, a PMO-antibody conjugate as described herein or a pharmaceutical composition comprising the PMO-antibody conjugate is used to induce exon 44 skipping to treat Duchenne muscular dystrophy or Becker muscular dystrophy. In some cases, a PMO-antibody conjugate or a pharmaceutical composition comprising the PMO-antibody conjugate as described herein is used to induce exon 44 skipping to treat Duchenne muscular dystrophy.

[0038] Antibody-polynucleic acid conjugates

[0039] In some aspects, antibodies are conjugated to polynucleic acid molecules. Polynucleic acid molecules can be ASOs or PMOs. In some cases, one or more polynucleic acid molecules are PMOs. Antibodies can be anti-transferrin receptor (anti-CD71) antibodies or antigen-binding fragments thereof. In some aspects, antibodies are non-specifically conjugated to polynucleic acid molecules. In some cases, antibodies are conjugated to polynucleic acid molecules via lysine residues. In some cases, antibodies are conjugated to polynucleic acid molecules via cysteine ​​residues. In some cases, antibodies are conjugated to polynucleic acid molecules via lysine residues or cysteine ​​residues in a non-site-specific manner. In some cases, antibodies are conjugated to polynucleic acid molecules in a non-site-specific manner via lysine residues (e.g., lysine residues present in antibodies). In some cases, antibodies are conjugated to polynucleic acid molecules in a non-site-specific manner via cysteine ​​residues (e.g., cysteine ​​residues present in antibodies).

[0040] In some aspects, antibodies are conjugated to polynucleic acid molecules in a site-specific manner. In some cases, antibodies are conjugated to polynucleic acid molecules via a site-specific manner by lysine residues, cysteine ​​residues, at the 5' end, at the 3' end, non-natural amino acids or enzyme-modified or enzyme-catalyzed residues. In some cases, antibodies are conjugated to polynucleic acid molecules by lysine residues (lysine residues present in, for example, antibodies, via a site-specific manner). In some cases, antibodies are conjugated to polynucleic acid molecules by cysteine ​​residues (cysteine ​​residues present in, for example, antibodies, via a site-specific manner). In some cases, antibodies are conjugated to polynucleic acid molecules at the 5' end via a site-specific manner. In some cases, antibodies are conjugated to polynucleic acid molecules at the 3' end via a site-specific manner. In some cases, antibodies are conjugated to polynucleic acid molecules via a site-specific manner by non-natural amino acids. In some cases, antibodies are conjugated to polynucleic acid molecules via a site-specific manner by enzyme-modified or enzyme-catalyzed residues. In some cases, antibodies are conjugated to polynucleic acid molecules via a joint or one or more joints.

[0041] In some aspects, one or more polynucleic acid molecules are conjugated to an antibody. One or more polynucleic acid molecules may be ASOs or PMOs. In some cases, one or more polynucleic acid molecules are PMOs. The antibody may be an anti-transferrin receptor (anti-CD71) antibody or an antigen-binding fragment thereof. In some cases, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 or more polynucleic acid molecules are conjugated to an antibody. In some cases, about 1 polynucleic acid molecule is conjugated to an antibody. In some cases, about 2 polynucleic acid molecules are conjugated to an antibody. In some cases, about 3 polynucleic acid molecules are conjugated to an antibody. In some cases, about 4 polynucleic acid molecules are conjugated to an antibody. In some cases, about 5 polynucleic acid molecules are conjugated to an antibody. In some cases, about 6 polynucleic acid molecules are conjugated to an antibody. In some cases, about 7 polynucleic acid molecules are conjugated to an antibody. In some cases, about 8 polynucleic acid molecules are conjugated to an antibody. In some cases, about 9 polynucleic acid molecules are conjugated to one antibody. In some cases, about 10 polynucleic acid molecules are conjugated to one antibody. In some cases, about 11 polynucleic acid molecules are conjugated to one antibody. In some cases, about 12 polynucleic acid molecules are conjugated to one antibody. In some cases, about 13 polynucleic acid molecules are conjugated to one antibody. In some cases, about 14 polynucleic acid molecules are conjugated to one antibody. In some cases, about 15 polynucleic acid molecules are conjugated to one antibody. In some cases, about 16 polynucleic acid molecules are conjugated to one antibody. In some cases, one or more polynucleic acid molecules are the same. In other cases, one or more polynucleic acid molecules are different.

[0042] In some aspects, the number of polynucleic acid molecules conjugated with an antibody forms a ratio. In some cases, the ratio is referred to as DAR (drug-antibody) ratio, wherein the drug as mentioned herein is a polynucleic acid molecule. In some cases, the DAR ratio of a polynucleic acid molecule to an antibody is about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 or more. In some cases, the DAR ratio of a polynucleic acid molecule to an antibody A is about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 or more. In some cases, the DAR ratio includes integers and fractions or decimals of the DAR ratio. For example, the fraction or decimal of the DAR ratio includes X.1, X.2, X.3, X.4, X.5, X.6, X.7, X.8, X.9 (e.g., 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, etc.). In some cases, the DAR ratio of the polynucleic acid molecule to the antibody is about 1 or greater. In some cases, the DAR ratio of the polynucleic acid molecule to the antibody is about 2 or greater. In some cases, the DAR ratio of the polynucleic acid molecule to the antibody is about 3 or greater. In some cases, the DAR ratio of the polynucleic acid molecule to the antibody is about 4 or greater. In some cases, the DAR ratio of the polynucleic acid molecule to the antibody is about 5 or greater. In some cases, the DAR ratio of the polynucleic acid molecule to the antibody is about 6 or greater. In some cases, the DAR ratio of the polynucleic acid molecule to the antibody is about 7 or greater. In some cases, the DAR ratio of the polynucleic acid molecule to the antibody is about 8 or greater. In some cases, the DAR ratio of the polynucleic acid molecule to the antibody is about 9 or greater. In some cases, the DAR ratio of the polynucleic acid molecule to the antibody is about 10 or greater. In some cases, the DAR ratio of the polynucleic acid molecule to the antibody is about 11 or greater. In some cases, the DAR ratio of the polynucleic acid molecule to the antibody is about 12 or greater.

[0043] In some cases, the DAR ratio of the polynucleic acid molecule to the antibody is about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16. In some cases, the DAR ratio of the polynucleic acid molecule to the antibody is about 1. In some cases, the DAR ratio of the polynucleic acid molecule to the antibody is about 2. In some cases, the DAR ratio of the polynucleic acid molecule to the antibody is about 3. In some cases, the DAR ratio of the polynucleic acid molecule to the antibody is about 4. In some cases, the DAR ratio of the polynucleic acid molecule to the antibody is about 5. In some cases, the DAR ratio of the polynucleic acid molecule to the antibody is about 6. In some cases, the DAR ratio of the polynucleic acid molecule to the antibody is about 7. In some cases, the DAR ratio of the polynucleic acid molecule to the antibody is about 8. In some cases, the DAR ratio of the polynucleic acid molecule to the antibody is about 9. In some cases, the DAR ratio of the polynucleic acid molecule to the antibody is about 10. In some cases, the DAR ratio of the polynucleic acid molecule to the antibody is about 11. In some cases, the DAR ratio of the polynucleic acid molecule to the antibody is about 12. In some cases, the DAR ratio of the polynucleic acid molecule to the antibody is about 13. In some cases, the DAR ratio of the polynucleic acid molecule to the antibody is about 14. In some cases, the DAR ratio of the polynucleic acid molecule to the antibody is about 15. In some cases, the DAR ratio of the polynucleic acid molecule to the antibody is about 16.

[0044] In some cases, the DAR ratio of the polynucleic acid molecule to the antibody is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16. In some cases, the DAR ratio of the polynucleic acid molecule to the antibody is 1. In some cases, the DAR ratio of the polynucleic acid molecule to the antibody is 2. In some cases, the DAR ratio of the polynucleic acid molecule to the antibody is 4. In some cases, the DAR ratio of the polynucleic acid molecule to the antibody is 6. In some cases, the DAR ratio of the polynucleic acid molecule to the antibody is 8. In some cases, the DAR ratio of the polynucleic acid molecule to the antibody is 12. In some cases, the DAR ratio of the polynucleic acid molecule to the antibody is 16.

[0045] In some aspects, the composition comprises a variety of antibody-polynucleic acid conjugates. In some cases, the number of polynucleic acid molecules conjugated to the antibody forms a ratio. In some cases, the ratio is called DAR (drug-antibody) ratio, wherein the drug as mentioned herein is a polynucleic acid molecule. In some cases, the multiple antibody-polynucleic acid conjugates in the composition have the same DAR ratio. In some cases, the multiple antibody-polynucleic acid conjugates in the composition have different DAR ratios. In some cases, at least two of the antibody-polynucleic acid conjugates in the composition have different DAR ratios from each other. In some cases, the DAR ratio is an average DAR (drug-antibody) ratio, which is the average of the DAR ratios of the multiple antibody-polynucleic acid conjugates in the composition. In some cases, the average DAR ratio of polynucleic acid molecules to antibodies is about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 or more. In some cases, the average DAR ratio of polynucleic acid molecules to antibodies is about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 or more. In some cases, the average DAR ratio includes integers and fractions or decimals of the DAR ratio. In some cases, the average DAR ratio of polynucleic acid molecules to antibodies is about 1 or more. In some cases, the average DAR ratio of polynucleic acid molecules to antibodies is about 2 or more. In some cases, the average DAR ratio of polynucleic acid molecules to antibodies is about 3 or more. In some cases, the average DAR ratio of polynucleic acid molecules to antibodies is about 4 or more. In some cases, the average DAR ratio of polynucleic acid molecules to antibodies is about 5 or more. In some cases, the average DAR ratio of polynucleic acid molecules to antibodies is about 6 or more. In some cases, the average DAR ratio of polynucleic acid molecules to antibodies is about 7 or more. In some cases, the average DAR ratio of polynucleic acid molecules to antibodies is about 8 or more. In some cases, the average DAR ratio of the polynucleic acid molecules to the antibodies is about 9 or greater. In some cases, the average DAR ratio of the polynucleic acid molecules to the antibodies is about 10 or greater. In some cases, the average DAR ratio of the polynucleic acid molecules to the antibodies is about 11 or greater. In some cases, the average DAR ratio of the polynucleic acid molecules to the antibodies is about 12 or greater.

[0046] In some cases, the average DAR ratio of the polynucleic acid molecules to antibody A is about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16. In some cases, the average DAR ratio of the polynucleic acid molecules to the antibody is about 1. In some cases, the average DAR ratio of the polynucleic acid molecules to the antibody is about 2. In some cases, the average DAR ratio of the polynucleic acid molecules to the antibody is about 3. In some cases, the average DAR ratio of the polynucleic acid molecules to the antibody is about 4. In some cases, the average DAR ratio of the polynucleic acid molecules to the antibody is about 5. In some cases, the average DAR ratio of the polynucleic acid molecules to the antibody is about 6. In some cases, the average DAR ratio of the polynucleic acid molecules to the antibody is about 7. In some cases, the average DAR ratio of the polynucleic acid molecules to the antibody is about 8. In some cases, the average DAR ratio of the polynucleic acid molecules to the antibody is about 9. In some cases, the average DAR ratio of the polynucleic acid molecules to the antibody is about 10. In some cases, the average DAR ratio of the polynucleic acid molecules to the antibody is about 11. In some cases, the average DAR ratio of the polynucleic acid molecules to the antibodies is about 12. In some cases, the average DAR ratio of the polynucleic acid molecules to the antibodies is about 13. In some cases, the average DAR ratio of the polynucleic acid molecules to the antibodies is about 14. In some cases, the average DAR ratio of the polynucleic acid molecules to the antibodies is about 15. In some cases, the average DAR ratio of the polynucleic acid molecules to the antibodies is about 16.

[0047] In some cases, the average DAR ratio of the polynucleic acid molecules to the antibodies is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16. In some cases, the average DAR ratio of the polynucleic acid molecules to the antibodies is 1. In some cases, the average DAR ratio of the polynucleic acid molecules to the antibodies is 2. In some cases, the average DAR ratio of the polynucleic acid molecules to the antibodies is 4. In some cases, the average DAR ratio of the polynucleic acid molecules to the antibodies is 6. In some cases, the average DAR ratio of the polynucleic acid molecules to the antibodies is 8. In some cases, the average DAR ratio of the polynucleic acid molecules to the antibodies is 12. In some cases, the average DAR ratio of the polynucleic acid molecules to the antibodies is 16.

[0048] In some cases, the average DAR ratio of the polynucleic acid molecules to the antibody is in the range of 1.5-2.5, 2.5-3.5, 3.5-4.5, 4.5-5.5, 5.5-6.5, 6.5-7.5, 7.5-8.5, 8.5-9.5, 9.5-10.5, 10.5-11.5, 11.5-12.5, 12.5-13.5, 13.5-14.5, 14.5-15.5, 15.5-16.5 or 16.5-17.5. In some cases, the average DAR ratio of the polynucleic acid molecules to the antibody is in the range of 1.5-2.5. In some cases, the average DAR ratio of the polynucleic acid molecules to the antibody is in the range of 2.5-3.5. In some cases, the average DAR ratio of the polynucleic acid molecules to the antibody is in the range of 3.5-4.5. In some cases, the average DAR ratio of polynucleic acid molecules to antibodies ranges from 4.5 to 5.5. In some cases, the average DAR ratio of polynucleic acid molecules to antibodies ranges from 5.5 to 6.5. In some cases, the average DAR ratio of polynucleic acid molecules to antibodies ranges from 6.5 to 7.5. In some cases, the average DAR ratio of polynucleic acid molecules to antibodies ranges from 7.5 to 8.5. In some cases, the average DAR ratio of polynucleic acid molecules to antibodies ranges from 8.5 to 9.5. In some cases, the average DAR ratio of polynucleic acid molecules to antibodies ranges from 9.5 to 10.5. In some cases, the average DAR ratio of polynucleic acid molecules to antibodies ranges from 10.5 to 11.5. In some cases, the average DAR ratio of polynucleic acid molecules to antibody A ranges from 11.5 to 12.5. In some cases, the average DAR ratio of polynucleic acid molecules to antibodies ranges from 12.5 to 13.5. In some cases, the average DAR ratio of polynucleic acid molecules to antibodies ranges from 13.5 to 14.5. In some cases, the average DAR ratio of polynucleic acid molecules to antibodies ranges from 14.5 to 15.5. In some cases, the average DAR ratio of polynucleic acid molecules to antibodies ranges from 15.5 to 16.5. In some cases, the average DAR ratio of polynucleic acid molecules to antibodies ranges from 16.5 to 17.5.

[0049] In some cases, compared with a conjugate comprising a polynucleic acid molecule without an antibody, a conjugate comprising a polynucleic acid molecule and an antibody has improved activity. In some cases, the improved activity causes enhanced biologically relevant functions, such as improved stability, affinity, combination, functional activity, and efficacy in treating or preventing disease states. In some cases, the disease state is the result of one or more mutant exons of a gene. In some cases, compared with a conjugate comprising a polynucleic acid molecule without an antibody, a conjugate comprising a polynucleic acid molecule and an antibody causes an increase in exon skipping of one or more mutant exons. In some cases, compared with a conjugate comprising a polynucleic acid molecule without an antibody, exon skipping increases in a conjugate comprising a polynucleic acid molecule and an antibody A by at least or about 5%, 10%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or more than 95%.

[0050] PMO molecules in PMO-antibody conjugates

[0051] In some aspects, the polynucleic acid is an antisense oligonucleotide (ASO) or a PMO molecule. In some aspects, the antibody-polynucleic acid conjugate is an ASO-antibody conjugate. In some aspects, the antibody-polynucleic acid conjugate is a PMO-antibody conjugate. In some aspects, the PMO molecule in the PMO-antibody conjugate described herein induces exon 44 skipping to induce changes in incorrectly spliced ​​mRNA transcripts. In some cases, the PMO molecule restores the translation reading frame of dystrophin by changing the incorrectly spliced ​​mRNA transcript. In some cases, the PMO molecule produces a functional and truncated dystrophin by restoring the translation reading frame of dystrophin.

[0052] In some aspects, the polynucleic acid molecule is conjugated to an antibody for delivery to a site of interest. In some cases, the PMO molecule is conjugated to an antibody. In some cases, the PMO molecule is conjugated to an antibody for delivery to a site of interest.

[0053] In some aspects, the PMO molecule is conjugated to an antibody for delivery to muscle cells. In some cases, the PMO molecule for skipping exon 44 is conjugated to an antibody. In some cases, the PMO molecule for skipping exon 44 is conjugated to an antibody for delivery to muscle cells.

[0054] In some cases, the antibody is conjugated to at least one PMO molecule. In some cases, the antibody is conjugated to at least one PMO molecule to form a PMO-antibody conjugate. In some aspects, the antibody is conjugated to the 5' end of the PMO molecule, the 3' end of the PMO molecule, an internal site on the PMO molecule, or any combination thereof. In some cases, the antibody is conjugated to at least two PMO molecules. In some cases, the antibody is conjugated to at least 2, 3, 4, 5, 6, 7, 8 or more PMO molecules.

[0055] In some cases, the PMO molecule in the PMO-antibody conjugate targets the pre-mRNA sequence of the DMD gene and hybridizes with it. In some cases, the PMO molecule targets the splicing site of exon 44 of the pre-mRNA sequence of the DMD gene and hybridizes with it. In some cases, the PMO molecule targets the cis-regulatory element of exon 44 of the pre-mRNA sequence of the DMD gene and hybridizes with it. In some cases, the PMO molecule targets the trans-regulatory element of the exon of the pre-mRNA sequence of the DMD gene and hybridizes with it. In some cases, the PMO molecule targets the exon splicing enhancer or intron splicing enhancer of exon 44 of the pre-mRNA sequence of the DMD gene. In some cases, the PMO molecule targets the exon splicing silencer or intron splicing silencer of exon 44 of the pre-mRNA sequence of the DMD gene and hybridizes with it. In some cases, the PMO molecule targets the receptor site of exon 44 of the pre-mRNA sequence of the DMD gene and hybridizes with it.

[0056] In some cases, the PMO molecule in the PMO-antibody conjugate targets a sequence found in an intron or exon of the pre-mRNA sequence of the DMD gene and hybridizes with it. For example, the PMO molecule targets a sequence found in exon 44 of the pre-mRNA sequence of the DMD gene that mediates the splicing of the exon and hybridizes with it. In some cases, the PMO molecule targets the exon recognition sequence of the pre-mRNA sequence of the DMD gene. In some cases, the PMO molecule targets the sequence upstream of the exon of the pre-mRNA sequence of the DMD gene. In some cases, the PMO molecule targets the sequence downstream of the exon of the pre-mRNA sequence of the DMD gene.

[0057] As described above, PMO molecules target improperly processed mRNA transcripts that cause neuromuscular diseases or disorders. In some instances, the neuromuscular disease or disorder is Duchenne muscular dystrophy or Becker muscular dystrophy.

[0058] In some cases, the polynucleic acid molecule (e.g., PMO molecule, antisense oligonucleotide, etc.) targets a region (sequence) adjacent to a mutant exon. In another case, if there is a mutation in exon 44, the polynucleic acid molecule targets a sequence in exon 44 of the pre-mRNA sequence of the DMD gene (e.g., a region within exon 44) such that exon 44 is skipped.

[0059] In some cases, the polynucleic acid molecules described herein target a region at the exon-intron junction of exon 44 of the pre-mRNA sequence of a DMD gene. In some cases, the polynucleic acid molecules described herein target a region at the exon-intron junction of exon 44 of the pre-mRNA sequence of a DMD gene.

[0060] In some cases, the PMO molecule in the PMO-antibody conjugate hybridizes to a target region at the 5' intron-exon junction or the 3' exon-intron junction of exon 44 of the pre-mRNA of the DMD gene.

[0061] In some cases, the polynucleic acid molecule hybridizes to a target region at the 5' intron-exon junction of exon 44 of the pre-mRNA of the DMD gene.

[0062] In some cases, the PMO molecule hybridizes to a target region at the 3' exon-intron junction of exon 44 of the pre-mRNA of the DMD gene.

[0063] In some cases, the PMO molecule in the PMO-antibody conjugates described herein targets a splice site of exon 44 of the pre-mRNA of a DMD gene. In some cases, the PMO molecule in the PMO-antibody conjugates described herein targets a splice site of exon 44 of the pre-mRNA of a DMD gene. As used herein, splice sites include canonical splice sites, cryptic splice sites, or alternative splice sites that can induce insertions, deletions, duplications, or changes in incorrectly spliced ​​mRNA transcripts to induce exon 44 skipping.

[0064] In some cases, the PMO molecules in the PMO-antibody conjugates hybridize to target regions near exon-intron junctions. In some cases, the PMO molecules described herein target exon 44 upstream (or 5') of the pre-mRNA of the DMD gene at least 1000 nucleotides (nt), 500nt, 400nt, 300nt, 200nt, 100nt, 80nt, 60nt, 50nt, 40nt, 30nt, 20nt, 10nt or 5nt regions. In some cases, the PMO molecules described herein target exon 44 upstream (or 5') of the pre-mRNA of the DMD gene at least 1000nt, 500nt, 400nt, 300nt, 200nt, 100nt, 80nt, 60nt, 50nt, 40nt, 30nt, 20nt, 10nt or 5nt regions.

[0065] In some cases, the PMO molecule in the PMO-antibody conjugate hybridizes to a target region downstream (or 3') of exon 44 of the pre-mRNA of the DMD gene. In some cases, the polynucleic acid molecule hybridizes to a target region about 5, 10, 15, 20, 50, 100, 200, 300, 400, or 500 nt downstream (or 3') of exon 44 of the pre-mRNA of the DMD gene.

[0066] In some cases, the PMO molecule in the PMO-antibody conjugates described herein targets an internal region within exon 44 of the pre-mRNA of the DMD gene.

[0067] In some aspects, the PMO molecules in the PMO-antibody conjugates described herein target a partially spliced ​​mRNA sequence comprising exon 44 of the pre-mRNA of the DMD gene. In some cases, the PMO molecules hybridize to a target region upstream (or 5') of exon 44 of the pre-mRNA of the DMD gene. In some cases, the PMO molecules hybridize to a target region upstream (or 5') of about 5, 10, 15, 20, 50, 100, 200, 300, 400 or 500bp of the pre-mRNA of the DMD gene. In some cases, the PMO molecules hybridize to a target region downstream (or 3') of exon 44 of the pre-mRNA of the DMD gene. In some cases, the PMO molecules hybridize to a target region downstream (or 3') of about 5, 10, 15, 20, 50, 100, 200, 300, 400 or 500bp of the pre-mRNA of the DMD gene.

[0068] In some cases, the PMO molecule hybridizes to a target region within exon 44 of the pre-mRNA of the DMD gene. In some cases, the PMO molecule hybridizes to a target region at the 5' intron-exon 44 junction or the 3' exon 44-intron junction of the pre-mRNA of the DMD gene.

[0069] In some aspects, the PMO molecule comprises a sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to a sequence selected from SEQ ID NOs: 100-133.

[0070] In some aspects, the PMO molecule comprises a core sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to a sequence selected from SEQ ID NOs: 100-133.

[0071] In some aspects, the PMO molecule in the PMO-antibody conjugate comprises at least 10, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more consecutive bases of a sequence selected from SEQ ID NOs: 100-133. In some cases, the PMO molecule further comprises 1, 2, 3 or 4 mismatches or no more than 1, 2, 3 or 4 mismatches with a sequence selected from SEQ ID NOs: 100-133.

[0072] Tables 1 and 10 list the PMO molecules of SEQ ID NOs: 100-133.

[0073] Table 1

[0074]

[0075] Table 10

[0076]

[0077] In some aspects, the polynucleic acid molecule is an antisense oligonucleotide (ASO) or a phosphorodiamidate morpholino oligonucleotide (PMO) molecule.

[0078] In some aspects, the PMO molecule is about 10 to about 50 nucleotides in length. In some cases, the PMO molecule is about 10 to about 30, about 15 to about 30, about 18 to about 30, about 18 to about 25, about 18 to about 24, about 19 to about 23, about 19 to about 30, about 19 to about 25, about 19 to about 24, about 19 to about 23, about 20 to about 30, about 20 to about 25, about 20 to about 24, about 20 to about 23, or about 20 to about 22 nucleotides in length.

[0079] In some aspects, the polynucleic acid molecule comprises natural, synthetic or artificial nucleotide analogs or bases. In some cases, the ASO molecule or PMO molecule in the polynucleic acid molecule-antibody conjugate (e.g., PMO-antibody conjugate or ASO-antibody conjugate) comprises a combination of DNA, RNA and / or nucleotide analogs. In some cases, the synthetic or artificial nucleotide analogs or bases comprise modifications at one or more of the ribose moiety, the phosphate moiety, the nucleoside moiety, or a combination thereof.

[0080] In some aspects, nucleotide analogs or artificial nucleotide bases include nucleic acids with modifications at the 2' hydroxyl groups of the ribose moiety. In some cases, the modification includes H, OR, R, halo, SH, SR, NH2, NHR, NR2 or CN, wherein R is an alkyl moiety. Exemplary alkyl moieties include but are not limited to halogen, sulfur, thiol, thioether, thioester, amine (primary, secondary or tertiary amine), amide, ether, ester, alcohol and oxygen. In some cases, the alkyl moiety further includes modification. In some cases, the modification includes azo groups, keto groups, aldehyde groups, carboxyl groups, nitro groups, nitroso groups, nitrile groups, heterocycles (for example, imidazoles, hydrazino or hydroxyamino) groups, isocyanates or cyanate groups, or sulfur-containing groups (for example, sulfoxides, sulfones, sulfides or disulfides). In some cases, the alkyl moiety further includes hetero substitution. In some cases, the carbon of the heterocyclic group is replaced by nitrogen, oxygen or sulfur. In some cases, heterocyclic substitution includes but is not limited to morpholino, imidazoles and pyrrolidino.

[0081] In some cases, the modification at the 2' hydroxyl group is a 2'-O-methyl modification or a 2'-O-methoxyethyl (2'-O-MOE) modification. In some cases, the 2'-O-methyl modification adds a methyl group to the 2' hydroxyl group of the ribose moiety, while the 2'O-methoxyethyl modification adds a methoxyethyl group to the 2' hydroxyl group of the ribose moiety. Exemplary chemical structures of 2'-O-methyl modifications of adenosine molecules and 2'O-methoxyethyl modifications of uridine are shown below.

[0082]

[0083] In some cases, the modification at the 2' hydroxyl group is a 2'-O-aminopropyl modification, wherein an extended amine group comprising a propyl linker binds the amine group to the 2' oxygen. In some cases, the modification neutralizes the overall negative charge of the oligonucleotide molecule derived from the phosphate ester by introducing a positive charge from the amine group per sugar, and improves cellular uptake properties due to its zwitterionic properties. An exemplary chemical structure of a 2'-O-aminopropyl nucleoside phosphoramidite is shown below.

[0084]

[0085] In some cases, the modification at the 2' hydroxyl group is a locked or bridged ribose modification (e.g., locked nucleic acid or LNA), in which an oxygen molecule bound to the 2' carbon is linked to the 4' carbon via a methylene group, thereby forming a 2'-C, 4'-C-oxy-methylene linked bicyclic ribonucleotide monomer. An exemplary representation of the chemical structure of LNA is shown below. The representation shown on the left highlights the chemical connectivity of the LNA monomer. The representation shown on the right highlights the locked 3'-endo (3E) conformation of the furanose ring of the LNA monomer.

[0086]

[0087] In some cases, the modification at the 2' hydroxyl group includes ethylene nucleic acid (ENA), such as 2'-4'-ethylene bridged nucleic acid, which locks the sugar conformation into a C3'-endosugar fold (puckering) conformation. ENA is part of the modified nucleic acid class of bridged nucleic acids, which also includes LNA. Exemplary chemical structures of ENA and bridged nucleic acids are shown below.

[0088]

[0089] In some aspects, additional modifications at the 2' hydroxyl group include 2'-deoxy, 2'-deoxy-2'-fluoro, 2'-O-aminopropyl (2'-O-AP), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'-O-dimethylaminopropyl (2'-O-DMAP), 2'-O-dimethylaminoethoxyethyl (2'-O-DMAEOE), or 2'-ON-methylacetamido (2'-O-NMA).

[0090] In some aspects, the nucleotide analogs comprise modified bases such as, but not limited to, 5-propynyl uridine, 5-propynyl cytidine, 6-methyladenine, 6-methylguanine, N,N,-dimethyladenine, 2-propyladenine, 2-propylguanine, 2-aminoadenine, 1-methylinosine, 3-methyluridine, 5-methylcytidine, 5-methyluridine and other nucleotides with modifications at the 5 position, 5-(2-amino)propyl uridine, 5-halocytidine, 5-halouridine, 4-acetyl cytidine, 1-methyladenosine, 2-methyladenosine, 3-methylcytidine, 6-methyluridine, 2-methylguanosine, 7-methylguanosine, 2,2-dimethylguanosine, 5-methylaminoethyl uridine, 5-methyloxyuridine, deaza nucleotides such as 7-deaza-adenosine, 6-azo uridine, 6-azocytidine, 6-azothymidine), 5-methyl-2-thiouridine, other thiobases such as 2-thiouridine and 4-thiouridine and 2-thiocytidine, dihydrouridine, pseudouridine, braided uridine, archaeosin, naphthyl and substituted naphthyl groups, any O-alkylated and N-alkylated purine and pyrimidine such as N6-methyladenosine, 5-methylcarbonylmethyluridine, uridine 5-hydroxyacetic acid, pyridin-4-one, pyridin-2-one, phenyl and modified phenyl groups such as aminophenol or 2,4,6-trimethoxybenzene, modified cytosine that acts as a G clamp nucleotide, 8-substituted adenine and guanine, 5-substituted uracil and thymine, azapyrimidine, carboxyhydroxyalkyl nucleotides, carboxyalkylaminoalkyl nucleotides, and alkylcarbonylalkylated nucleotides. Modified nucleotides also include those nucleotides whose sugar moieties are modified, and nucleotides having sugars other than ribose moieties or their analogs. For example, in some cases, the sugar moiety is or is based on mannose, arabinose, glucopyranose, galactopyranose, 4'-thioribose and other sugars, heterocycles or carbocycles. The term nucleotide also includes universal bases known in the art. For example, universal bases include, but are not limited to, 3-nitropyrrole, 5-nitroindole or agarone.

[0091] In some aspects, nucleotide analogs further include morpholino, peptide nucleic acid (PNA), methylphosphonate nucleotides, thiolphosphonate nucleotides, 2'-fluoro N3-P5'-phosphoramidites, 1', 5'-anhydrohexitol nucleic acid (HNA) or a combination thereof. Morpholino or phosphorodiamidate morpholino oligomers (PMOs) include synthetic molecules whose structures mimic natural nucleic acid structures but deviate from normal sugar and phosphate structures. In some cases, the five-membered ribose ring is replaced by a six-membered morpholino ring containing four carbons, a nitrogen and an oxygen. In some cases, the ribose monomer is connected by a phosphorodiamidate group rather than a phosphate group. In such a case, the main chain changes to remove all positive and negative charges so that the morpholino neutral molecule can pass through the cell membrane without the aid of a cell delivery agent, such as a cell delivery agent used by a charged oligonucleotide.

[0092]

[0093] In some aspects, peptide nucleic acids (PNAs) contain no sugar rings or phosphate linkages, and the bases are attached and appropriately spaced by oligoglycine-like molecules, thus eliminating backbone charge.

[0094]

[0095] In some aspects, one or more modifications are optionally present at the internucleotide linkage. In some cases, the modified internucleotide linkage includes, but is not limited to, phosphorothioate, phosphorodithioate, methylphosphonate, 5'-alkylenephosphonate, 5'-methylphosphonate, 3'-alkylenephosphonate, boron trifluoride, 3'-5' linkage or 2'-5' linkage boranephosphate and selenophosphate, phosphotriester, thiocarbonylalkylphosphotriester, hydrogenphosphonate linkage, alkylphosphonate, alkylthiophosphonate, arylthiophosphonate, phosphoselenate, diselenide, phosphinate, phosphoamide, 3'-alkylphosphoamide, aminoalkylphosphoamide, thiocarbonylphosphoamide, piperazine phosphate, thiophenyl Amine phosphate, aniline phosphate, ketone, sulfone, sulfonamide, carbonate, carbamate, methylene imino, methylene dimethyl imino, methylal, thioformal, oxime, methylene imino, methylene azo imino, thioamide, linkage with ribose acetyl group, aminoethylglycine, silyl or siloxane linkage, with or without heteroatom such as 1 to 10 carbon alkyl or cycloalkyl linkage (it is saturated or unsaturated and / or substituted and / or contains heteroatom), linkage with morpholino structure, amide, polyamide (wherein base is directly or indirectly attached to the nitrogen of main chain) and combination thereof.Phosphorothioate antisense oligonucleotide (PS ASO) is the antisense oligonucleotide comprising thiophosphate linkage.Exemplary PS ASO is as follows.

[0096]

[0097] In some cases, the modification is a methyl or thiol modification, such as a methylphosphonate or thiolphosphonate modification. Exemplary thiolphosphonate nucleotides (left) and methylphosphonate nucleotides (right) are shown below.

[0098]

[0099] In some cases, modified nucleotides include, but are not limited to, 2'-fluoro N3-P5'-phosphoramidites as shown below:

[0100]

[0101] In some cases, modified nucleotides include, but are not limited to, hexitol nucleic acids (or 1',5'-anhydrohexitol nucleic acids (HNA)) as shown below:

[0102]

[0103] In some aspects, the nucleotide analogs or artificial nucleotide bases described above include 5'-vinylphosphonate modified nucleotides having a modification at the 5' hydroxyl group of the ribose moiety. In some aspects, the 5'-vinylphosphonate modified nucleotides are selected from the nucleotides provided below, wherein X is O or S; and B is a heterocyclic base moiety.

[0104]

[0105] In some cases, the modification at the 2' hydroxyl group is a 2'-O-aminopropyl modification, wherein an extended amine group comprising a propyl linker binds the amine group to the 2' oxygen. In some cases, this modification neutralizes the overall negative charge of the oligonucleotide molecule derived from the phosphate by introducing a positive charge from the amine group per sugar and improves cellular uptake properties due to its zwitterionic nature.

[0106] In some cases, the 5'-vinylphosphonate modified nucleotide is further modified at the 2' hydroxyl group by a locked or bridged ribose modification (e.g., locked nucleic acid or LNA), wherein the oxygen molecule bound to the 2' carbon is linked to the 4' carbon through a methylene group, thereby forming a 2'-C, 4'-C-oxy-methylene linked bicyclic ribonucleotide monomer. An exemplary representation of the chemical structure of the 5'-vinylphosphonate modified LNA is shown below, wherein X is O or S; B is a heterocyclic base moiety; and J is an internucleotide linking group that is linked to an adjacent nucleotide in a polynucleotide.

[0107]

[0108] In some aspects, additional modifications at the 2' hydroxyl group include 2'-deoxy, 2'-deoxy-2'-fluoro, 2'-O-aminopropyl (2'-O-AP), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'-O-dimethylaminopropyl (2'-O-DMAP), 2'-O-dimethylaminoethoxyethyl (2'-O-DMAEOE), or 2'-ON-methylacetamido (2'-O-NMA).

[0109] In some aspects, the nucleotide analogs comprise modified bases such as, but not limited to, 5-propynyl uridine, 5-propynyl cytidine, 6-methyladenine, 6-methylguanine, N,N,-dimethyladenine, 2-propyladenine, 2-propylguanine, 2-aminoadenine, 1-methylinosine, 3-methyluridine, 5-methylcytidine, 5-methyluridine and other nucleotides with modifications at the 5 position, 5-(2-amino)propyl uridine, 5-halocytidine, 5-halouridine, 4-acetyl cytidine, 1-methyladenosine, 2-methyladenosine, 3-methylcytidine, 6-methyluridine, 2-methylguanosine, 7-methylguanosine, 2,2-dimethylguanosine, 5-methylaminoethyl uridine, 5-methyloxyuridine, deaza nucleotides such as 7-deaza-adenosine, 6- uridine, 6-azocytidine or 6-azothymidine), 5-methyl-2-thiouridine, other thiobases such as 2-thiouridine, 4-thiouridine and 2-thiouridine, dihydrouridine, pseudouridine, quercetin, archaeopurine, naphthyl and substituted naphthyl groups, any O-alkylated and N-alkylated purine and pyrimidine such as N6-methyladenosine, 5-methylcarbonylmethyluridine, uridine 5-hydroxyacetic acid, pyridin-4-one or pyridin-2-one, phenyl and modified phenyl groups such as aminophenol or 2,4,6-trimethoxybenzene, modified cytosine that acts as a G clamp nucleotide, 8-substituted adenine and guanine, 5-substituted uracil and thymine, azapyrimidine, carboxyhydroxyalkyl nucleotides, carboxyalkylaminoalkyl nucleotides, and alkylcarbonylalkylated nucleotides. 5'-vinylphosphonate modified nucleotides may also include those in which the sugar moiety is modified, and 5'-vinylphosphonate modified nucleotides having a sugar other than a ribosyl group or an analog thereof. For example, in some cases, the sugar moiety is or is based on mannose, arabinose, glucopyranose, galactopyranose, 4'-thioribose and other sugars, heterocycles or carbocycles. The term nucleotide also encompasses universal bases known in the art. For example, universal bases include, but are not limited to, 3-nitropyrrole, 5-nitroindole or agarone.

[0110] In some aspects, the nucleotide analogs modified by 5'-vinylphosphonate further include morpholino, peptide nucleic acid (PNA), methylphosphonate nucleotides, thiolphosphonate nucleotides, 2'-fluoro N3-P5'-phosphoramidites or 1', 5'-anhydrohexitol nucleic acid (HNA).Morpholino or phosphorodiamidate morpholino oligomers (PMO) include synthetic molecules whose structures simulate natural nucleic acid structures but deviate from normal sugar and phosphate structures.In some cases, the five-membered ribose ring is replaced by a six-membered morpholino ring containing four carbons, a nitrogen and an oxygen.In some cases, the ribose monomer is connected by a phosphorodiamidate group rather than a phosphate group.In such a case, the main chain changes to remove all positive and negative charges so that the morpholino neutral molecules can pass through the cell membrane without the need for a cell delivery agent, such as a cell delivery agent used by a charged oligonucleotide.Non-limiting examples of morpholino oligonucleotides modified by 5'-vinylphosphonate are shown below, wherein B is a heterocyclic base moiety.

[0111]

[0112] In some aspects, the 5'-vinylphosphonate modified morpholino or PMO described above is a PMO comprising a positive charge or a cationic charge. In some cases, PMO is PMOplus (Sarepta). PMOplus refers to a phosphorodiamidate morpholino oligomer comprising any number of (1-piperazinyl) phosphinyloxy linkages, (1-(4-(ω-guanidino-alkanoyl))-piperazinyl) phosphinyloxy linkages (e.g., as described in PCT Publication No. WO2008 / 036127). In some cases, PMO is a PMO described in U.S. Patent No. 7,943,762.

[0113] In some aspects, the morpholino or PMO described above is PMO-X (Sarepta). In some cases, PMO-X refers to a phosphorodiamidate morpholino oligomer comprising at least one linkage or at least one of the disclosed terminal modifications, such as those disclosed in PCT Publication No. WO2011 / 150408 and U.S. Publication No. 2012 / 0065169.

[0114] In some aspects, the morpholino or PMO described above is a PMO as described in Table 5 of US Publication No. 2014 / 0296321.

[0115] An exemplary representation of the chemical structure of a 5'-vinylphosphonate modified nucleic acid is shown below, where X is O or S; B is a heterocyclic base moiety; and J is an internucleotide linkage.

[0116]

[0117] In some aspects, one or more modifications of the 5'-vinylphosphonate modified oligonucleotide optionally occur at the internucleotide linkage. In some cases, the modified internucleotide linkage includes, but is not limited to, phosphorothioate; phosphorodithioate; methylphosphonate; 5'-alkylenephosphonate; 5'-methylphosphonate; 3'-alkylenephosphonate; boron trifluoride; 3'-5' linkage or 2'-5' linkage boranophosphate and selenophosphate; phosphotriester; thiocarbonylalkylphosphotriester; hydrogenphosphonate linkage; alkylphosphonate; alkylthiophosphonate; arylthiophosphonate; phosphoselenate; phosphodiselenate; phosphinate; phosphoamide; 3'-alkylphosphoamide; aminoalkylphosphoamide; thiocarbonylphosphoamide; piperazine phosphate; thiophenyl Amine phosphates; aniline phosphates; ketones; sulfones; sulfonamides; carbonates; carbamates; methylenehydrazino; methylenedimethylhydrazino; methylal; thiomethylal; oximes; methyleneimino; methylenemethylimino; thioamides; linkages with a ribose acetyl group; aminoethylglycine; silyl or siloxane linkages; alkyl or cycloalkyl linkages of, for example, 1 to 10 carbons with or without heteroatoms (which are saturated or unsaturated and / or substituted and / or contain heteroatoms); linkages, amides or polyamides with a morpholino structure (in which the base is attached directly or indirectly to the nitrogen of the backbone); and combinations thereof.

[0118] In some cases, the modification is a methyl or thiol modification, such as a methylphosphonate or thiolphosphonate modification. Exemplary thiolphosphonate nucleotides (left), phosphorodithioate (middle), and methylphosphonate nucleotides (right) are shown below.

[0119]

[0120] In some cases, 5'-vinylphosphonate modified nucleotides include, but are not limited to, phosphoramidites as shown below:

[0121]

[0122] In some cases, the modified internucleotide linkage is a phosphorodiamidate linkage. Non-limiting examples of phosphorodiamidate linkages with morpholino systems are shown below.

[0123]

[0124] In some cases, the modified internucleotide linkage is a methylphosphonate linkage. Non-limiting examples of methylphosphonate linkages are shown below.

[0125]

[0126] In some cases, the modified internucleotide linkage is an amide linkage. Non-limiting examples of amide linkages are shown below.

[0127]

[0128] In some cases, 5'-vinylphosphonate modified nucleotides include, but are not limited to, modified nucleic acids as shown below:

[0129]

[0130] wherein B is a heterocyclic base moiety.

[0131]

[0132] wherein B is a heterocyclic base moiety;

[0133] R4 and R5 are independently selected from hydrogen, halogen, alkyl or alkoxy; and J is an internucleotide linking group that links to adjacent nucleotides in the polynucleotide.

[0134]

[0135] wherein B is a heterocyclic base moiety;

[0136] R6 is selected from hydrogen, halogen, alkyl or alkoxy; and

[0137] J is an internucleotide linker group that links adjacent nucleotides in the polynucleotide.

[0138]

[0139] wherein B is a heterocyclic base moiety; and

[0140] J is an internucleotide linker group that links adjacent nucleotides in the polynucleotide.

[0141]

[0142] wherein B is a heterocyclic base moiety; and

[0143] J is an internucleotide linker group that links adjacent nucleotides in the polynucleotide.

[0144]

[0145] wherein B is a heterocyclic base moiety;

[0146] R6 is selected from hydrogen, halogen, alkyl or alkoxy; and

[0147] J is an internucleotide linker group that links adjacent nucleotides in the polynucleotide.

[0148] In some aspects, the PMO molecules in the PMO-antibody conjugates comprise a plurality of phosphorodiamidate morpholino oligomers or a plurality of non-natural nucleotides modified with peptide nucleic acids, and optionally comprise at least one inverted abasic portion. In some cases, the PMO molecules comprise at least 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more non-natural nucleotides modified with phosphorodiamidate morpholino oligomers. In some cases, the PMO molecules comprise 100% non-natural nucleotides modified with phosphorodiamidate morpholino oligomers.

[0149] In some cases, the PMO molecules in the PMO-antibody conjugate comprise at least one of about 5% to about 100% modification, about 10% to about 100% modification, about 20% to about 100% modification, about 30% to about 100% modification, about 40% to about 100% modification, about 50% to about 100% modification, about 60% to about 100% modification, about 70% to about 100% modification, about 80% to about 100% modification, and about 90% to about 100% modification.

[0150] In some cases, one or more of the artificial nucleotide analogs described herein are resistant to the following nucleases compared to natural polynucleic acid molecules: for example, ribonucleases (e.g., RNase H), deoxyribonucleases (e.g., DNase), or exonucleases (e.g., 5'-3' exonucleases and 3'-5' exonucleases). In some cases, the artificial nucleotide analogs described herein are resistant to 2'-O-methyl, 2'-O-methoxyethyl (2'-O-MOE), 2'-O-aminopropyl, 2'-deoxy, 2'-deoxy-2'-fluoro, 2'-O-aminopropyl (2'-O-AP), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'-O-dimethylaminopropyl (2'-O-DMAP), 2'-O-dimethylaminoethyloxyethyl (2'-O-DMAEOE), or 2'-O-methyl. Artificial nucleotide analogs modified with '-ON-methylacetamido (2'-O-NMA), LNA, ENA, PNA, HNA, morpholino, methylphosphonate nucleotides, thiolphosphonate nucleotides, 2'-fluoro N3-P5'-phosphoramidites, or a combination thereof are resistant to the following nucleases: for example, ribonucleases (e.g., RNase H), deoxyribonucleases (e.g., DNA enzymes), or exonucleases (e.g., 5'-3' exonucleases and 3'-5' exonucleases). In some cases, 2'-O-methyl modified polynucleic acid molecules are resistant to nucleases (e.g., RNase H, DNA enzymes, 5'-3' exonucleases, or 3'-5' exonucleases). In some cases, 2'O-methoxyethyl (2'-O-MOE) modified polynucleic acid molecules are resistant to nucleases (e.g., RNase H, DNA enzymes, 5'-3' exonucleases, or 3'-5' exonucleases). In some cases, the polynucleic acid molecules modified by 2'-O-aminopropyl have nuclease resistance (e.g., RNase H, DNA enzyme, 5'-3' exonuclease or 3'-5' exonuclease resistance). In some cases, the polynucleic acid molecules modified by 2'-deoxy have nuclease resistance (e.g., RNase H, DNA enzyme, 5'-3' exonuclease or 3'-5' exonuclease resistance). In some cases, the polynucleic acid molecules modified by 2'-deoxy-2'-fluoro have nuclease resistance (e.g., RNase H, DNA enzyme, 5'-3' exonuclease or 3'-5' exonuclease resistance). In some cases, the polynucleic acid molecules modified by 2'-O-aminopropyl (2'-O-AP) have nuclease resistance (e.g., RNase H, DNA enzyme, 5'-3' exonuclease or 3'-5' exonuclease resistance). In some cases, the 2'-O-dimethylaminoethyl (2'-O-DMAOE) modified polynucleic acid molecule is nuclease resistant (eg, RNase H, DNase, 5'-3' exonuclease, or 3'-5' exonuclease resistant).In some cases, 2'-O-dimethylaminopropyl (2'-O-DMAP) modified polynucleic acid molecules have nuclease resistance (e.g., RNase H, DNA enzyme, 5'-3' exonuclease or 3'-5' exonuclease resistance). In some cases, 2'-O-dimethylaminoethyloxyethyl (2'-O-DMAEOE) modified polynucleic acid molecules have nuclease resistance (e.g., RNase H, DNA enzyme, 5'-3' exonuclease or 3'-5' exonuclease resistance). In some cases, 2'-ON-methylacetamido (2'-O-NMA) modified polynucleic acid molecules have nuclease resistance (e.g., RNase H, DNA enzyme, 5'-3' exonuclease or 3'-5' exonuclease resistance). In some cases, LNA modified polynucleic acid molecules have nuclease resistance (e.g., RNase H, DNA enzyme, 5'-3' exonuclease or 3'-5' exonuclease resistance). In some cases, the polynucleic acid molecules modified by ENA have nuclease resistance (e.g., RNase H, DNA enzyme, 5'-3' exonuclease or 3'-5' exonuclease resistance). In some cases, the polynucleic acid molecules modified by HNA have nuclease resistance (e.g., RNase H, DNA enzyme, 5'-3' exonuclease or 3'-5' exonuclease resistance). In some cases, morpholino has nuclease resistance (e.g., RNase H, DNA enzyme, 5'-3' exonuclease or 3'-5' exonuclease resistance). In some cases, the polynucleic acid molecules modified by PNA have nuclease resistance (e.g., RNase H, DNA enzyme, 5'-3' exonuclease or 3'-5' exonuclease resistance). In some cases, the polynucleic acid molecules modified by methylphosphonate nucleotides have nuclease resistance (e.g., RNase H, DNA enzyme, 5'-3' exonuclease or 3'-5' exonuclease resistance). In some cases, the polynucleic acid molecules modified with thiolphosphonate nucleotides have nuclease resistance (e.g., RNase H, DNA enzyme, 5'-3' exonuclease or 3'-5' exonuclease resistance). In some cases, the polynucleic acid molecules comprising 2'-fluoro N3-P5'-phosphoramidites have nuclease resistance (e.g., RNase H, DNA enzyme, 5'-3' exonuclease or 3'-5' exonuclease resistance). In some cases, the 5' conjugates described herein inhibit 5'-3' exonuclease cleavage. In some cases, the 3' conjugates described herein inhibit 3'-5' exonuclease cleavage.

[0151] Polynucleic acid molecule synthesis

[0152] In some aspects, polynucleic acid molecules described herein are constructed using chemical synthesis and / or enzymatic ligation reactions using procedures known in the art. For example, polynucleic acid molecules are chemically synthesized using naturally occurring nucleotides or various modified nucleotides that are designed to increase the biological stability of the molecule or to increase the physical stability of the duplex formed between the polynucleic acid molecule and the target nucleic acid. Exemplary methods include those described in U.S. Patent Nos. 5,142,047; 5,185,444; 5,889,136; 6,008,400 and 6,111,086; PCT Publication No. WO2009099942; or European Publication No. 1579015. Additional exemplary methods include those described in Griffey et al., "2'-O-aminopropyl ribonucleotides: a zwitterionic modification that enhances the exonuclease resistance and biological activity of antisense oligonucleotides," J. Med. Chem. 39(26):5100-5109 (1997)); Obika et al. "Synthesis of 2'-O,4'-C-methyleneuridine and-cytidine. Novel bicyclic nucleosides having a fixed C3,-endo sugar puckering". Tetrahedron Letters 38(50):8735 (1997); Koizumi, M. "ENA oligonucleotides as therapeutics". Current opinion in molecular therapeutics 8(2):144–149 (2006); and Abramova et al., "Novel oligonucleotide analogues based on morpholino nucleoside subunits-antisense technologies: new chemical possibilities,” Indian Journal of Chemistry 48B:1721-1726 (2009).Alternatively, the polynucleic acid molecule is biologically produced using an expression vector into which the polynucleic acid molecule has been subcloned in the antisense orientation (ie, RNA transcribed from the inserted polynucleic acid molecule will be in the antisense orientation to the target polynucleic acid molecule of interest).

[0153] In some aspects, polynucleic acid molecules are synthesized via a tandem synthesis method in which the two strands are synthesized as a single contiguous oligonucleotide fragment or strand separated by a cleavable linker, which is subsequently cleaved to provide separate fragments or strands that hybridize and allow purification of the duplex.

[0154] Other modification methods for incorporating, for example, sugar, base and phosphate modifications include: Eckstein et al., International Publication No. WO 92 / 07065; Perrault et al., Nature, 1990, 344, 565-568; Pieken et al., Science, 1991, 253, 314-317; Usman and Cedergren, Trends in Biochem. Sci., 1992, 17, 334-339; Usman et al., International Publication No. WO 93 / 15187; Sproat, U.S. Pat. No. 5,334,711 and Beigelman et al., 1995, J. Biol. Chem., 270, 25702; Beigelman et al., International PCT Publication No. WO 97 / 26270; Beigelman et al., U.S. Pat. No. 5,716,824; Usman et al., U.S. Pat. No. 5,627,053; Woolf et al., International PCT Publication No. WO 98 / 13526; Thompson et al., U.S. Serial No. 60 / 082,404 filed April 20, 1998; Karpeisky et al., 1998, Tetrahedron Lett., 39, 1131; Earnshaw and Gait, 1998, Biopolymers (Nucleic Acid Sciences), 48, 39-55; Verma and Eckstein, 1998, Annu. Rev. Biochem., 67, 99-134; and Burlina et al., 1997, Bioorg. Med. Chem., 5, 1999-2010. These publications describe general methods and strategies for determining the position of incorporation of sugar, base and / or phosphate modifications, etc., into nucleic acid molecules without modulating catalysis.

[0155] In some cases, although the polynucleic acid molecule internucleotide linkage is chemically modified using phosphorothioate, phosphorodithioate and / or 5'-methylphosphonate linkages to improve stability, excessive modification sometimes causes toxicity or reduces activity. Therefore, when designing nucleic acid molecules, in some cases, the amount of these internucleotide linkages is minimized. In such cases, the reduction in the concentration of these linkages results in reduced toxicity, increased efficacy and improved specificity of these molecules.

[0156] Antibody

[0157] In some aspects, the antibody or antigen-binding fragment thereof includes a humanized antibody or antigen-binding fragment thereof, a murine antibody or antigen-binding fragment thereof, a chimeric antibody or antigen-binding fragment thereof, a monoclonal antibody or antigen-binding fragment thereof, a monovalent Fab', a divalent Fab2, a F(ab)'3 fragment, a single-chain variable fragment (scFv), a bi-scFv, (scFv)2, a diabody, a minibody, a nanobody, a triabody, a tetrabody, a disulfide-stabilized Fv protein (dsFv), a single domain antibody (sdAb), an Ig NAR, a camelid antibody or antigen-binding fragment thereof, a bispecific antibody or antigen-binding fragment thereof, or a chemically modified derivative thereof.

[0158] In some cases, the antibody is an anti-transferrin receptor (anti-CD71) antibody or its antigen binding fragment. In some cases, the anti-transferrin receptor antibody is a humanized antibody or its antigen binding fragment. In other cases, the anti-transferrin receptor antibody is a chimeric antibody or its antigen binding fragment. In other cases, the anti-transferrin receptor antibody is a monovalent, divalent or multivalent antibody or its antigen binding fragment. In some aspects, exemplary anti-transferrin receptor antibodies or their antigen binding fragments include MAB5746 from R&D Systems, AHP858 from Bio-Rad Laboratories, A80-128A from BethylLaboratories, Inc. and T2027 from MilliporeSigma. In some aspects, anti-transferrin receptor antibodies or their antigen binding fragments include antibodies disclosed in U.S. Patent No. 10,913,800 or U.S. Patent No. 11,028,179.

[0159] In some instances, the anti-transferrin receptor antibody comprises a heavy chain variable (VH) region and a light chain variable (VL) region, wherein the VH region comprises: a HCDR1 sequence comprising, or consisting of, the sequence of SEQ ID NO: 17; a HCDR2 sequence comprising, or consisting of, the sequence of EINPIX1GRSNYAX2KFQG (SEQ ID NO: 12), wherein X1 is selected from N or Q and X2 is selected from Q or E; and a HCDR3 sequence comprising, or consisting of, the sequence of SEQ ID NO: 19.

[0160] In some aspects, the VH region of the anti-transferrin antibody comprises a HCDR1, HCDR2, and HCDR3 sequence selected from Table 2.

[0161] Table 2

[0162]

[0163] *13E4_VH2 has the same HCDR1, HCDR2 and HCDR3 sequences as the anti-transferrin receptor antibody 13E4_VH4

[0164] In some aspects, the VH region comprises: a HCDR1 sequence comprising or consisting of a sequence of SEQ ID NO: 17; a HCDR2 sequence comprising or consisting of a sequence of SEQ ID NO: 18, 20, or 21; and a HCDR3 sequence comprising or consisting of a sequence of SEQ ID NO: 19. In some cases, the VH region comprises: a HCDR1 sequence comprising or consisting of a sequence of SEQ ID NO: 17, a HCDR2 sequence comprising or consisting of a sequence of SEQ ID NO: 18, and a HCDR3 sequence comprising or consisting of a sequence of SEQ ID NO: 19. In some cases, the VH region comprises: a HCDR1 sequence comprising or consisting of a sequence of SEQ ID NO: 17, a HCDR2 sequence comprising or consisting of a sequence of SEQ ID NO: 20, and a HCDR3 sequence comprising or consisting of a sequence of SEQ ID NO: 19. In some cases, the VH region comprises: a HCDR1 sequence comprising or consisting of a sequence of SEQ ID NO: 17, a HCDR2 sequence comprising or consisting of a sequence of SEQ ID NO: 21, and a HCDR3 sequence comprising or consisting of a sequence of SEQ ID NO: 19.

[0165] In some aspects, the VL region of the anti-transferrin receptor antibody comprises: a LCDR1 sequence comprising or consisting of a sequence of RTSENIYX3NLA (SEQ ID NO: 13), a LCDR2 sequence comprising or consisting of a sequence of AX4TNLAX5 (SEQ ID NO: 14), and a LCDR3 sequence comprising or consisting of a sequence of QHFWGTPLTX6 (SEQ ID NO: 15), wherein X3 is selected from N or S, X4 is selected from A or G, X5 is selected from D or E, and X6 is present or absent, and if present, is F.

[0166] In some aspects, the VL region of the anti-transferrin receptor antibody comprises a LCDR1, LCDR2, and LCDR3 sequence selected from Table 3.

[0167] Table 3

[0168]

[0169] *13E4_VL1 has the same LCDR1, LCDR2 and LCDR3 sequences as the anti-transferrin receptor antibody 13E4_VL2

[0170] In some cases, the VL region comprises: a LCDR1 sequence comprising or consisting of a sequence of SEQ ID NO: 13, a LCDR2 sequence comprising or consisting of a sequence of SEQ ID NO: 23, 25 or 28, and a LCDR3 sequence comprising or consisting of a sequence of SEQ ID NO: 24 or 26, wherein X3 is selected from N or S.

[0171] In some cases, the VL region comprises: a LCDR1 sequence comprising or consisting of a sequence of SEQ ID NO: 22 or 27, a LCDR2 sequence comprising or consisting of a sequence of SEQ ID NO: 14, and a LCDR3 sequence comprising or consisting of a sequence of SEQ ID NO: 24 or 26, wherein X4 is selected from A or G, and X5 is selected from D or E.

[0172] In some cases, the VL region comprises: a LCDR1 sequence comprising or consisting of a sequence of SEQ ID NO: 22 or 27, a LCDR2 sequence comprising or consisting of a sequence of SEQ ID NO: 23, 25 or 28, and a LCDR3 sequence comprising or consisting of a sequence of SEQ ID NO: 15, wherein X6 is present or absent and, if present, is F.

[0173] In some cases, the VL region comprises: a LCDR1 sequence comprising or consisting of a sequence of SEQ ID NO:22, a LCDR2 sequence comprising or consisting of a sequence of AATNLAX5 (SEQ ID NO:16), and a LCDR3 sequence comprising or consisting of a sequence of SEQ ID NO:15, wherein X5 is selected from D or E, and X6 is present or absent, and if present, is F.

[0174] In some cases, the VL region comprises: a LCDR1 sequence comprising or consisting of a sequence of SEQ ID NO:22, a LCDR2 sequence comprising or consisting of a sequence of SEQ ID NO:23, and a LCDR3 sequence comprising or consisting of a sequence of SEQ ID NO:24.

[0175] In some cases, the VL region comprises: a LCDR1 sequence comprising or consisting of a sequence of SEQ ID NO:22, a LCDR2 sequence comprising or consisting of a sequence of SEQ ID NO:25, and a LCDR3 sequence comprising or consisting of a sequence of SEQ ID NO:26.

[0176] In some cases, the VL region comprises: a LCDR1 sequence comprising or consisting of a sequence of SEQ ID NO:27, a LCDR2 sequence comprising or consisting of a sequence of SEQ ID NO:28, and a LCDR3 sequence comprising or consisting of a sequence of SEQ ID NO:26.

[0177] In some aspects, the anti-transferrin receptor antibody comprises a VH region and a VL region, wherein the VH region comprises: a HCDR1 sequence comprising or consisting of a sequence of SEQ ID NO: 17; a HCDR2 sequence comprising or consisting of a sequence of SEQ ID NO: 12, wherein X1 is selected from N or Q and X2 is selected from Q or E; and a HCDR3 sequence comprising or consisting of a sequence of SEQ ID NO: 19; and the VL region comprises: a LCDR1 sequence comprising or consisting of a sequence of SEQ ID NO: 13, a LCDR2 sequence comprising or consisting of a sequence of SEQ ID NO: 14, and a LCDR3 sequence comprising or consisting of a sequence of SEQ ID NO: 15, wherein X3 is selected from N or S, X4 is selected from A or G, X5 is selected from D or E, and X6 is present or absent, and if present, is F.

[0178] In some instances, the anti-transferrin receptor antibody comprises a VH region and a VL region, wherein the VH region comprises: a HCDR1 sequence comprising or consisting of a sequence of SEQ ID NO: 17; a HCDR2 sequence comprising or consisting of a sequence of SEQ ID NO: 12, wherein X1 is selected from N or Q and X2 is selected from Q or E; and a HCDR3 sequence comprising or consisting of a sequence of SEQ ID NO: 19; and the VL region comprises: a LCDR1 sequence comprising or consisting of a sequence of SEQ ID NO: 13, a LCDR2 sequence comprising or consisting of a sequence of SEQ ID NO: 23, 25 or 28, and a LCDR3 sequence comprising or consisting of a sequence of SEQ ID NO: 24 or 26, wherein X3 is selected from N or S.

[0179] In some instances, the anti-transferrin receptor antibody comprises a VH region and a VL region, wherein the VH region comprises: a HCDR1 sequence comprising or consisting of a sequence of SEQ ID NO: 17; a HCDR2 sequence comprising or consisting of a sequence of SEQ ID NO: 12, wherein X1 is selected from N or Q and X2 is selected from Q or E; and a HCDR3 sequence comprising or consisting of a sequence of SEQ ID NO: 19; and the VL region comprises: a LCDR1 sequence comprising or consisting of a sequence of SEQ ID NO: 22 or 27, a LCDR2 sequence comprising or consisting of a sequence of SEQ ID NO: 14, and a LCDR3 sequence comprising or consisting of a sequence of SEQ ID NO: 24 or 26, wherein X4 is selected from A or G, and X5 is selected from D or E.

[0180] In some cases, the anti-transferrin receptor antibody comprises a VH region and a VL region, wherein the VH region comprises: a HCDR1 sequence comprising or consisting of a sequence of SEQ ID NO: 17; a HCDR2 sequence comprising or consisting of a sequence of SEQ ID NO: 12, wherein X1 is selected from N or Q and X2 is selected from Q or E; and a HCDR3 sequence comprising or consisting of a sequence of SEQ ID NO: 19; and the VL region comprises: a LCDR1 sequence comprising or consisting of a sequence of SEQ ID NO: 22 or 27, a LCDR2 sequence comprising or consisting of a sequence of SEQ ID NO: 23, 25 or 28, and a LCDR3 sequence comprising or consisting of a sequence of SEQ ID NO: 15, wherein X6 is present or absent and, if present, is F.

[0181] In some cases, the anti-transferrin receptor antibody comprises a VH region and a VL region, wherein the VH region comprises: a HCDR1 sequence comprising or consisting of a sequence of SEQ ID NO: 17; a HCDR2 sequence comprising or consisting of a sequence of SEQ ID NO: 12, wherein X1 is selected from N or Q and X2 is selected from Q or E; and a HCDR3 sequence comprising or consisting of a sequence of SEQ ID NO: 19; and the VL region comprises: a LCDR1 sequence comprising or consisting of a sequence of SEQ ID NO: 22, a LCDR2 sequence comprising or consisting of a sequence of SEQ ID NO: 16, and a LCDR3 sequence comprising or consisting of a sequence of SEQ ID NO: 15, wherein X5 is selected from D or E, and X6 is present or absent, and if present, is F.

[0182] In some cases, the anti-transferrin receptor antibody comprises a VH region and a VL region, wherein the VH region comprises: a HCDR1 sequence comprising or consisting of a sequence of SEQ ID NO: 17; a HCDR2 sequence comprising or consisting of a sequence of SEQ ID NO: 12, wherein X1 is selected from N or Q and X2 is selected from Q or E; and a HCDR3 sequence comprising or consisting of a sequence of SEQ ID NO: 19; and the VL region comprises: a LCDR1 sequence comprising or consisting of a sequence of SEQ ID NO: 22, a LCDR2 sequence comprising or consisting of a sequence of SEQ ID NO: 23, and a LCDR3 sequence comprising or consisting of a sequence of SEQ ID NO: 24.

[0183] In some cases, the anti-transferrin receptor antibody comprises a VH region and a VL region, wherein the VH region comprises: a HCDR1 sequence comprising or consisting of a sequence of SEQ ID NO: 17; a HCDR2 sequence comprising or consisting of a sequence of SEQ ID NO: 12, wherein X1 is selected from N or Q and X2 is selected from Q or E; and a HCDR3 sequence comprising or consisting of a sequence of SEQ ID NO: 19; and the VL region comprises: a LCDR1 sequence comprising or consisting of a sequence of SEQ ID NO: 22, a LCDR2 sequence comprising or consisting of a sequence of SEQ ID NO: 25, and a LCDR3 sequence comprising or consisting of a sequence of SEQ ID NO: 26.

[0184] In some cases, the anti-transferrin receptor antibody comprises a VH region and a VL region, wherein the VH region comprises: a HCDR1 sequence comprising or consisting of a sequence of SEQ ID NO: 17; a HCDR2 sequence comprising or consisting of a sequence of SEQ ID NO: 12, wherein X1 is selected from N or Q and X2 is selected from Q or E; and a HCDR3 sequence comprising or consisting of a sequence of SEQ ID NO: 19; and the VL region comprises: a LCDR1 sequence comprising or consisting of a sequence of SEQ ID NO: 27, a LCDR2 sequence comprising or consisting of a sequence of SEQ ID NO: 28, and a LCDR3 sequence comprising or consisting of a sequence of SEQ ID NO: 26.

[0185] In some cases, the anti-transferrin receptor antibody comprises a VH region and a VL region, wherein the VH region comprises: a HCDR1 sequence comprising or consisting of a sequence of SEQ ID NO: 17, a HCDR2 sequence comprising or consisting of a sequence of SEQ ID NO: 18, and a HCDR3 sequence comprising or consisting of a sequence of SEQ ID NO: 19; and the VL region comprises: a LCDR1 sequence comprising or consisting of a sequence of SEQ ID NO: 13, a LCDR2 sequence comprising or consisting of a sequence of SEQ ID NO: 23, 25 or 28, and a LCDR3 sequence comprising or consisting of a sequence of SEQ ID NO: 24 or 26, wherein X3 is selected from N or S.

[0186] In some cases, the anti-transferrin receptor antibody comprises a VH region and a VL region, wherein the VH region comprises: a HCDR1 sequence comprising or consisting of a sequence of SEQ ID NO: 17, a HCDR2 sequence comprising or consisting of a sequence of SEQ ID NO: 18, and a HCDR3 sequence comprising or consisting of a sequence of SEQ ID NO: 19; and the VL region comprises: a LCDR1 sequence comprising or consisting of a sequence of SEQ ID NO: 22 or 27, a LCDR2 sequence comprising or consisting of a sequence of SEQ ID NO: 14, and a LCDR3 sequence comprising or consisting of a sequence of SEQ ID NO: 24 or 26, wherein X4 is selected from A or G, and X5 is selected from D or E.

[0187] In some cases, the anti-transferrin receptor antibody comprises a VH region and a VL region, wherein the VH region comprises: a HCDR1 sequence comprising or consisting of a sequence of SEQ ID NO: 17, a HCDR2 sequence comprising or consisting of a sequence of SEQ ID NO: 18, and a HCDR3 sequence comprising or consisting of a sequence of SEQ ID NO: 19; and the VL region comprises: a LCDR1 sequence comprising or consisting of a sequence of SEQ ID NO: 22 or 27, a LCDR2 sequence comprising or consisting of a sequence of SEQ ID NO: 23, 25 or 28, and a LCDR3 sequence comprising or consisting of a sequence of SEQ ID NO: 15, wherein X6 is present or absent and, if present, is F.

[0188] In some cases, the anti-transferrin receptor antibody comprises a VH region and a VL region, wherein the VH region comprises: a HCDR1 sequence comprising or consisting of a sequence of SEQ ID NO: 17, a HCDR2 sequence comprising or consisting of a sequence of SEQ ID NO: 18, and a HCDR3 sequence comprising or consisting of a sequence of SEQ ID NO: 19; and the VL region comprises: a LCDR1 sequence comprising or consisting of a sequence of SEQ ID NO: 22, a LCDR2 sequence comprising or consisting of a sequence of SEQ ID NO: 16, and a LCDR3 sequence comprising or consisting of a sequence of SEQ ID NO: 15, wherein X5 is selected from D or E, and X6 is present or absent, and if present, is F.

[0189] In some cases, the anti-transferrin receptor antibody comprises a VH region and a VL region, wherein the VH region comprises: a HCDR1 sequence comprising or consisting of a sequence of SEQ ID NO: 17, a HCDR2 sequence comprising or consisting of a sequence of SEQ ID NO: 18, and a HCDR3 sequence comprising or consisting of a sequence of SEQ ID NO: 19; and the VL region comprises: a LCDR1 sequence comprising or consisting of a sequence of SEQ ID NO: 22, a LCDR2 sequence comprising or consisting of a sequence of SEQ ID NO: 23, and a LCDR3 sequence comprising or consisting of a sequence of SEQ ID NO: 24.

[0190] In some cases, the anti-transferrin receptor antibody comprises a VH region and a VL region, wherein the VH region comprises: a HCDR1 sequence comprising or consisting of a sequence of SEQ ID NO: 17, a HCDR2 sequence comprising or consisting of a sequence of SEQ ID NO: 18, and a HCDR3 sequence comprising or consisting of a sequence of SEQ ID NO: 19; and the VL region comprises: a LCDR1 sequence comprising or consisting of a sequence of SEQ ID NO: 22, a LCDR2 sequence comprising or consisting of a sequence of SEQ ID NO: 21, and a LCDR3 sequence comprising or consisting of a sequence of SEQ ID NO: 26.

[0191] In some cases, the anti-transferrin receptor antibody comprises a VH region and a VL region, wherein the VH region comprises: a HCDR1 sequence comprising or consisting of a sequence of SEQ ID NO: 17, a HCDR2 sequence comprising or consisting of a sequence of SEQ ID NO: 18, and a HCDR3 sequence comprising or consisting of a sequence of SEQ ID NO: 19; and the VL region comprises: a LCDR1 sequence comprising or consisting of a sequence of SEQ ID NO: 27, a LCDR2 sequence comprising or consisting of a sequence of SEQ ID NO: 28, and a LCDR3 sequence comprising or consisting of a sequence of SEQ ID NO: 26.

[0192] In some cases, the anti-transferrin receptor antibody comprises a VH region and a VL region, wherein the VH region comprises: a HCDR1 sequence comprising or consisting of a sequence of SEQ ID NO: 17, a HCDR2 sequence comprising or consisting of a sequence of SEQ ID NO: 20, and a HCDR3 sequence comprising or consisting of a sequence of SEQ ID NO: 19; and the VL region comprises: a LCDR1 sequence comprising or consisting of a sequence of SEQ ID NO: 13, a LCDR2 sequence comprising or consisting of a sequence of SEQ ID NO: 23, 25 or 28, and a LCDR3 sequence comprising or consisting of a sequence of SEQ ID NO: 24 or 26, wherein X3 is selected from N or S.

[0193] In some cases, the anti-transferrin receptor antibody comprises a VH region and a VL region, wherein the VH region comprises: a HCDR1 sequence comprising or consisting of a sequence of SEQ ID NO: 17, a HCDR2 sequence comprising or consisting of a sequence of SEQ ID NO: 20, and a HCDR3 sequence comprising or consisting of a sequence of SEQ ID NO: 19; and the VL region comprises: a LCDR1 sequence comprising or consisting of a sequence of SEQ ID NO: 22 or 27, a LCDR2 sequence comprising or consisting of a sequence of SEQ ID NO: 14, and a LCDR3 sequence comprising or consisting of a sequence of SEQ ID NO: 24 or 26, wherein X4 is selected from A or G, and X5 is selected from D or E.

[0194] In some cases, the anti-transferrin receptor antibody comprises a VH region and a VL region, wherein the VH region comprises: a HCDR1 sequence comprising or consisting of a sequence of SEQ ID NO: 17, a HCDR2 sequence comprising or consisting of a sequence of SEQ ID NO: 20, and a HCDR3 sequence comprising or consisting of a sequence of SEQ ID NO: 19; and the VL region comprises: a LCDR1 sequence comprising or consisting of a sequence of SEQ ID NO: 22 or 27, a LCDR2 sequence comprising or consisting of a sequence of SEQ ID NO: 23, 25 or 28, and a LCDR3 sequence comprising or consisting of a sequence of SEQ ID NO: 15, wherein X6 is present or absent and, if present, is F.

[0195] In some cases, the anti-transferrin receptor antibody comprises a VH region and a VL region, wherein the VH region comprises: a HCDR1 sequence comprising or consisting of a sequence of SEQ ID NO: 17, a HCDR2 sequence comprising or consisting of a sequence of SEQ ID NO: 20, and a HCDR3 sequence comprising or consisting of a sequence of SEQ ID NO: 19; and the VL region comprises: a LCDR1 sequence comprising or consisting of a sequence of SEQ ID NO: 22, a LCDR2 sequence comprising or consisting of a sequence of SEQ ID NO: 16, and a LCDR3 sequence comprising or consisting of a sequence of SEQ ID NO: 15, wherein X5 is selected from D or E, and X6 is present or absent, and if present, is F.

[0196] In some cases, the anti-transferrin receptor antibody comprises a VH region and a VL region, wherein the VH region comprises: a HCDR1 sequence comprising or consisting of a sequence of SEQ ID NO: 17, a HCDR2 sequence comprising or consisting of a sequence of SEQ ID NO: 20, and a HCDR3 sequence comprising or consisting of a sequence of SEQ ID NO: 19; and the VL region comprises: a LCDR1 sequence comprising or consisting of a sequence of SEQ ID NO: 22, a LCDR2 sequence comprising or consisting of a sequence of SEQ ID NO: 23, and a LCDR3 sequence comprising or consisting of a sequence of SEQ ID NO: 24.

[0197] In some cases, the anti-transferrin receptor antibody comprises a VH region and a VL region, wherein the VH region comprises: a HCDR1 sequence comprising or consisting of a sequence of SEQ ID NO: 17, a HCDR2 sequence comprising or consisting of a sequence of SEQ ID NO: 20, and a HCDR3 sequence comprising or consisting of a sequence of SEQ ID NO: 19; and the VL region comprises: a LCDR1 sequence comprising or consisting of a sequence of SEQ ID NO: 22, a LCDR2 sequence comprising or consisting of a sequence of SEQ ID NO: 25, and a LCDR3 sequence comprising or consisting of a sequence of SEQ ID NO: 26.

[0198] In some cases, the anti-transferrin receptor antibody comprises a VH region and a VL region, wherein the VH region comprises: a HCDR1 sequence comprising or consisting of a sequence of SEQ ID NO: 17, a HCDR2 sequence comprising or consisting of a sequence of SEQ ID NO: 20, and a HCDR3 sequence comprising or consisting of a sequence of SEQ ID NO: 19; and the VL region comprises: a LCDR1 sequence comprising or consisting of a sequence of SEQ ID NO: 27, a LCDR2 sequence comprising or consisting of a sequence of SEQ ID NO: 28, and a LCDR3 sequence comprising or consisting of a sequence of SEQ ID NO: 26.

[0199] In some cases, the anti-transferrin receptor antibody comprises a VH region and a VL region, wherein the VH region comprises: a HCDR1 sequence comprising or consisting of a sequence of SEQ ID NO: 17, a HCDR2 sequence comprising or consisting of a sequence of SEQ ID NO: 21, and a HCDR3 sequence comprising or consisting of a sequence of SEQ ID NO: 19; and the VL region comprises: a LCDR1 sequence comprising or consisting of a sequence of SEQ ID NO: 13, a LCDR2 sequence comprising or consisting of a sequence of SEQ ID NO: 23, 25 or 28, and a LCDR3 sequence comprising or consisting of a sequence of SEQ ID NO: 24 or 26, wherein X3 is selected from N or S.

[0200] In some cases, the anti-transferrin receptor antibody comprises a VH region and a VL region, wherein the VH region comprises: a HCDR1 sequence comprising or consisting of a sequence of SEQ ID NO: 17, a HCDR2 sequence comprising or consisting of a sequence of SEQ ID NO: 21, and a HCDR3 sequence comprising or consisting of a sequence of SEQ ID NO: 19; and the VL region comprises: a LCDR1 sequence comprising or consisting of a sequence of SEQ ID NO: 22 or 27, a LCDR2 sequence comprising or consisting of a sequence of SEQ ID NO: 14, and a LCDR3 sequence comprising or consisting of a sequence of SEQ ID NO: 24 or 26, wherein X4 is selected from A or G, and X5 is selected from D or E.

[0201] In some cases, the anti-transferrin receptor antibody comprises a VH region and a VL region, wherein the VH region comprises: a HCDR1 sequence comprising or consisting of a sequence of SEQ ID NO: 17, a HCDR2 sequence comprising or consisting of a sequence of SEQ ID NO: 21, and a HCDR3 sequence comprising or consisting of a sequence of SEQ ID NO: 19; and the VL region comprises: a LCDR1 sequence comprising or consisting of a sequence of SEQ ID NO: 22 or 27, a LCDR2 sequence comprising or consisting of a sequence of SEQ ID NO: 23, 25 or 28, and a LCDR3 sequence comprising or consisting of a sequence of SEQ ID NO: 15, wherein X6 is present or absent and, if present, is F.

[0202] In some cases, the anti-transferrin receptor antibody comprises a VH region and a VL region, wherein the VH region comprises: a HCDR1 sequence comprising or consisting of a sequence of SEQ ID NO: 17, a HCDR2 sequence comprising or consisting of a sequence of SEQ ID NO: 21, and a HCDR3 sequence comprising or consisting of a sequence of SEQ ID NO: 19; and the VL region comprises: a LCDR1 sequence comprising or consisting of a sequence of SEQ ID NO: 22, a LCDR2 sequence comprising or consisting of a sequence of SEQ ID NO: 16, and a LCDR3 sequence comprising or consisting of a sequence of SEQ ID NO: 15, wherein X5 is selected from D or E, and X6 is present or absent, and if present, is F.

[0203] In some cases, the anti-transferrin receptor antibody comprises a VH region and a VL region, wherein the VH region comprises: a HCDR1 sequence comprising or consisting of a sequence of SEQ ID NO: 17, a HCDR2 sequence comprising or consisting of a sequence of SEQ ID NO: 21, and a HCDR3 sequence comprising or consisting of a sequence of SEQ ID NO: 19; and the VL region comprises: a LCDR1 sequence comprising or consisting of a sequence of SEQ ID NO: 22, a LCDR2 sequence comprising or consisting of a sequence of SEQ ID NO: 23, and a LCDR3 sequence comprising or consisting of a sequence of SEQ ID NO: 24.

[0204] In some cases, the anti-transferrin receptor antibody comprises a VH region and a VL region, wherein the VH region comprises: a HCDR1 sequence comprising or consisting of a sequence of SEQ ID NO: 17, a HCDR2 sequence comprising or consisting of a sequence of SEQ ID NO: 21, and a HCDR3 sequence comprising or consisting of a sequence of SEQ ID NO: 19; and the VL region comprises: a LCDR1 sequence comprising or consisting of a sequence of SEQ ID NO: 22, a LCDR2 sequence comprising or consisting of a sequence of SEQ ID NO: 25, and a LCDR3 sequence comprising or consisting of a sequence of SEQ ID NO: 26.

[0205] In some cases, the anti-transferrin receptor antibody comprises a VH region and a VL region, wherein the VH region comprises: a HCDR1 sequence comprising or consisting of a sequence of SEQ ID NO: 17, a HCDR2 sequence comprising or consisting of a sequence of SEQ ID NO: 21, and a HCDR3 sequence comprising or consisting of a sequence of SEQ ID NO: 19; and the VL region comprises: a LCDR1 sequence comprising or consisting of a sequence of SEQ ID NO: 27, a LCDR2 sequence comprising or consisting of a sequence of SEQ ID NO: 28, and a LCDR3 sequence comprising or consisting of a sequence of SEQ ID NO: 26.

[0206] In some aspects, the anti-transferrin receptor antibody comprises a VH region and a VL region, wherein the sequence of the VH region comprises or consists of a sequence having about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% sequence identity to a sequence selected from SEQ ID NOs: 29-33, and the sequence of the VL region comprises or consists of a sequence having about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% sequence identity to a sequence selected from SEQ ID NOs: 34-38. In some aspects, the anti-transferrin receptor antibody comprises a VH region and a VL region, wherein the sequence of the VH region comprises a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with a sequence selected from the group consisting of SEQ ID NOs: 29-33 or consisting of such a sequence, and the sequence of the VL region comprises a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with a sequence selected from the group consisting of SEQ ID NOs: 34-38 or consisting of such a sequence. In some aspects, the anti-transferrin receptor antibody comprises a VH region and a VL region, wherein the sequence of the VH region comprises a sequence selected from the group consisting of SEQ ID NOs: 29-33 or consisting of such a sequence, and the sequence of the VL region comprises a sequence selected from the group consisting of SEQ ID NOs: 34-38 or consisting of such a sequence.

[0207] In some aspects, the VH region comprises or consists of a sequence selected from SEQ ID NO: 29-33 (Table 4), and the VL region comprises or consists of a sequence selected from SEQ ID NO: 34-38 (Table 5). The underlined regions in Tables 4 and 5 represent respective CDR1, CDR2 or CDR3 sequences.

[0208] Table 4

[0209]

[0210] Table 5

[0211]

[0212] In some aspects, the anti-transferrin receptor antibody comprises a VH region and a VL region as shown in Table 6.

[0213] Table 6

[0214]

[0215] In some aspects, the anti-transferrin receptor antibodies described herein include IgG frameworks, IgA frameworks, IgE frameworks or IgM frameworks. In some cases, the anti-transferrin receptor antibodies include IgG frameworks (e.g., IgG1, IgG2, IgG3 or IgG4). In some cases, the anti-transferrin receptor antibodies include IgG1 frameworks. In some cases, the anti-transferrin receptor antibodies include IgG2 (e.g., IgG2a or IgG2b) frameworks. In some cases, the anti-transferrin receptor antibodies include IgG2a frameworks. In some cases, the anti-transferrin receptor antibodies include IgG2b frameworks. In some cases, the anti-transferrin receptor antibodies include IgG3 frameworks. In some cases, the anti-transferrin receptor antibodies include IgG4 frameworks.

[0216] In some cases, the anti-transferrin receptor antibody comprises one or more mutations in a framework region (e.g., a CH1 domain, a CH2 domain, a CH3 domain, a hinge region, or a combination thereof). In some cases, one or more mutations are to stabilize the antibody and / or increase the half-life. In some cases, one or more mutations are to regulate Fc receptor interactions to reduce or eliminate Fc effector functions, such as FcγR, antibody-dependent cell-mediated cytotoxicity (ADCC) or complement-dependent cytotoxicity (CDC). In other cases, one or more mutations are to regulate glycosylation.

[0217] In some aspects, one or more mutations are located in the Fc region. In some cases, the Fc region comprises a mutation at residue position L234, L235, or a combination thereof. In some cases, the mutation comprises L234 and L235. In some cases, the mutation comprises L234A and L235A. In some cases, the residue position is referenced to IgG1.

[0218] In some cases, the Fc region comprises a mutation at residue positions L234, L235, D265, N21, K46, L52 or P53 or a combination thereof. In some cases, the mutation comprises a combination of L234 and L235 and a mutation at residue positions K46, L52 or P53. In some cases, the Fc region comprises a mutation at L234, L235 and K46. In some cases, the Fc region comprises a mutation at L234, L235 and L52. In some cases, the Fc region comprises a mutation at L234, L235 and P53. In some cases, the Fc region comprises a mutation at D265 and N21. In some cases, the residue position is with reference to IgG1.

[0219] In some cases, the Fc region comprises L234A, L235A, D265A, N21G, K46G, L52R or P53G or a combination thereof. In some cases, the Fc region comprises a combination of L234A and L235A with K46G, L52R or P53G. In some cases, the Fc region comprises L234A, L235A and K46G. In some cases, the Fc region comprises L234A, L235A and L52R. In some cases, the Fc region comprises L234A, L235A and P53G. In some cases, the Fc region comprises D265A and N21G. In some cases, the residue positions are referenced to IgG1.

[0220] In some cases, the Fc region comprises a mutation at residue position L235, L236, D265, N21, K46, L52 or P53 or a combination of these mutations. In some cases, the Fc region comprises a mutation at L235 and L236. In some cases, the Fc region comprises a combination of a mutation at L235 and L236 and a mutation at residue position K46, L52 or P53. In some cases, the Fc region comprises a mutation at L235, L236 and K46. In some cases, the Fc region comprises a mutation at L235, L236 and L52. In some cases, the Fc region comprises a mutation at L235, L236 and P53. In some cases, the Fc region comprises a mutation at D265 and N21. In some cases, the residue position is with reference to IgG2b.

[0221] In some aspects, the Fc region comprises L235A, L236A, D265A, N21G, K46G, L52R or P53G or a combination thereof. In some cases, the Fc region comprises L235A and L236A. In some cases, the Fc region comprises a combination of L235A and L236A with K46G, L52R or P53G. In some cases, the Fc region comprises L235A, L236A and K46G. In some cases, the Fc region comprises L235A, L236A and L52R. In some cases, the Fc region comprises L235A, L236A and P53G. In some cases, the Fc region comprises D265A and N21G. In some cases, the residue positions are with reference to IgG2b.

[0222] In some aspects, the Fc region comprises a mutation at residue position L233, L234, D264, N20, K45, L51 or P52, wherein these residues correspond to positions 233, 234, 264, 20, 45, 51 and 52 of SEQ ID NO:39. In some cases, the Fc region comprises a mutation at L233 and L234. In some cases, the Fc region comprises a combination of a mutation at L233 and L234 and a mutation at residue position K45, L51 or P52. In some cases, the Fc region comprises a mutation at L233, L234 and K45. In some cases, the Fc region comprises a mutation at L233, L234 and L51. In some cases, the Fc region comprises a mutation at L233, L234 and K45. In some cases, the Fc region comprises a mutation at L233, L234 and K45. In some cases, the Fc region comprises a mutation at L233, L234 and P52. In some cases, the Fc region comprises mutations at D264 and N20. In some cases, positions equivalent to residues L233, L234, D264, N20, K45, L51, or P52 in an IgG1, IgG2, IgG3, or IgG4 framework are contemplated. In some cases, mutations of residues corresponding to residues L233, L234, D264, N20, K45, L51, or P52 of SEQ ID NO: 39 in an IgG1, IgG2, or IgG4 framework are also contemplated.

[0223] In some aspects, the Fc region comprises L233A, L234A, D264A, N20G, K45G, L51R or P52G, wherein these residues correspond to positions 233, 234, 264, 20, 45, 51 and 52 of SEQ ID NO:39. In some cases, the Fc region comprises L233A and L234A. In some cases, the Fc region comprises a combination of L233A and L234A with K45G, L51R or P52G. In some cases, the Fc region comprises L233A, L234A and K45G. In some cases, the Fc region comprises L233A, L234A and L51R. In some cases, the Fc region comprises L233A, L234A and K45G. In some cases, the Fc region comprises L233A, L234A and L51R. In some cases, the Fc region comprises L233A, L234A and K45G. In some cases, the Fc region comprises L233A, L234A and P52G. In some instances, the Fc region comprises D264A and N20G.

[0224] In some aspects, the human IgG constant region is modified to alter antibody-dependent cellular cytotoxicity (ADCC) and / or complement-dependent cytotoxicity (CDC), for example, as described in Natsume et al., 2008 Cancer Res, 68(10):3863-72; Idusogie et al., 2001 J Immunol, 166(4):2571-5; Moore et al., 2010 mAbs, 2(2):181-189; Lazar et al., 2006 PNAS, 103(11):4005-4010, Shields et al., 2001 JBC, 276(9):6591-6604; Stavenhagen et al., 2007 Cancer Res, 67(18):8882-8890; Stavenhagen et al., 2008 Advan. Enzyme Regul., 48: 152-164; Alegre et al., 1992 J Immunol, 148: 3461-3468; Amino acid modifications reviewed in Kaneko and Niwa, 2011 Biodrugs, 25(1): 1-11.

[0225] In some aspects, the anti-transferrin receptor antibodies described herein are full-length antibodies comprising a heavy chain (HC) and a light chain (LC). In some cases, the heavy chain (HC) comprises a sequence selected from Table 7. In some cases, the light chain (LC) comprises a sequence selected from Table 8. The underlined region represents each CDR.

[0226] Table 7

[0227]

[0228]

[0229]

[0230]

[0231]

[0232]

[0233] Table 8

[0234]

[0235] In some aspects, the anti-transferrin receptor antibodies described herein have improved serum half-life compared to a reference anti-transferrin receptor antibody. In some cases, the improved serum half-life is at least 30 minutes, 1 hour, 1.5 hours, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 12 hours, 18 hours, 24 hours, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 14 days, 30 days or longer than a reference anti-transferrin receptor antibody.

[0236] In some aspects, the antibody or its antigen binding fragment is further modified using conventional techniques known in the art, for example (alone or in combination) by using amino acid deletions, insertions, substitutions, additions and / or by recombination and / or any other modification known in the art (e.g., post-translational modifications and chemical modifications, such as glycosylation and phosphorylation). In some cases, the modification further includes modifications for regulating the interaction with the Fc receptor. In some cases, one or more modifications include those described in, for example, International Publication No. WO97 / 34631, which discloses amino acid residues involved in the interaction between the Fc domain and the FcRn receptor. Methods for introducing such modifications in a nucleic acid sequence that is the basis of the antibody or its binding fragment amino acid sequence are well known to those skilled in the art.

[0237] In some cases, the antibody or antigen-binding fragment thereof further encompasses derivatives thereof and includes a polypeptide sequence containing at least one CDR.

[0238] In some cases, the term "single-chain" as used herein means that the first domain and the second domain of the bispecific single-chain construct are covalently linked, preferably in the form of colinear amino acid sequences encodable by a single nucleic acid molecule.

[0239] In some cases, bispecific single chain antibody constructs relate to constructs comprising two binding domains derived from antibodies. In such embodiments, bispecific single chain antibody constructs are connected in series with double scFv or double antibodies. In some cases, scFv contains VH and VL domains connected by a linker peptide. In some cases, the length and sequence of the linker are sufficient to ensure that each of the first domain and the second domain can retain its differential binding specificity independently of each other.

[0240] In some aspects, as used herein, binding or interacting with defines the binding / interaction of at least two antigen interaction sites with each other. In some cases, the antigen interaction site defines a motif of a polypeptide, which shows the ability to specifically interact with a specific antigen or a specific antigen group. In some cases, binding / interaction is also understood to define specific recognition. In this case, specific recognition refers to whether an antibody or its binding fragment can interact and / or bind with at least two amino acids of each target molecule. For example, specific recognition relates to the specificity of an antibody molecule, or to its ability to distinguish a specific region of a target molecule. In other cases, the specific interaction of an antigen interaction site with its specific antigen leads to the initiation of a signal, for example, due to conformational changes of the induced antigen, oligomerization of the antigen, etc. In a further aspect, binding is specifically illustrated by the "key-lock principle". Therefore, in some cases, the specific motifs in the amino acid sequence of an antigen interaction site and an antigen are bound to each other due to their primary, secondary or tertiary structures and due to the secondary modification of the structure. In this case, the specific interaction of an antigen interaction site with its specific antigen also leads to a simple binding of the site to the antigen.

[0241] In some cases, specific interaction further refers to reduced cross-reactivity or reduced off-target effects of the antibody or its binding fragment. For example, an antibody or its antigen-binding fragment that binds to a polypeptide / protein of interest but does not or substantially does not bind to any other polypeptide is considered to be specific for the polypeptide / protein of interest. Examples of specific interactions of an antigen interaction site with a particular antigen include the specificity of a ligand for its receptor, such as the interaction of an antigenic determinant (epitope) with an antigen binding site of an antibody.

[0242] Thus, in some cases, the polynucleic acid molecule conjugate comprises a polynucleic acid molecule (e.g., a PMO molecule) and an anti-transferrin receptor antibody or antigen-binding fragment thereof conjugated to the polynucleic acid (the polynucleic acid molecule comprises or consists of a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 99% or 100% sequence identity with a sequence selected from SEQ ID NOs: 100-133), such that the polynucleic acid molecule conjugate induces exon skipping of the pre-mRNA of the DMD gene.

[0243] In certain aspects, the polynucleic acid molecule conjugate comprises an anti-transferrin receptor antibody or an antigen-binding fragment thereof conjugated to a polynucleic acid molecule (e.g., a PMO molecule) that hybridizes to a sequence of a target region of a pre-mRNA transcript of a DMD gene, and the polynucleic acid molecule has a sense chain comprising or consisting of a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 99% or 100% sequence identity to a sequence selected from SEQ ID NOs: 100-133, and the anti-transferrin receptor antibody or an antigen-binding fragment thereof comprises a heavy chain variable (VH) region and a light chain variable (VL) region, wherein the VH region comprises: a HCDR1 sequence comprising or consisting of SEQ ID NO: 17, a HCDR2 sequence comprising or consisting of SEQ ID NO: 20, and a HCDR3 sequence comprising or consisting of SEQ ID NO: 19; and the VL region comprises: a LCDR1 sequence comprising or consisting of SEQ ID NO: 22, a LCDR2 sequence comprising or consisting of SEQ ID NO: 23, and a LCDR3 sequence comprising SEQ ID NO: 24. NO:24 or a LCDR3 sequence consisting thereof, and the anti-transferrin receptor antibody or an antigen-binding fragment thereof and the polynucleic acid molecule are conjugated via a linker comprising 4-(N-maleimidomethyl)cyclohexane-1-amide (SMCC).

[0244] In certain aspects, the polynucleic acid molecule conjugate comprises an anti-transferrin receptor antibody or an antigen-binding fragment thereof conjugated to a polynucleic acid molecule (e.g., a PMO molecule), the polynucleic acid molecule hybridizing to a sequence of a target region of a pre-mRNA transcript of a DMD gene, and the polynucleic acid molecule comprises or consists of a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 99% or 100% sequence identity to a sequence selected from SEQ ID NOs: 100-133, and the anti-transferrin receptor antibody or an antigen-binding fragment thereof comprises a heavy chain variable (VH) region and a light chain variable (VL) region, wherein the VH region comprises or consists of a sequence having at least 80%, 85%, 90%, 95%, 99% or 100% sequence identity to SEQ ID NO: 30, and wherein the VL region comprises or consists of a sequence having at least 80%, 85%, 90%, 95%, 99% or 100% sequence identity to SEQ ID NO: 31. NO:34 has a sequence with at least 80%, 85%, 90%, 95%, 99% or 100% sequence identity or consists of such a sequence, and the anti-transferrin receptor antibody or antigen-binding fragment thereof and the polynucleic acid molecule are conjugated via a maleimide linker.

[0245] In certain aspects, the polynucleic acid molecule conjugate comprises an anti-transferrin receptor antibody or an antigen-binding fragment thereof conjugated to a polynucleic acid molecule (e.g., a PMO molecule), the polynucleic acid molecule hybridizing to a sequence of a target region of a pre-mRNA transcript of a DMD gene, and the polynucleic acid molecule comprises or consists of a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 99% or 100% sequence identity to a sequence selected from SEQ ID NOs: 100-133, and comprises at least three, four, five or six consecutive 2'-O-methyl modified nucleotides and at least two, at least three 2'-F modified nucleotides at the 5' end, and the anti-transferrin receptor antibody or an antigen-binding fragment thereof comprises a heavy chain variable (VH) region and a light chain variable (VL) region, wherein the VH region comprises or consists of a sequence having at least 80%, 85%, 90%, 95%, 99% or 100% sequence identity to SEQ ID NO: 30, and wherein the VL region comprises or consists of a sequence having at least 80%, 85%, 90%, 95%, 99% or 100% sequence identity to SEQ ID NO: 31. NO:34 has a sequence with at least 80%, 85%, 90%, 95%, 99% or 100% sequence identity or consists of such a sequence, and the anti-transferrin receptor antibody or antigen-binding fragment thereof and the polynucleic acid molecule are conjugated via a maleimide linker.

[0246] In certain aspects, the polynucleic acid molecule conjugate comprises an anti-transferrin receptor antibody or an antigen-binding fragment thereof conjugated to a polynucleic acid molecule (e.g., a PMO molecule), the polynucleic acid molecule hybridizing to a sequence of a target region of a pre-mRNA transcript of a DMD gene, and the polynucleic acid molecule comprises or consists of a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 99% or 100% sequence identity to a sequence selected from SEQ ID NOs: 100-133, and comprises at least two, at least three, at least four or at least five consecutive 2'-O-methyl modified nucleotides at the 3' end of the polynucleic acid molecule, and comprises at least one, at least two, at least three, at least four 2'-F modified nucleotides, and the anti-transferrin receptor antibody or an antigen-binding fragment thereof comprises a heavy chain variable (VH) region and a light chain variable (VL) region, wherein the VH region comprises: a HCDR1 sequence comprising or consisting of SEQ ID NO: 17, a HCDR2 sequence comprising or consisting of SEQ ID NO: 20, and a HCDR3 sequence comprising SEQ ID NO: 14. NO:19 or a HCDR3 sequence consisting of it; and the VL region comprises: a LCDR1 sequence comprising SEQ ID NO:22 or a LCDR2 sequence comprising SEQ ID NO:23 or a LCDR3 sequence consisting of it, and an anti-transferrin receptor antibody or an antigen-binding fragment thereof and a polynucleic acid molecule are conjugated via a maleimide linker.

[0247] In certain aspects, the polynucleic acid molecule conjugate comprises an anti-transferrin receptor antibody or an antigen-binding fragment thereof conjugated to a polynucleic acid molecule (e.g., a PMO molecule), the polynucleic acid molecule hybridizing to a sequence of a target region of a pre-mRNA transcript of a DMD gene, and the polynucleic acid molecule comprises or consists of a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 99% or 100% sequence identity to a sequence selected from SEQ ID NOs: 100-133, comprises one or more 2'-O-methyl modified nucleotides at the 5' end and / or the 3' end of the polynucleic acid molecule, and the anti-transferrin receptor antibody or an antigen-binding fragment thereof comprises a heavy chain variable (VH) region and a light chain variable (VL) region, wherein the VH region comprises: a HCDR1 sequence comprising or consisting of SEQ ID NO: 17, a HCDR2 sequence comprising or consisting of SEQ ID NO: 18, and a HCDR3 sequence comprising or consisting of SEQ ID NO: 19; and the VL region comprises: a HCDR1 sequence comprising or consisting of SEQ ID NO: 19; NO:22 or a LCDR1 sequence consisting of it, a LCDR2 sequence consisting of it, and a LCDR3 sequence consisting of it, and an anti-transferrin receptor antibody or an antigen-binding fragment thereof and a polynucleic acid molecule are conjugated via a maleimide linker.

[0248] In certain aspects, the polynucleic acid molecule conjugate comprises an anti-transferrin receptor antibody or an antigen-binding fragment thereof conjugated to a polynucleic acid molecule (e.g., a PMO molecule), the polynucleic acid molecule hybridizing to a target sequence of a pre-mRNA transcript of a DMD gene, and the polynucleic acid molecule comprises or consists of a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 99% or 100% sequence identity to a sequence selected from SEQ ID NOs: 100-133, and the anti-transferrin receptor antibody or an antigen-binding fragment thereof comprises a heavy chain variable (VH) region and a light chain variable (VL) region, and the VH region comprises or consists of a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 99% or 100% sequence identity to one of SEQ ID NOs: 29-33, and wherein the VL region comprises or consists of a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 99% or 100% sequence identity to one of SEQ ID NOs: 29-33, and wherein the VL region comprises or consists of a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 99% or 100% sequence identity to a sequence selected from SEQ ID NOs: NO:34-38 has a sequence of at least 80%, at least 85%, at least 90%, at least 95%, at least 99% or 100% sequence identity or is composed of such a sequence, and the anti-transferrin receptor antibody or its antigen-binding fragment and the polynucleic acid molecule are conjugated via a 6-amino-1-hexanol joint. In some cases, the polynucleic acid molecule comprises at least one or more 2' modified nucleotides. In some cases, the polynucleic acid molecule comprises at least five consecutive 2'-O-methyl modified nucleotides at the 3' end. In some cases, the polynucleic acid molecule comprises at least three or at least four 2'-F modified nucleotides, wherein any two of the at least three or at least four 2'-F modified nucleotides are discontinuous.

[0249] In some aspects, the antibody or antigen-binding fragment thereof is conjugated non-specifically to any of the PMO molecules disclosed herein. In some cases, the antibody or antigen-binding fragment thereof is conjugated to any of the PMO molecules disclosed herein via a lysine residue or a cysteine ​​residue in a non-site-specific manner. In some cases, the antibody or antigen-binding fragment thereof is conjugated to any of the PMO molecules disclosed herein via a lysine residue in a non-site-specific manner. In some cases, the antibody or antigen-binding fragment thereof is conjugated to any of the PMO molecules disclosed herein via a cysteine ​​residue in a non-site-specific manner.

[0250] In some aspects, the antibody or its antigen-binding fragment is conjugated to any of the PMO molecules disclosed herein in a site-specific manner. In some cases, the antibody or its antigen-binding fragment is conjugated to any of the PMO molecules disclosed herein via a lysine residue, a cysteine ​​residue, at the 5' end, at the 3' end, a non-natural amino acid or an enzyme-modified or enzyme-catalyzed residue in a site-specific manner. In some cases, the antibody or its antigen-binding fragment is conjugated to any of the PMO molecules disclosed herein via a lysine residue in a site-specific manner. In some cases, the antibody or its antigen-binding fragment is conjugated to any of the PMO molecules disclosed herein via a cysteine ​​residue in a site-specific manner. In some cases, the antibody or its antigen-binding fragment is conjugated to any of the PMO molecules disclosed herein at the 5' end in a site-specific manner. In some cases, the antibody or its antigen-binding fragment is conjugated to any of the PMO molecules disclosed herein at the 3' end in a site-specific manner. In some cases, the antibody or its antigen-binding fragment is conjugated to any of the PMO molecules disclosed herein via a site-specific manner via a non-natural amino acid. In some cases, the antibody or antigen-binding fragment thereof is conjugated to any of the PMO molecules disclosed herein via an enzyme-modified or enzyme-catalyzed residue in a site-specific manner.

[0251] In some aspects, one or more PMO molecules are conjugated to any of the antibodies or antigen-binding fragments thereof disclosed herein. In some cases, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 or more PMO molecules are conjugated to an antibody or antigen-binding fragment thereof. In some cases, about 1 PMO molecule is conjugated to one antibody or antigen-binding fragment thereof. In some cases, about 2 PMO molecules are conjugated to one antibody or antigen-binding fragment thereof. In some cases, about 3 PMO molecules are conjugated to one antibody or antigen-binding fragment thereof. In some cases, about 4 PMO molecules are conjugated to one. In some cases, about 5 PMO molecules are conjugated to one antibody or antigen-binding fragment thereof. In some cases, about 6 PMO molecules are conjugated to one antibody or antigen-binding fragment thereof. In some cases, about 7 PMO molecules are conjugated to one antibody or antigen-binding fragment thereof. In some cases, about 8 PMO molecules are conjugated to one antibody or antigen-binding fragment thereof.

[0252] In some aspects, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 PMO molecules are conjugated to an antibody or antigen binding fragment thereof. In some cases, at least 1 PMO molecule is conjugated to one antibody or antigen binding fragment thereof. In some cases, at least 2 PMO molecules are conjugated to one antibody or antigen binding fragment thereof. In some cases, at least 3 PMO molecules are conjugated to one antibody or antigen binding fragment thereof. In some cases, at least 4 PMO molecules are conjugated to one. In some cases, at least 5 PMO molecules are conjugated to one antibody or antigen binding fragment thereof. In some cases, at least 6 PMO molecules are conjugated to one antibody or antigen binding fragment thereof. In some cases, at least 7 PMO molecules are conjugated to one antibody or antigen binding fragment thereof. In some cases, at least 8 PMO molecules are conjugated to one antibody or antigen binding fragment thereof.

[0253] In some cases, about 1 to about 16 PMO molecules are conjugated to an antibody or an antigen-binding fragment thereof. In some cases, about 2 to about 15 PMO molecules are conjugated to an antibody or an antigen-binding fragment thereof. In some cases, about 3 to about 14 PMO molecules are conjugated to an antibody or an antigen-binding fragment thereof. In some cases, about 4 to about 13 PMO molecules are conjugated to an antibody or an antigen-binding fragment thereof. In some cases, about 5 to about 12 PMO molecules are conjugated to an antibody or an antigen-binding fragment thereof. In some cases, about 6 to about 11 PMO molecules are conjugated to an antibody or an antigen-binding fragment thereof. In some cases, about 7 to about 10 PMO molecules are conjugated to an antibody or an antigen-binding fragment thereof. In some cases, about 8 to about 9 PMO molecules are conjugated to an antibody or an antigen-binding fragment thereof.

[0254] In some aspects, on average one or more PMO molecules are conjugated to an antibody or an antigen-binding fragment thereof. In some cases, on average about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 or more PMO molecules are conjugated to an antibody or an antigen-binding fragment thereof. In some cases, on average about 1 PMO molecule is conjugated to one antibody or an antigen-binding fragment thereof. In some cases, on average about 2 PMO molecules are conjugated to one antibody or an antigen-binding fragment thereof. In some cases, on average about 3 PMO molecules are conjugated to one antibody or an antigen-binding fragment thereof. In some cases, on average about 4 PMO molecules are conjugated to one. In some cases, on average about 5 PMO molecules are conjugated to one antibody or an antigen-binding fragment thereof. In some cases, on average about 6 PMO molecules are conjugated to one antibody or an antigen-binding fragment thereof. In some cases, on average about 7 PMO molecules are conjugated to one antibody or an antigen-binding fragment thereof. In some cases, on average about 8 PMO molecules are conjugated to one antibody or an antigen-binding fragment thereof.

[0255] In some cases, an average of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 PMO molecules are conjugated to an antibody or antigen-binding fragment thereof. In some cases, an average of at least 1 PMO molecule is conjugated to one antibody or antigen-binding fragment thereof. In some cases, an average of at least 2 PMO molecules are conjugated to one antibody or antigen-binding fragment thereof. In some cases, an average of at least 3 PMO molecules are conjugated to one antibody or antigen-binding fragment thereof. In some cases, an average of at least 4 PMO molecules are conjugated to one. In some cases, an average of at least 5 PMO molecules are conjugated to one antibody or antigen-binding fragment thereof. In some cases, an average of at least 6 PMO molecules are conjugated to one antibody or antigen-binding fragment thereof. In some cases, an average of at least 7 PMO molecules are conjugated to one antibody or antigen-binding fragment thereof. In some cases, an average of at least 8 PMO molecules are conjugated to one antibody or antigen-binding fragment thereof.

[0256] In some aspects, the number of PMO molecules conjugated to an antibody forms a ratio. In some cases, the ratio is referred to as a DAR (drug-antibody) ratio, wherein the drug as referred to herein is a PMO molecule. In some cases, the DAR ratio of a PMO molecule to an antibody is about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 or more. In some cases, the DAR ratio of a PMO molecule to an antibody is about 1 or more. In some cases, the DAR ratio of a PMO molecule to an antibody is about 2 or more. In some cases, the DAR ratio of a PMO molecule to an antibody is about 3 or more. In some cases, the DAR ratio of a PMO molecule to an antibody is about 4 or more. In some cases, the DAR ratio of a PMO molecule to an antibody is about 5 or more. In some cases, the DAR ratio of a PMO molecule to an antibody is about 6 or more. In some cases, the DAR ratio of a PMO molecule to an antibody is about 7 or more. In some cases, the DAR ratio of the PMO molecule to the antibody is about 8 or greater.

[0257] In some aspects, the average number of PMO molecules conjugated to an antibody forms an average ratio. In some cases, the average ratio is referred to as the average DAR (drug-antibody) ratio, wherein the drug as mentioned herein is a PMO molecule. In some cases, the average DAR ratio of a PMO molecule to an antibody is about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 or more. In some cases, the average DAR ratio of a PMO molecule to an antibody is about 1 or more. In some cases, the average DAR ratio of a PMO molecule to an antibody is about 2 or more. In some cases, the average DAR ratio of a PMO molecule to an antibody is about 3 or more. In some cases, the average DAR ratio of a PMO molecule to an antibody is about 4 or more. In some cases, the average DAR ratio of a PMO molecule to an antibody is about 5 or more. In some cases, the average DAR ratio of a PMO molecule to an antibody is about 6 or more. In some cases, the average DAR ratio of a PMO molecule to an antibody is about 7 or more. In some cases, the average DAR ratio of the PMO molecule to the antibody is about 8 or greater.

[0258] In some aspects, the average number of PMO molecules conjugated to an antibody forms an average ratio. In some cases, the average ratio is referred to as the average DAR (drug-antibody) ratio, wherein the drug as referred to herein is a PMO molecule. In some cases, the average DAR ratio of a PMO molecule to an antibody ranges from 1.5-2.5, 2.5-3.5, 3.5-4.5, 4.5-5.5, 5.5-6.5, 6.5-7.5, 7.5-8.5, 8.5-9.5, 9.5-10.5, 10.5-11.5, 11.5-12.5, 12.5-13.5, 13.5-14.5, 14.5-15.5, 15.5-16.5, or 16.5-17.5. In some cases, the average DAR ratio of a PMO molecule to an antibody ranges from 1.5-2.5. In some cases, the average DAR ratio of the PMO molecule to the antibody is in the range of 2.5-3.5. In some cases, the average DAR ratio of the PMO molecule to the antibody is in the range of 3.5-4.5. In some cases, the average DAR ratio of the PMO molecule to the antibody is in the range of 4.5-5.5. In some cases, the average DAR ratio of the PMO molecule to the antibody is in the range of 5.5-6.5. In some cases, the average DAR ratio of the PMO molecule to the antibody is in the range of 6.5-7.5. In some cases, the average DAR ratio of the PMO molecule to the antibody is in the range of 7.5-8.5.

[0259] Conjugation Chemistry

[0260] In some aspects, the polynucleic acid molecules disclosed herein (e.g., PMOs) are conjugated to antibodies (e.g., antibodies disclosed herein). In some cases, antibodies include amino acids, peptides, polypeptides, proteins, antibodies, antigens, toxins, hormones, lipids, nucleotides, nucleosides, sugars, carbohydrates, polymers (such as polyethylene glycol and polypropylene glycol), and analogs or derivatives of all these classes of substances. Additional examples of antibodies also include steroids, such as cholesterol, phospholipids, diacylglycerols and triacylglycerols, fatty acids, hydrocarbons (e.g., saturated, unsaturated, or containing substitutions), enzyme substrates, biotin, digoxigenin, and polysaccharides. In some cases, the polynucleic acid molecules are further conjugated to polymers, and optionally to endosomolytic moieties.

[0261] In some aspects, the polynucleic acid molecule is conjugated to the antibody by a chemical coupling process. In some cases, the polynucleic acid molecule is conjugated to the antibody by natural coupling. In some cases, conjugation is as described in Dawson et al., “Synthesis of proteins by native chemical ligation,” Science 1994, 266, 776–779; Dawson et al., “Modulation of Reactivity in Native Chemical Ligation through the Use of Thiol Additives,” J. Am. Chem. Soc. 1997, 119, 4325–4329; Hackeng et al., “Protein synthesis by native chemical ligation: Expanded scope by using straightforward methodology.,” Proc. Natl. Acad. Sci. USA 1999, 96, 10068–10073; or Wu et al., “Building complex glycopeptides: Development of a cysteine-free native chemical ligation protocol,” Angew. Chem. Int. Ed. 2006, 45, 4116–4125. In some cases, conjugation is as described in US Pat. No. 8,936,910. In some aspects, the polynucleic acid molecule is site-specifically or non-specifically conjugated to the antibody via native linkage chemistry.

[0262] In some cases, the polynucleic acid molecules are conjugated to the antibody by a site-specific method utilizing a "traceless" coupling technique (Philochem). In some cases, the "traceless" coupling technique utilizes an N-terminal 1,2-aminothiol group on the antibody, which is then conjugated to a polynucleic acid molecule containing an aldehyde group (see Casi et al., "Site-specific traceless coupling of potent cytotoxic drugs to recombinant antibodies for pharmacolivery," JACS 134(13):5887-5892(2012)).

[0263] In some cases, the polynucleic acid molecule is conjugated to the antibody by utilizing the site-specific method of the non-natural amino acid incorporated into the antibody. In some cases, the non-natural amino acid includes p-acetylphenylalanine (pAcPhe). In some cases, the ketone group of pAcPhe is selectively coupled to the conjugated part derived from alkoxy-amine to form an oxime bond (see Axup et al., "Synthesis of site-specific antibody-drug conjugates using unnatural aminoacids," PNAS 109 (40): 16101-16106 (2012)).

[0264] In some cases, the polynucleic acid molecule is conjugated to the antibody by a site-directed method utilizing an enzyme-catalyzed process. In some cases, the site-directed method utilizes SMARTag TM Technology (Redwood). In some cases, SMARTag TMThe technique involves the generation of formylglycine (FGly) residues from cysteine ​​by an oxidation process by formylglycine generating enzyme (FGE) in the presence of an aldehyde tag, followed by conjugation of FGly to an alkylhydrazine-functionalized polynucleic acid molecule via hydrazine-Pictet-Spengler (HIPS) coupling (see Wu et al., “Site-specific chemical modification of recombinant proteins produced in mammalian cells by using the genetically encoded aldehyde tag,” PNAS 106(9):3000-3005 (2009); Agarwal et al., “A Pictet-Spengler ligation for protein chemical modification,” PNAS 110(1):46-51 (2013)).

[0265] In some cases, the enzyme catalysis process includes microbial transglutaminase (mTG). In some cases, the polynucleic acid molecule is conjugated to the antibody using a process catalyzed by microbial transglutaminase. In some cases, the covalent bond between the amide side chain of glutamine and the primary amine of the functionalized polynucleic acid molecule in the mTG catalysis recognition sequence is formed. In some cases, mTG is produced by Streptomyces mobarensis (see Strop et al., "Location matters: site of conjugation modulates stability and pharmacokinetics of antibody drug conjugates," Chemistry and Biology 20 (2) 161-167 (2013)).

[0266] In some cases, the polynucleic acid molecule is conjugated to the antibody by a method as described in PCT Publication No. WO2014 / 140317, which utilizes a sequence-specific transpeptidase.

[0267] In some cases, the polynucleic acid molecule is conjugated to the antibody by methods as described in U.S. Patent Publication Nos. 2015 / 0105539 and 2015 / 0105540.

[0268] Production of antibodies or antigen-binding fragments thereof

[0269] In some aspects, the polypeptides (e.g., antibodies and antigen-binding fragments) described herein are produced using any method known in the art for synthesizing polypeptides (e.g., antibodies), in particular by chemical synthesis or by recombinant expression, and preferably by recombinant expression technology.

[0270] In some cases, the antibody or antigen-binding fragment thereof is expressed recombinantly and the nucleic acid encoding the antibody or antigen-binding fragment is assembled from chemically synthesized oligonucleotides (e.g., as described in Kutmeier et al., 1994, BioTechniques 17:242), which involves synthesizing overlapping oligonucleotides that contain partial sequences encoding the antibody, annealing and ligating those oligonucleotides, and then amplifying the ligated oligonucleotides by PCR.

[0271] Alternatively, nucleic acid molecules encoding antibodies are generated from a suitable source (e.g., an antibody cDNA library, or a cDNA library generated from any tissue or cell that expresses immunoglobulins), optionally by PCR amplification using synthetic primers that hybridize to the 3' and 5' ends of the sequence, or by cloning using oligonucleotide probes specific for a particular gene sequence.

[0272] In some cases, the antibody or antigen-binding fragment thereof is optionally generated by immunizing an animal, such as a rabbit, to generate polyclonal antibodies, or more preferably, by generating monoclonal antibodies, e.g., as described by Kohler and Milstein (1975, Nature 256:495-497) or as described by Kozbor et al. (1983, Immunology Today 4:72) or Cole et al. (1985, Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96). Alternatively, clones encoding at least the Fab portion of the antibody are optionally obtained by screening a Fab expression library for clones of Fab fragments that bind to a specific antigen (e.g., as described in Huse et al., 1989, Science 246: 1275-1281) or by screening antibody libraries (see, e.g., Clackson et al., 1991, Nature 352: 624; Hane et al., 1997 Proc. Natl. Acad. Sci. USA 94: 4937).

[0273] In some aspects, a technique developed to produce "chimeric antibodies" by splicing genes from mouse antibody molecules with appropriate antigenic specificity with genes from human antibody molecules with appropriate biological activity is used (Morrison et al., 1984, Proc. Natl. Acad. Sci. 81: 851-855; Neuberger et al., 1984, Nature 312: 604-608; Takeda et al., 1985, Nature 314: 452-454). Chimeric antibodies are molecules in which different parts are derived from different animal species, such as antibodies with variable regions derived from mouse monoclonal antibodies and human immunoglobulin constant regions, such as humanized antibodies.

[0274] In some aspects, the techniques described for producing single-chain antibodies (U.S. Patent No. 4,694,778; Bird, 1988, Science 242: 423-42; Huston et al., 1988, Proc. Natl. Acad. Sci. USA 85: 5879-5883; and Ward et al., 1989, Nature 334: 544-54) are suitable for producing single-chain antibodies. Single-chain antibodies are formed by connecting the heavy chain and light chain fragments of the Fv region via an amino acid bridge to produce a single-chain polypeptide. The techniques for assembling functional Fv fragments in Escherichia coli (E. coli) (Skerra et al., 1988, Science 242: 1038-1041) are also optionally used.

[0275] In some aspects, an expression vector comprising the nucleotide sequence of the antibody or the nucleotide sequence of the antibody is transferred to a host cell by conventional techniques (e.g., electroporation, liposome transfection, and calcium phosphate precipitation), and the transfected cells are then cultured by conventional techniques to produce the antibody. In specific aspects, the expression of the antibody is regulated by a constitutive, inducible, or tissue-specific promoter.

[0276] In some aspects, a variety of host expression vector systems are used to express the antibodies or antigen-binding fragments thereof described herein. Such host expression systems represent vehicles by which antibody coding sequences are produced and subsequently purified, and also represent cells that express antibodies or binding fragments thereof in situ when transformed or transfected with appropriate nucleotide coding sequences. These include, but are not limited to, microorganisms such as bacteria (e.g., E. coli and Bacillus subtilis (B. subtilis)) transformed with recombinant bacteriophage DNA, plasmid DNA, or cosmid DNA expression vectors containing antibody or binding fragment coding sequences; yeast (e.g., Saccharomyces Pichia) transformed with recombinant yeast expression vectors containing antibody or binding fragment coding sequences; insect cell systems infected with recombinant viral expression vectors (e.g., baculovirus) containing antibody or binding fragment coding sequences; , cauliflower mosaic virus (CaMV) and tobacco mosaic virus (TMV)) or transformed with a recombinant plasmid expression vector (e.g., Ti plasmid) containing the antibody or its binding fragment encoding sequence; or a mammalian cell system (e.g., COS, CHO, BH, 293, 293T, 3T3 cells) containing a recombinant expression construct, the recombinant expression construct containing a promoter derived from the genome of a mammalian cell (e.g., metallothionein promoter) or a promoter derived from a mammalian virus (e.g., adenovirus late promoter; vaccinia virus 7.5K promoter).

[0277] For the long-term high-yield production of recombinant protein, preferably stable expression. In some cases, the cell line of stably expressed antibody is optionally engineered. Do not use the expression vector containing viral replication origin, but use the DNA and selectable marker controlled by appropriate expression control elements (such as promoter, enhancer, sequence, transcription terminator, polyadenylation site, etc.) to transform host cells. After introducing foreign DNA, the engineered cells are grown in enrichment medium for 1-2 days subsequently, and then switched to selective medium. The selectable marker in the recombinant plasmid gives resistance to selection, and allows cells to stably integrate plasmid into their chromosome and grow to form a focus, which is then cloned and expanded into a cell line. This method can be advantageously used for the cell line of engineered expression antibody or its binding fragment.

[0278] In some cases, a variety of selection systems are used, including but not limited to the herpes simplex virus thymidine kinase (Wigler et al., 1977, Cell 11:223), hypoxanthine-guanine phosphoribosyltransferase (Szybalska & Szybalski, 192, Proc. Natl. Acad. Sci. USA 48:202), and adenine phosphoribosyltransferase (Lowy et al., 1980, Cell 22:817) genes used in tk-, hgprt-, or aprt- cells, respectively. In addition, antimetabolite resistance was used as the basis for selection for the following genes: dhfr, which confers resistance to methotrexate (Wigler et al., 1980, Proc. Natl. Acad. Sci. USA 77:357; O'Hare et al., 1981, Proc. Natl. Acad. Sci. USA 78:1527); gpt, which confers resistance to mycophenolic acid (Mulligan & Berg, 1981, Proc. Natl. Acad. Sci. USA 78:2072); neo, which confers resistance to the aminoglycoside G-418 (Clinical Pharmacy 12:488-505; Wu and Wu, 1991, Biotherapy 13:57-63). 3:87-95; Tolstoshev, 1993, Ann. Rev. Pharmacol. Toxicol. 32:573-596; Mulligan, 1993, Science 260:926-932; and Morgan and Anderson, 1993, Ann. Rev. Biochem. 62:191-217; May, 1993, TIBTECH 11(5):155-215); and hygro, which confers resistance to hygromycin (Santerre et al., 1984, Gene 30:147). Methods that are well known in the art of recombinant DNA technology that can be used are described in Ausubel et al. (eds.), 1993, Current Protocols in Molecular Biology, John Wiley & Sons, NY; Kriegler, 1990, Gene Transfer and Expression, A Laboratory Manual, Stockton Press, NY; and Dracopoli et al. (eds.), 1994, Chapters 12 and 13 of Current Protocols in Human Genetics, John Wiley & Sons, NY; Colberre-Garapin et al., 1981, J. Mol. Biol. 150:1.

[0279] In some cases, the expression level of the antibody is increased by vector amplification (for review, see Bebbington and Hentschel, The use of vectors based on gene amplification for the expression of cloned genes in mammalian cells in DNA cloning, Volume 3 (Academic Press, New York, 1987)). When the marker in the vector system expressing the antibody is amplifiable, an increase in the level of inhibitors present in the host cell culture will increase the copy number of the marker gene. Since the amplified region is related to the nucleotide sequence of the antibody, the production of the antibody will also increase (Crouse et al., 1983, Mol. Cell Biol. 3: 257).

[0280] In some cases, any method known in the art for purifying or analyzing antibodies or antibody conjugates is used, for example, by chromatography (e.g., ion exchange chromatography, affinity chromatography, particularly affinity chromatography for specific antigens after protein A, and size sieving column chromatography), centrifugation, differential solubility, or by any other standard technique for purifying proteins. Exemplary chromatographic methods include, but are not limited to, strong anion exchange chromatography, hydrophobic interaction chromatography, size exclusion chromatography, and fast protein liquid chromatography.

[0281] Connectors

[0282] In some aspects, the linkers described herein are cleavable linkers or non-cleavable linkers. In some cases, the linkers are cleavable linkers. In other cases, the linkers are non-cleavable linkers.

[0283] In some cases, the joint is a non-polymer joint.Non-polymer joint refers to a joint that does not contain a monomer repeating unit generated by a polymerization process.Exemplary non-polymer joints include but are not limited to C1-C6 alkyl groups (e.g., C5, C4, C3, C2 or C1 alkyl groups), homobifunctional crosslinks, heterobifunctional crosslinks, peptide joints, traceless joints, self-sacrificial (self-immolative) joints, joints based on maleimide or combinations thereof.In some cases, non-polymer joints include C1-C6 alkyl groups (e.g., C5, C4, C3, C2 or C1 alkyl groups), homobifunctional crosslinks, heterobifunctional crosslinks, peptide joints, traceless joints, self-sacrificial joints, joints based on maleimide or combinations thereof.In other cases, non-polymer joints do not include more than two joints of the same type, for example, more than two homobifunctional crosslinks or more than two peptide joints.In further cases, non-polymer joints optionally include one or more reactive functional groups.

[0284] In some cases, the non-polymer linker does not encompass the polymers described above. In some cases, the non-polymer linker does not encompass the polymers encompassed by the polymer portion C. In some cases, the non-polymer linker does not encompass polyalkylene oxides (e.g., PEG). In some cases, the non-polymer linker does not encompass PEG.

[0285] In some cases, the linker includes a homobifunctional linker. Exemplary homobifunctional linkers include, but are not limited to, Lomant reagent dithiobis(succinimidyl propionate) DSP, 3′3′-dithiobis(sulfosuccinimidyl propionate) (DTSSP), disuccinimidyl suberate (DSS), bis(sulfosuccinimidyl) suberate (BS), disuccinimidyl tartrate (DST), disulfosuccinimidyl tartrate (sulfoDST), bis(succinimidyl succinate) ethylene glycol ester (EGS), disuccinimidyl glutarate (DSG), N,N′-disuccinimidyl carbonate (DSC), dimethyl adipimidate (DMA), dimethylpimelimidate (DMP), dimethyl suberimidate (DMS), dimethyl-3,3′-dithiobispropionimidate (DTB P), 1,4-di-3′-(2′-pyridyldithio)propionamido)butane (DPDPB), bismaleimidohexane (BMH), aryl halide-containing compounds (DFDNB) such as 1,5-difluoro-2,4-dinitrobenzene or 1,3-difluoro-4,6-dinitrobenzene, 4,4′-difluoro-3,3′-dinitrophenyl sulfone (DFDNPS), bis-[β-(4-azidosalicylamido)ethyl] disulfide (BASED), formaldehyde, glutaraldehyde, 1,4-butanediol diglycidyl ether, adipic acid dihydrazide, carbohydrazide, o-toluidine, 3,3′-dimethylbenzidine, benzidine, α,α′-p-diaminobenzidine, diiodo-p-xylenesulfonic acid, N,N′-ethylene-bis(iodoacetamide) or N,N′-hexamethylene-bis(iodoacetamide).

[0286] In some aspects, the linker includes a heterobifunctional linker. Exemplary heterobifunctional linkers include, but are not limited to, amine-reactive and sulfhydryl crosslinkers, such as N-succinimidyl 3-(2-pyridyldithio) propionate (sPDP), long-chain N-succinimidyl 3-(2-pyridyldithio) propionate (LC-sPDP), water-soluble long-chain N-succinimidyl 3-(2-pyridyldithio) propionate (sulfo-LC-sPDP), succinimidyloxycarbonyl-α-methyl-α-(2-pyridyldithio) toluene (sMPT), sulfosuccinimidyl-6-[α-methyl-α-(2-pyridyldithio) toluamido] hexanoic acid Ester (sulfo-LC-sMPT), succinimidyl-4-(N-maleimidomethyl) cyclohexane-1-carboxylate (sMCC), sulfosuccinimidyl-4-(N-maleimidomethyl) cyclohexane-1-carboxylate (sulfo-sMCC), m-maleimidobenzoyl-N-hydroxysuccinimide ester (MBs), m-maleimidobenzoyl-N-hydroxysulfosuccinimide ester (sulfo-MBs), N-succinimidyl (4-iodoacetyl) aminobenzoate (sIAB), sulfosuccinimidyl (4-iodoacetyl) aminobenzoate ( Succinimidyl-4-(p-maleimidophenyl)butyrate (sMPB), Succinimidyl-4-(p-maleimidophenyl)butyrate (SMPB), N-(γ-maleimidobutyryloxy)succinimidyl ester (GMBs), N-(γ-maleimidobutyryloxy)sulfosuccinimidyl ester (Sulfo-GMBs), Succinimidyl-6-((iodoacetyl)amino)hexanoate (sIAX), Succinimidyl-6-[6-(((iodoacetyl)amino)hexanoyl)amino]hexanoate (sIAXX) , succinimidyl 4-(((iodoacetyl)amino)methyl)cyclohexane-1-carboxylate (sIAC), succinimidyl 6-((((4-iodoacetyl)amino)methyl)cyclohexane-1-carbonyl)amino)hexanoate (sIACX), p-nitrophenyl iodoacetate (NPIA); carbonyl-reactive and thiol-reactive cross-linkers such as 4-(4-N-maleimidophenyl)butyric acid hydrazide (MPBH), 4-(N-maleimidomethyl)cyclohexane-1-carboxy-hydrazide-8 (M2C2H), 3-(2-pyridyldithio)propionyl hydrazide (PDPH);Amine-reactive and photoreactive crosslinkers such as N-hydroxysuccinimidyl-4-azidosalicylic acid (NHs-AsA), N-hydroxysulfosuccinimidyl-4-azidosalicylic acid (sulfo-NHs-AsA), sulfosuccinimidyl-(4-azidosalicylamido)hexanoate (sulfo-NHs-LC-AsA), sulfosuccinimidyl-2-(ρ-azidosalicylamido)ethyl-1,3′-dithiopropionate (sAsD), N-hydroxysuccinimidyl-4-azidobenzoate (HsAB), N-hydroxysulfosuccinimidyl-4-azidobenzoate (sulfo-Hs AB), N-succinimidyl-6-(4′-azido-2′-nitrophenylamino)hexanoate (sANPAH), sulfosuccinimidyl-6-(4′-azido-2′-nitrophenylamino)hexanoate (sulfo-sANPAH), N-5-azido-2-nitrobenzoyloxysuccinimide (ANB-NOs), sulfosuccinimidyl-2-(m-azido-o-nitrobenzamido)-ethyl-1,3′-dithiopropionate (sAND), N-succinimidyl-4 (4-azidophenyl) 1,3′-dithiopropionate (sADP), N-sulfosuccinimidyl (4- azidophenyl)-1,3′-dithiopropionate (sulfo-sADP), sulfosuccinimidyl 4-(ρ-azidophenyl) butyrate (sulfo-sAPB), sulfosuccinimidyl 2-(7-azido-4-methylcoumarin-3-acetamide)ethyl-1,3′-dithiopropionate (sAED), sulfosuccinimidyl 7-azido-4-methylcoumarin-3-acetate (sulfo-sAMCA), ρ-nitrophenyl diazopyruvate (ρNPDP), ρ-nitrophenyl-2-diazo-3,3,3-trifluoropropionate (PNP-DTP); thiol-reactive and photoreactive crosslinkers , such as 1-(ρ-azido salicylamido)-4-(iodoacetamido)butane (AsIB), N-[4-(ρ-azido salicylamido)butyl]-3′-(2′-pyridyldithio)propionamide (APDP), benzophenone-4-iodoacetamide, benzophenone-4-maleimide; carbonyl-reactive and photoreactive crosslinkers, such as ρ-azidobenzoylhydrazide (ABH); carboxylate-reactive and photoreactive crosslinkers, such as 4-(ρ-azido salicylamido)butylamine (AsBA); and arginine-reactive and photoreactive crosslinkers, such as ρ-azidophenylglyoxal (APG). ;

[0287] In some cases, the linker includes a reactive functional group. In some cases, the reactive functional group includes a nucleophilic group that is reactive to the electrophilic group present on the antibody. Exemplary electrophilic groups include carbonyls, such as aldehydes, ketones, carboxylic acids, esters, amides, enones, acyl halides or anhydrides. In some aspects, the reactive functional group is an aldehyde. Exemplary nucleophilic groups include hydrazides, oximes, amino groups, hydrazine, thiosemicarbazones, hydrazine carboxylates and aryl hydrazides.

[0288] In some aspects, the joint includes a maleimide group. In some cases, the maleimide group is also referred to as a maleimide spacer. In some cases, the maleimide group further encompasses caproic acid to form maleimidocaproyl (mc). In some cases, the joint includes maleimidocaproyl (mc). In some cases, the joint is maleimidocaproyl (mc). In other cases, the maleimide group includes a maleimidomethyl group, such as succinimidyl-4-(N-maleimidomethyl) cyclohexane-1-carboxylate (sMCC) or sulfosuccinimidyl-4-(N-maleimidomethyl) cyclohexane-1-carboxylate (sulfo-sMCC) as described above.

[0289] In some aspects, the maleimide group is a self-stabilized maleimide. In some cases, the self-stabilized maleimide is incorporated into the basic amino group of the adjacent maleimide using diaminopropionic acid (DPR), to provide the intramolecular catalysis of the hydrolysis of the sulfosuccinimide ring, thereby preventing the elimination reaction of maleimide by the reverse Michael reaction. In some cases, the self-stabilized maleimide is Lyon et al., "Self-hydrolyzing maleimides improve the stability and pharmacological properties of antibody-drug conjugates," Nat.Biotechnol.32 (10): maleimide groups described in 1059-1062 (2014). In some cases, the joint includes a self-stabilized maleimide. In some cases, the joint is a self-stabilized maleimide.

[0290] In some aspects, the joint includes a peptide portion. In some cases, the peptide portion comprises at least 2, 3, 4, 5 or 6 or more amino acid residues. In some cases, the peptide portion comprises at most 2, 3, 4, 5, 6, 7 or 8 amino acid residues. In some cases, the peptide portion comprises about 2, about 3, about 4, about 5 or about 6 amino acid residues. In some cases, the peptide portion is a cleavable peptide portion (for example, enzymatically or chemically). In some cases, the peptide portion is a non-cleavable peptide portion. In some cases, the peptide portion includes Val-Cit (valine-citrulline), Gly-Gly-Phe-Gly (SEQ ID NO:96), Phe-Lys, Val-Lys, Gly-Phe-Lys, Phe-Phe-Lys, Ala-Lys, Val-Arg, Phe-Cit, Phe-Arg, Leu-Cit, Ile-Cit, Trp-Cit, Phe-Ala, Ala-Leu-Ala-Leu (SEQ ID NO:97), or Gly-Phe-Leu-Gly (SEQ ID NO:98). In some cases, the linker comprises a peptide portion, such as: Val-Cit (valine-citrulline), Gly-Gly-Phe-Gly, Phe-Lys, Val-Lys, Gly-Phe-Lys, Phe-Phe-Lys, Ala-Lys, Val-Arg, Phe-Cit, Phe-Arg, Leu-Cit, Ile-Cit, Trp-Cit, Phe-Ala, Ala-Leu-Ala-Leu, or Gly-Phe-Leu-Gly. In some cases, the linker comprises Val-Cit. In some cases, the linker is Val-Cit.

[0291] In some aspects, the linker comprises a benzoic acid group or a derivative thereof. In some cases, the benzoic acid group or a derivative thereof comprises p-aminobenzoic acid (PABA). In some cases, the benzoic acid group or a derivative thereof comprises gamma-aminobutyric acid (GABA).

[0292] In some aspects, the joint includes one or more of a maleimide group, a peptide moiety and / or a benzoic acid group in any combination. In some aspects, the joint includes a combination of a maleimide group, a peptide moiety and / or a benzoic acid group. In some cases, the maleimide group is maleimidocaproyl (mc). In some cases, the peptide group is val-cit. In some cases, the benzoic acid group is PABA. In some cases, the joint includes a mc-val-cit group. In some cases, the joint includes a val-cit-PABA group. In other cases, the joint includes a mc-val-cit-PABA group.

[0293] In some aspects, the joint is a self-sacrificial joint or a self-eliminating joint. In some cases, the joint is a self-sacrificial joint. In other cases, the joint is a self-eliminating joint (e.g., a cyclized self-eliminating joint). In some cases, the joint includes a joint described in U.S. Patent No. 9,089,614 or PCT Publication No. WO2015038426.

[0294] In some aspects, the linker is a dendritic linker. In some cases, the dendritic linker comprises a branched multifunctional linker portion. In some cases, the dendritic linker is used to increase the molar ratio of polynucleotide to antibody. In some cases, the dendritic linker comprises a PAMAM dendrimer.

[0295] In some aspects, the linker is a traceless linker or a linker that does not leave a linker portion (e.g., an atom or linker group) to a binding portion (e.g., an antibody), a polynucleotide, a polymer, or an endosomal dissolution portion after cleavage. Exemplary traceless linkers include, but are not limited to, germanium linkers, silicon linkers, sulfur linkers, selenium linkers, nitrogen linkers, phosphorus linkers, boron linkers, chromium linkers, or phenylhydrazide linkers. In some cases, the linker is a traceless aryl-triazene linker as described in Hejesen et al., "A traceless aryl-triazene linker for DNA-directed chemistry," Org Biomol Chem 11(15): 2493-2497 (2013). In some cases, the linker is a traceless linker described in Blaney et al., "Traceless solid-phase organic synthesis," Chem. Rev. 102: 2607-2024 (2002). In some cases, the linker is a traceless linker described in U.S. Patent No. 6,821,783.

[0296] In some cases, the linker is a linker described in U.S. Pat. Nos. 6,884,869; 7,498,298; 8,288,352; 8,609,105; or 8,697,688; U.S. Patent Publication Nos. 2014 / 0127239; 2013 / 028919; 2014 / 286970; 2013 / 0309256; 2015 / 037360; or 2014 / 0294851; or PCT Publication Nos. WO2015057699; WO2014080251; WO2014197854; WO2014145090; or WO2014177042.

[0297] In some cases, the joint is a C1-C6 alkyl group. In some cases, the joint is a C1-C6 alkyl group, for example, a C5, C4, C3, C2 or C1 alkyl group. In some cases, the C1-C6 alkyl group is an unsubstituted C1-C6 alkyl group. As used in the context of a joint and particularly in the context of a joint, an alkyl group means a saturated straight or branched hydrocarbon radical containing up to six carbon atoms. In some cases, the joint is a non-polymer joint. In some cases, the joint includes a homobifunctional joint or a heterobifunctional joint as described above. In some cases, the joint includes a heterobifunctional joint. In some cases, the joint includes or comprises sMCC. In other cases, the joint includes a heterobifunctional joint optionally conjugated to a C1-C6 alkyl group. In other cases, the joint includes a sMCC optionally conjugated to a C1-C6 alkyl group. In other cases, the joint does not include a homobifunctional joint or a heterobifunctional joint as described above.

[0298] Pharmaceutical preparations

[0299] In some aspects, the pharmaceutical preparations described herein are administered to a subject by a variety of routes of administration, including but not limited to parenteral (e.g., intravenous, subcutaneous, intramuscular), oral, intranasal, buccal, rectal, or transdermal routes of administration. In some cases, the pharmaceutical compositions described herein are formulated for parenteral (e.g., intravenous, subcutaneous, intramuscular, intraarterial, intraperitoneal, intrathecal, intracerebral, intraventricular, or intracranial) administration. In other cases, the pharmaceutical compositions described herein are formulated for oral administration. In other cases, the pharmaceutical compositions described herein are formulated for intranasal administration.

[0300] In some aspects, pharmaceutical formulations include, but are not limited to, aqueous liquid dispersions, self-emulsifying dispersions, solid solutions, liposomal dispersions, aerosols, solid dosage forms, powders, immediate release formulations, controlled release formulations, fast melt formulations, tablets, capsules, pills, delayed release formulations, extended release formulations, pulsatile release formulations, multiparticulate formulations (e.g., nanoparticulate formulations), and mixed immediate and controlled release formulations.

[0301] In some cases, the pharmaceutical preparation includes a multi-particle preparation. In some cases, the pharmaceutical preparation includes a nanoparticle preparation. In some cases, the nanoparticles include cMAP, cyclodextrin or lipid. In some cases, the nanoparticles include solid lipid nanoparticles, polymer nanoparticles, self-emulsifying nanoparticles, liposomes, microemulsions or micellar solutions. Other exemplary nanoparticles include but are not limited to paramagnetic nanoparticles, superparamagnetic nanoparticles, metal nanoparticles, fullerene-like materials, inorganic nanotubes, dendritic polymers (such as metal chelates with covalent attachment), nanofibers, nanohorns, nano-onions, nanorods, nanorods and quantum dots. In some cases, the nanoparticles are metal nanoparticles, such as nanoparticles of scandium, titanium, vanadium, chromium, manganese, iron, cobalt, nickel, copper, zinc, yttrium, zirconium, niobium, molybdenum, ruthenium, rhodium, palladium, silver, cadmium, hafnium, tantalum, tungsten, rhenium, osmium, iridium, platinum, gold, gadolinium, aluminum, gallium, indium, tin, thallium, lead, bismuth, magnesium, calcium, strontium, barium, lithium, sodium, potassium, boron, silicon, phosphorus, germanium, arsenic, antimony, and combinations, alloys, or oxides thereof.

[0302] In some cases, the nanoparticle includes a core or a core and a shell (as in a core-shell nanoparticle).

[0303] In some cases, the nanoparticles are further coated with molecules for attaching functional elements (e.g., to one or more of a polynucleic acid molecule or a binding moiety (e.g., an antibody described herein)). In some cases, the coating comprises chondroitin sulfate, dextran sulfate, carboxymethyl dextran, alginic acid, pectin, carrageenan, fucoidan, agar, porphyran, karaya gum, gellan gum, xanthan gum, hyaluronic acid, glucosamine, galactosamine, chitosan (or chitosan), polyglutamic acid, polyaspartic acid, lysozyme, cytochrome C, ribonuclease, trypsinogen, chymotrypsinogen, α-chymotrypsin, polylysine, polyarginine, histone, protamine, ovalbumin or dextrin or cyclodextrin. In some cases, the nanoparticles include graphene-coated nanoparticles.

[0304] In some cases, the nanoparticles have at least one dimension that is less than about 500 nm, 400 nm, 300 nm, 200 nm, or 100 nm.

[0305] In some cases, the nanoparticle formulation comprises paramagnetic nanoparticles, superparamagnetic nanoparticles, metal nanoparticles, fullerene-like materials, inorganic nanotubes, dendritic macromolecules (such as metal chelates with covalent attachment), nanofibers, nanohorns, nanoonions, nanorods, nanoropes or quantum dots. In some cases, polynucleic acid molecules or binding moieties (e.g., antibodies) described herein are directly or indirectly conjugated to nanoparticles. In some cases, at least 1, 5, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100 or more polynucleic acid molecules or binding moieties described herein are directly or indirectly conjugated to nanoparticles.

[0306] In some aspects, the pharmaceutical preparation comprises a delivery vector, such as a recombinant vector, which delivers the polynucleic acid molecules into cells. In some cases, the recombinant vector is a DNA plasmid. In other cases, the recombinant vector is a viral vector. Exemplary viral vectors include vectors derived from adeno-associated viruses, retroviruses, adenoviruses or alphaviruses. In some cases, the recombinant vector capable of expressing polynucleic acid molecules provides stable expression in target cells. In other cases, a viral vector providing transient expression of polynucleic acid molecules is used.

[0307] In some aspects, the pharmaceutical preparation includes a carrier or carrier material selected based on compatibility with the compositions disclosed herein and the release profile properties of the desired dosage form. Exemplary carrier materials include, for example, adhesives, suspending agents, disintegrants, fillers, surfactants, solubilizers, stabilizers, lubricants, wetting agents, diluents, etc. Pharmaceutically compatible carrier materials include, but are not limited to, gum arabic, gelatin, colloidal silicon dioxide, calcium glycerophosphate, calcium lactate, maltodextrin, glycerol, magnesium silicate, polyvinyl pyrrolidone (PVP), cholesterol, cholesterol ester, sodium caseinate, soy lecithin, taurocholic acid, phosphatidylcholine, sodium chloride, tricalcium phosphate, dipotassium hydrogen phosphate, cellulose and cellulose conjugates, sodium saccharide stearoyl lactylate, carrageenan, monoglyceride, diglyceride, pregelatinized starch, etc. See, e.g., Remington: The Science and Practice of Pharmacy, 19th ed. (Easton, Pa.: Mack Publishing Company, 1995); Hoover, John E., Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pennsylvania 1975; Liberman, H. A. and Lachman, L., eds., Pharmaceutical Dosage Forms, Marcel Decker, New York, NY, 1980; and Pharmaceutical Dosage Forms and Drug Delivery Systems, 7th ed. (Lippincott Williams & Wilkins 1999).

[0308] Treatment options

[0309] In some aspects, the pharmaceutical composition described herein is used for therapeutic applications. In some aspects, the pharmaceutical composition is used once a day, twice a day, three times a day or more. Every day, every day, every other day, five days a week, once a week, every other week, two weeks a month, three weeks a month, once a month, twice a month, three times a month or more. The pharmaceutical composition is used for at least 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months, 18 months, 2 years, 3 years or more.

[0310] In some aspects, one or more pharmaceutical compositions are used simultaneously, sequentially or at intervals for a period of time. In some aspects, one or more pharmaceutical compositions are used simultaneously. In some cases, one or more pharmaceutical compositions are used sequentially. In other cases, one or more pharmaceutical compositions are used at intervals for a period of time (e.g., the first application of the first pharmaceutical composition is on the first day, then at least 1, 2, 3, 4, 5 days or more days are spaced before applying at least the second pharmaceutical composition).

[0311] In some aspects, two or more different pharmaceutical compositions are co-administered. In some cases, two or more different pharmaceutical compositions are co-administered simultaneously. In some cases, two or more different pharmaceutical compositions are co-administered successively, with no time gap between administrations. In other cases, two or more different pharmaceutical compositions are co-administered successively, with a gap of about 0.5 hour, 1 hour, 2 hours, 3 hours, 12 hours, 1 day, 2 days or longer between administrations.

[0312] If the patient's condition does improve, the composition is continued to be administered, at the doctor's discretion; alternatively, the dose of the administered composition is temporarily reduced or temporarily suspended for a certain length of time (i.e., a "drug holiday"). In some cases, the length of the drug holiday ranges from 2 days to 1 year, including, by way of example only, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 10 days, 12 days, 15 days, 20 days, 28 days, 35 days, 50 days, 70 days, 100 days, 120 days, 150 days, 180 days, 200 days, 250 days, 280 days, 300 days, 320 days, 350 days, or 365 days. The dosage reduction during the drug holiday is 10%-100%, including, by way of example only, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 100%.

[0313] Once the patient's condition improves, a maintenance dose is administered if necessary. Subsequently, depending on the change in symptoms, the dosage or frequency of administration, or both, may be reduced to a level at which the improvement in the disease, disorder or condition is maintained.

[0314] In some aspects, the amount of a given medicament corresponding to such an amount varies according to factors such as the specific compound, the severity of the disease, the characteristics of the object or host in need of treatment (e.g., body weight), but it is still routinely determined in a manner known in the art according to the specific circumstances related to the case, including, for example, the specific medicament administered, the route of administration, and the object or host treated. In some cases, the desired dosage is conveniently presented in a single dose or in divided doses, which are administered simultaneously (or in a short period of time) or at appropriate intervals, for example, as 2, 3, 4 or more sub-doses per day.

[0315] The foregoing ranges are indicative only, as the number of variables regarding individual treatment regimens is enormous, and considerable deviations from these recommended values ​​are not uncommon. Such dosages vary according to a number of variables, not limited to the activity of the compound used, the disease or condition to be treated, the mode of administration, the needs of the individual subject, the severity of the disease or condition to be treated, and the judgment of the practitioner.

[0316] In some aspects, the toxicity and therapeutic efficacy of such treatment regimens are determined by standard pharmaceutical procedures in cell culture or experimental animals, including but not limited to the determination of LD50 (50% lethal dose to a population) and ED50 (50% therapeutically effective dose to a population). The dose ratio between toxic effects and therapeutic effects is the therapeutic index, and is expressed as the ratio of LD50 to ED50. Compounds showing high therapeutic indexes are preferred. The data obtained from cell culture assays and animal studies are used to formulate dosage ranges for humans. The dosage of such compounds is preferably within a circulating concentration range that includes ED50 and has minimal toxicity. Depending on the dosage form used and the route of administration used, the dosage varies within this range.

[0317] Kits / Products

[0318] In certain aspects, kits and articles for use with one or more of the compositions and methods described herein are disclosed herein. Such kits include a carrier, package or container compartmentalized to receive one or more containers (such as vials, tubes, etc.), each container containing one of the individual elements to be used in the methods described herein. Suitable containers include, for example, bottles, vials, syringes and test tubes. In one embodiment, the container is formed of various materials such as glass or plastic.

[0319] The articles of manufacture provided herein contain packaging materials. Examples of pharmaceutical packaging materials include, but are not limited to, blister packs, bottles, tubes, bags, containers, bottles, and any packaging material suitable for a selected formulation and intended mode of administration and treatment.

[0320] For example, the container comprises a target nucleic acid molecule described herein.Such a kit optionally includes an identifying description or label or instructions for its use in the methods described herein.

[0321] The kit typically includes a label listing the contents and / or instructions for use, and a package insert with instructions for use. A set of instructions will also typically be included.

[0322] In one embodiment, the label is on or associated with the container. In one embodiment, the label is on the container when the letters, numbers or other characters forming the label are attached, molded or etched on the container itself; when the label is present in a receptacle or carrier that also holds the container (e.g., as a package insert), the label is associated with the container. In one embodiment, the label is used to indicate that the contents will be used for a specific therapeutic application. The label also indicates guidance about the contents such as use in the methods described herein.

[0323] In certain aspects, the pharmaceutical composition is presented in a package or dispenser device containing one or more unit dosage forms, and the unit dosage form contains a compound provided herein. For example, the package comprises metal or plastic foil, such as a blister package. In one embodiment, the package or dispenser device is accompanied by instructions for use. In one embodiment, the package or dispenser is also accompanied by a notice in a form specified by a government agency that regulates drug manufacturing, use or sales, and associated with a container, which reflects that the agency approves the drug form for human or veterinary administration. Such a notice is, for example, a label approved by the U.S. Food and Drug Administration for prescription drugs or an approved product insert. In one embodiment, a composition containing a compound provided herein formulated in a compatible pharmaceutical carrier is also prepared, the composition is placed in an appropriate container, and is marked for treatment of the indicated condition.

[0324] Specific terms

[0325] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those generally understood by those skilled in the art to which the subject matter to which protection is requested belongs. It should be understood that the foregoing general description and the following detailed description are exemplary and illustrative only and are not intended to limit any subject matter to which protection is requested. In this application, unless otherwise specifically stated, the use of the singular includes the plural. It must be noted that, as used in this specification and the appended claims, the singular forms "one", "a kind of" and "the" include plural referents unless the context clearly states otherwise. In this application, unless otherwise stated, the use of "or" means "and / or". In addition, the use of the term "including" and other forms such as "include", "includes" and "included" is non-restrictive.

[0326] As used herein, ranges and amounts may be expressed as "about" a particular value or range. "About" also includes the exact amount. Thus, "about 5 μL" means "about 5 μL" and also means "5 μL". Typically, the term "about" includes amounts that are expected to be within experimental error.

[0327] The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described.

[0328] As used herein, the terms "individual," "subject," and "patient" mean any mammal. In some aspects, the mammal is a human. In some aspects, the mammal is a non-human. None of these terms require or are limited to situations characterized by supervision (e.g., continuous or intermittent) by a healthcare worker (e.g., a doctor, a registered nurse, a nurse practitioner, a physician's assistant, a caregiver, or a hospice worker).

[0329] As used herein, the term "DMD subject" means any mammal suffering from or expected to suffer from DMD and / or having a genetic predisposition (such as a DMD gene mutation) relevant to DMD. In some aspects, the mammal is a person. In some aspects, the mammal is a non-human.

[0330] Example

[0331] These examples are provided for illustrative purposes only, and are not intended to limit the scope of the claims provided herein.

[0332] Example 1: In silico identification of phosphorodiamidate morpholino oligomers (PMOs) with predicted high hDMD exon 44 skipping activity

[0333] Several algorithms have been reported for identifying regions on the hDMD pre-mRNA that can be modified for exon 44 skipping activity. Based on reported exon 44 skipping predictions, PMO screening focused on a specific region closest to the exon 44 acceptor site (Echigoya et al. 2015, PLoS ONE 10(3):e0120058).

[0334] PMOs with hDMD exon 44 skipping activity were identified by computer simulation. Figure 1 Exon 44 skipping activity of PMO 30mer and 25mer is shown. PMOs that bind to the exon 44 acceptor site are labeled based on the distance (in bases) of their 3' end from the acceptor site. Large squares represent PMOs with exon 44 skipping activity, and dots represent PMOs with predicted exon 44 skipping activity. The acceptor site for exon 44 is 148 base pairs in length (source: NCBI à Homo sapiens dystrophin (DMD), transcript variant Dp427m, mRNA; accession number NM_004006) 5'-GCGATTTGACAGATCTGTTGAGAAATGGCGGCGTTTTCATTATGATATAAAGATATTTAATCAGTGGCTAACAGAAGCTGAACAGTTTCTCAGAAAGACACAAATTCCTGAGAATTGGGAACATGCTAAATACAAATGGTATCTTAAG-3' (SEQ ID NO: 134), and the most active exon 44 skipping PMO was observed to interact between the acceptor site at position 0 (Ac0) and the acceptor site at position 20 (Ac20). Twelve PMOs (30mers) with predicted activities greater than 70% for hDMD exon 44 skipping were further identified (see Figure 1 The sequences of these 12 PMOs targeting the hDMD exon 44 acceptor site are shown in Table 1.

[0335] result

[0336] Overall, 12 phosphorodiamidate morpholino oligomers (PMOs) with the highest predicted exon 44 skipping activities were selected based on an algorithm that facilitates identification of regions on hDMD pre-mRNA that are potentially amenable to exon 44 skipping activity.

[0337] Example 2: Identification and selection of PMOs with high exon 44 skipping activity in healthy primary human skeletal muscle cells (hSkMC)

[0338] The selected 12 PMOs with high exon 44 skipping predicted activity from Example 1 were synthesized for additional in vitro assays in healthy primary human skeletal muscle cells. Primary human skeletal muscle cells (SkMC) (Gibco, #A11440) were obtained commercially. According to the manufacturer's instructions, these cells were plated on 24-well plates (Gibco, #1970788) (50,000 cells / well) coated with type 1 collagen for 2 days in DMEM supplemented with 2% horse serum and 1x ITS (Gibco, #1933286) to pre-differentiate and induce the formation of myotubes. Before transfection, the cells were incubated for 24 hours without antibiotics. PMO was synthesized by GeneTools. PMO was formulated in water, heated at 65-70°C for 5 minutes, and diluted into warm culture medium with 2 μM Endo-Porter (Gene Tools, #EP6P1-1) to promote the absorption of PMO into cells. Cells were harvested 48 hours after transfection. Cells were collected in Trizol and stored at -80°C until processed for RNA isolation using the Direct-zol-96 RNA Isolation Kit (Zymo) according to the manufacturer's instructions. Total RNA concentration was quantified spectroscopically. 100-200 ng of purified RNA was converted to cDNA using a high-capacity cDNA reverse transcription kit (Applied Biosystems) and a SimpliAmp thermal cycler (Applied Biosystems). DNA fragments representing total DMD mRNA or mRNA with exon 44 skipped were amplified by PCR using TaqMan Fast Advanced Master Mix (Applied Biosystems) and hDMD TaqMan assay Hs01049401_m1 (VIC-MGB, Thermo Fisher Scientific) or a custom TaqMan assay specific for the hDMD exon 43 / 45 junction (FAM-MGB, forward: 5'-CTGTGGAAAGGGTGAAGCTA-3' (SEQ ID NO:90), reverse: 5'-GACAAGGGAACTCCAGGATG-3' (SEQ ID NO:91), probe: 5'-AGCTCTCTCCCAGCTTGATTTCCA-3' (SEQ ID NO:92)). For quantification of exon 44 skipping levels by gel electrophoresis, PCR reactions were incubated at 95°C for 20 sec, followed by 32 cycles of incubation at 95°C for 1 sec and 60°C for 20 sec using QuantStudio 7Flex (Applied Biosystems).PCR products were diluted 4:1 with TAE-loaded buffer and loaded onto 24-well 4% TAE gels (Embi Tec, #GG3807) containing GelGreen. PCR products were separated by electrophoresis (50V for 2 hours). ChemiDoc TM XRS+ (Bio-Rad) was used to quantify the band intensity corresponding to total DMD products and skipped DMD products by optical density determination.

[0339] result

[0340] The selected 12 kinds of PMO were transfected in primary healthy HSkMC, which were pre-differentiated into myotubes using Endoporter as described above and harvested 48 hours after transfection. Total DMD mRNA and DMD mRNA skipped by exon 44 were amplified by RT-qPCR. PCR products were separated by gel electrophoresis and quantified by densitometry. The presented data were fitted with a specific binding algorithm (single site). The best fit values ​​of binding affinity (Kd=EC50) and (Bmax=maximum jump%) are reported in Table 9. These results are from 2 independent experiments performed in duplicate using 1, 3 and 10 μM or 0.1, 1 and 10 μM PMOs.

[0341] Table 9

[0342]

[0343] result

[0344] Figure 2 Shown is the dose-dependent response of exon 44 skipping activity of selected 12 PMOs (30-mers) targeting the acceptor site of human DMD exon 44 in healthy primary human skeletal muscle cells (hSkMCs).

[0345] The results of the assay in HSkMC indicated that the maximum hDMD exon 44 skipping activity of the tested PMOs was greater than 75%, confirming their predicted activities, as shown in Tables 9 and Figure 2 In addition, the dose responses of exon 44 skipping active cells of the selected 12 PMOs (30-mers) all showed similar binding affinities (Kd), as shown in Table 9 (0.3-1.0 mM; single site, specific binding algorithm).

[0346] Overall, in vitro assays of the activities of the 12 selected PMOs confirmed their predicted activities for exon 44 skipping.

[0347] Example 3: Selection of length-optimized exon 44 skipping PMOs in human healthy immortalized myoblasts

[0348] In order to select the PMO with the optimal length / activity ratio, the predicted free binding energy (ΔG) of the shorter PMO oligonucleotide targeting the Ac0-Ac10 site to target the exon 44 receptor site was analyzed. Table 11 shows the predicted free binding energy (ΔG (kcal / mol)) of the exon 44 receptor site of PMO targeting hDMD of various lengths. ΔG was calculated using DNA-DNA oligonucleotide hybridization as a first approximation (IDT oligonucleotide analyzer).

[0349] Table 11

[0350]

[0351] result

[0352] The relationship between the length of the PMO molecule and the predicted free binding energy (ΔG) of the DMD target mRNA is characterized to identify the PMO oligonucleotides that retain the maximum activity and the sequence length is less than 30 polymers. It is predicted that the shorter sequence has a lower binding energy relative to the 30 polymer parent sequence (Table 11). According to the predicted free binding energy (ΔG (kcal / mol)) of the PMO in Table 11, 13 different PMOs targeting the receptor site position between +2 and +10 and the length between 26 and 28 oligonucleotides and the apparent ΔG<-50kcal / mol are selected for synthesis (see the box in Table 11). They include the PMO (hEx_44_Ac24_28, hEx_44_Ac25_28 and hEx_44_Ac28) with hDMD exon 44 skipping predicted activity>50% (data not shown). The sequence of each of these 13 PMOs is shown in Table 10. In addition, a shorter 25-mer PMOhEx_44_Ac2_25 with a predicted binding energy (ΔG) of -40.8 kcal / mol was included as an internal control (see Table 11). The selected 13 PMOs with a free binding energy (ΔG) <-50 kcal / mol and a 25-mer as a control were synthesized in the range of 26 to 28-mers for further in vitro screening of exon 44 skipping activity in primary and immortalized human skeletal muscle cells (hSkMCs).

[0353] In vitro exon 44 skipping screening assay

[0354] Human myoblast cell lines were obtained from the AssociationInstitut de Myologie-Centre de Recherche en Myologie (UMRS 787INSERM and SorbonneUniversité, France) through MyoBank, which is affiliated with EuroBioBank (grant reference AC-2019-3502). The myoblast cell line was derived from the fascia lata (AB1167C20FL) of a 20-year-old healthy male donor. The cells were grown in Promocell growth medium (C-23160) supplemented with 5% FBS at a cell density of less than 80%. Immortalized myoblasts were seeded into 24-well plates at 50,000 cells / well in growth medium, grown to confluence and then differentiated. In order to be induced to differentiate into myotubes, the cells were rinsed with DMEM and then incubated in differentiation medium (DMEM, 50 μg / mL gentamicin, 10 μg / mL insulin) for 3-4 days. Before transfection, cells were incubated for 24 h without antibiotics. PMO was synthesized by GeneTools and formulated in water, heated at 65-70 ° C for 5 minutes, and diluted into warm culture medium with 2 μM Endo-Porter (Gene Tools, # EP6P1-1) to promote PMO absorption into cells. Experiments were performed with 0.3, 1, 3.3 and 10 μM PMO. After 48 hours, cells were harvested and RNA isolation and cDNA synthesis were performed as previously described. For quantification by qPCR, the PCR reaction was cycled 40 times, and the amplification of the PCR product in which the total PCR product and exon 44 were skipped was monitored using QuantStudio6 or 7Flex real-time PCR instruments (Applied Biosystems). Data were analyzed by QuantStudioTM real-time PCR software v1.3 (Applied Biosystems). The mRNA% skipped by exon 44 was calculated as 100*2 (CT (total)-CT (skipped)). Primers used: hDMD TaqMan assay Hs01049401_m1 (VIC-MGB, Thermo Fisher Scientific) or a custom TaqMan assay specific for the hDMD exon 43 / 45 junction (FAM-MGB, forward: 5'-CTGTGGAAAGGGTGAAGCTA-3' (SEQ ID NO:90), reverse: 5'-GACAAGGGAACTCCAGGATG-3' (SEQ ID NO:91), probe: 5'-AGCTCTCTCCCAGCTTGATTTCCA-3' (SEQ ID NO:92)).The dose response of the selected PMOs was fitted using a specific binding algorithm (single site). Total DMD mRNA and exon 44 skipped DMD mRNA were monitored by RT-qPCR. The dose response of the selected guide PMOs was fitted using a specific binding algorithm (single site).

[0355] Transfection of the selected PMOs into myotubes derived from healthy immortalized hSkMCs showed that 3 different PMOs of various sizes had exon 44 skipping activity superior to the other PMOs. The 26-mer hEx44_Ac7_26 targeting receptor site 7, the 27-mer hEx44_Ac5_27 targeting receptor site 5, and the 28-mer hEx44_Ac4_28 targeting receptor site 4 showed at least 75% or greater exon 44 skipping activity at a concentration of 10 μM ( Figure 3 Of these three PMOs, the PMO hEx44_Ac7-26mer exhibited the best length / activity ratio and was selected as the PMO molecule for further evaluation via in vitro and in vivo assays.

[0356] Based on exon 44 skipping active myotubes derived from healthy immortalized hSkMCs, the 26-mer PMO hEx44_Ac7-26 (5'-CGCCGCCATTTCTCAACAGATCTGTC-3' (SEQ ID NO: 118)) had the best exon 44 skipping activity among these three PMOs.

[0357] Example 4: hEx44_Ac7_26 induces exon 44 skipping activity in healthy human cells and cells derived from DMD patients

[0358] Immortalized and primary human skeletal muscle cells (HSkMC) (DMD cells: AB1323-immortalized; 47811-primary; 47898-primary; healthy cells: AB1167-immortalized; MB07-primary; MB09-primary) were obtained from Institut de Myologie (IoM) (immortalized) in Paris, France and Besta Institute (primary) in Italy. 2 primary cells and 1 immortalized cell line were each derived from a DMD patient with exon 45 deletion. Immortalized cells were grown in skeletal muscle growth medium (Promocell, C-23160). Primary cells were grown in GM consisting of DMEM+Glutamax (Gibco, catalog number 10566-016) supplemented with 20% FBS (Corning), 1% penicillin / streptomycin (ThermoFisher), 10 μg / ml insulin (Sigma), 25 ng / ml hFGF (Stemcell Technologies), 10 ng / ml EGF (Stemcell Technologies), and plated on 24-well plates coated with 1% Matrigel (20,000 cells / well). According to the manufacturer's instructions, myoblasts were induced to form myotubes in DMEM+Glutamax (Gibco) supplemented with a skeletal muscle cell differentiation medium supplement mixture (Promocell, catalog number C-39366) and 1% penicillin / streptomycin for 2 days. PMO was synthesized by GeneTools. PMO was formulated in water, heated at 65-70°C for 5-10 minutes, and diluted into warm culture medium. Cells were harvested 48h after transfection. Cells were collected in Trizol and stored at -80 °C until processed for RNA isolation using Direct-zol-96 RNA Isolation Kit (Zymo) according to the manufacturer's instructions. Total RNA concentration was quantified spectroscopically. cDNA was prepared from 100-500 ng of purified RNA using a high-capacity cDNA reverse transcription kit (Applied Biosystems) in a SimpliAmp thermal cycler (Applied Biosystems). 40 ng of cDNA was divided into droplets in triplicate in a combination of a QX200 automatic droplet generator (BioRad) with a Taqman probe (ThermoFischer), 2X ddPCR supermix (without dUTP) (BioRad) and BamHI restriction enzyme (BioRad). After droplet generation, the mixture was loaded into a deep well C1000 Touch thermal cycler (BioRad) for PCR amplification.Absolute quantification of target RNA molecules was measured in a QX200 droplet digital PCR system (BioRad) using QXManager software (BioRad). Exon skipping percentage was calculated by normalizing the count of the targeted exon relative to total gene expression. Primers used: hDMD TaqMan assay Hs01049401_m1 (VIC-MGB, Thermo Fisher Scientific) or a custom TaqMan assay specific to hDMD exon 43 / 45 junction (FAM-MGB, forward: 5'-CTGTGGAAAGGGTGAAGCTA-3' (SEQ ID NO: 90), reverse: 5'-GACAAGGGAACTCCAGGATG-3' (SEQ ID NO: 91), probe: 5'-AGCTCTCTCCCAGCTTGATTTCCA-3' (SEQ ID NO: 92)).

[0359] result

[0360] Exon 44 skipping activity in primary and immortalized healthy or DMD patients was assessed using hEx44_Ac7_26-transfected myotubes derived from exon 45 deletions using ddPCR, a sensitive and highly accurate method for quantifying exon skipping. These in vitro assays using hEx44_Ac7_26 were performed in myotubes derived from healthy subjects and DMD patients with exon 45 deletions suitable for exon 44 skipping therapy. Figure 4C As shown in , hEx44_Ac7_26 is able to induce exon 44 skipping in healthy myotubes and myotubes derived from DMD patients, and the exon 44 skipping activity in these cells is dose-dependent. Interestingly, the results indicate that hEx44_Ac7_26 has higher exon 44 skipping activity in DMD cells than in healthy cells. In cells derived from DMD patients transfected with hEx44_Ac7_26, exon 44 skipping activity was as high as 60% ( Figure 4C ), while in healthy primary or immortalized cells, exon 44 skipping activity is only up to 10% ( Figure 4A-4B Without being bound by any particular theory, it is possible that skipping of specific exons in dystrophin pre-mRNA in healthy cells can lead to destabilization of the skipped mRNA and a decrease in total dystrophin mRNA, while hEx44_Ac7_26 induced frameshift recovery and a significant increase in the levels of skipped DMD transcripts in cells derived from DMD patients, which was highly correlated with an increase in total dystrophin mRNA expression levels to WT levels.

[0361] In general, hEx44_Ac7_26 was able to induce exon 44 skipping in both healthy human cells and cells derived from DMD patients, and the exon 44 skipping activity in cells derived from DMD patients was greater than that in healthy human cells.

[0362] Example 5: hEx44_Ac7_26 induces dystrophin restoration in myotubes derived from DMD patients

[0363] Human primary myoblasts from healthy subjects and DMD patients were expanded in skeletal muscle growth medium (GM; Zenbio). On day 0, 15,000 human primary myoblasts per well were seeded in GM in a 96-well MyoScreen CYTOO plate (CYTOO) coated with 10 μg / ml fibronectin (Invitrogen). One day after inoculation (day 1), the growth medium was replaced with a differentiation medium (DM) consisting of Dulbecco's modified Eagle's medium: nutrient mixture F12 (DMEM / F12; Invitrogen), 2% horse serum (HS; GE Healthcare), 100U / ml penicillin and 100μg / ml streptomycin (Invitrogen). On day 3 or day 6, compounds (PMO and AOC) were added to DMD cells without culture medium renewal for 6 days or 3 days, respectively. For PMO treatment, PMO was synthesized by GeneTools. Before being added to the culture medium, PMO was heated at 70°C for 5 minutes and then slowly cooled. Under this specific condition, 1 μM of Endo-Porter (GeneTools) was added to these wells at the same time as a delivery agent. For each experiment, a simulated condition corresponding to vehicle + / -Endo-Porter was included to serve as a negative control. On the 9th day, after being fixed with 10% formalin (Sigma-Aldrich) for 30 min, the myotubes were washed three times in Dulbecco's phosphate-buffered saline (DPBS; Invitrogen) and permeabilized in 0.5% Triton X-100 (Sigma-Aldrich). After blocking in 1% bovine serum albumin (BSA; Sigma-Aldrich), the cells were incubated with primary antibodies prepared in blocking solution: myotubes were stained with a troponin T-specific antibody (ab45932 Abcam) or a myosin heavy chain-specific antibody (14-6503-82 Thermo Fisher). C-terminal and N-terminal dystrophin were stained using NCL-Dys2 and NCL-DysB antibodies (Leica), respectively. After washing three times with DPBS, secondary antibodies prepared in BSA 1% were added to the wells together with Hoechst 33342. Cells were finally washed three times in DPBS before harvesting. Quantitative microscopy was performed using an Operetta HCS imaging system with a 10× / 0.3NA objective (PerkinElmer). Images were analyzed using scripts developed in Acapella software (PerkinElmer), including custom segmentation of myotubes and nuclei.Myotubes were defined as areas that were positive for skeletal muscle differentiation markers troponin-T or myosin heavy chain (MHC) and met optimized specific filtering conditions, such as minimum / maximum area, maximum orientation, minimum elongation, and minimum / maximum length of myotubes. Nuclei were counted to define the total number of nuclei. The fusion index (FI) was calculated as the number of nuclei within the stained area of ​​the myotube divided by the total number of nuclei and expressed as a percentage. After excluding myotubes that touched the image border, the entire intact myotube was finally used to obtain the myotube area and the average intensity of dystrophin. Three healthy donors were included in each experiment. The average intensity of dystrophin expression in these healthy myotubes was calculated and used as a reference for assessing the percentage of dystrophin recovery under DMD treatment conditions, calculated as: dystrophin recovery % = (IDMD treatment-IDMD simulation) / (I average healthy-IDMD simulation). The percentage of positive myotubes under each condition was determined as the percentage of myotubes expressing dystrophin intensity above the threshold determined using the respective simulation conditions.

[0364] Jess capillary western blot

[0365] Patient-derived human immortalized skeletal muscle myoblasts with exon 45 deletion and healthy human immortalized skeletal muscle myoblasts were seeded on 1% matrigel-coated 24-well plates at a starting density of 20,000 cells / well in universal culture medium (skeletal muscle growth medium (Promocell c-23160), gentamicin 5% (Gibco 15710064)). Three days after seeding, myoblasts were initiated to differentiate into myotubes by adding differentiation medium (DMEM+Glutmax (Gibco 10566-016), insulin (Promocell C-39366)). Myoblasts were collected four days after differentiation and two days after PMO treatment. On ice, myoblasts underwent two cold DPBS (Gibco 14190144) wash cycles and were subsequently incubated for 5 min with M-PER lysis buffer (Thermo Fisher, 78501) and Halt protease inhibitor (Thermo Fisher, 78429). Each well was then scraped for 20 seconds individually. The suspension was then collected and centrifuged at 14000g for 15 minutes at 4°C. The supernatant was collected and the total protein concentration was measured using the Pierce BCA protein assay kit (ThermoScientific, 23227) according to the manufacturer's instructions. The samples were normalized to 300 μg / mL. The samples were then snap-frozen in liquid nitrogen and then quantified based on Jess capillary protein blots. The protein simple Jess system with a 66-440kDA separation module (Protein Simple, SM-W008), an anti-rabbit detection module (ProteinSimple, DM-001) and a Replex module (Protein Simple, RP-001) was used to measure dystrophin quantification by capillary protein blot analysis. Anti-dystrophin rabbit monoclonal antibody (Abcam, AB154168) specific dystrophin was diluted 1:5000 in antibody dilution buffer 2 (Protein Simple). The anti-rabbit detection module included blocking reagent (antibody diluent), HRP-conjugated anti-rabbit secondary antibody, and chemiluminescent substrate. The Replex module included total protein normalizer and biotinylation agent. These reagents were plated following the manufacturer's protocol. Sample proteins diluted to appropriate concentrations in sample buffer (100x dilution of '10x sample buffer' from the separation module) were separated in capillaries and analyzed by chemiluminescent signal. The dystrophin signal was determined by Compass software (Protein Simple).The following criteria were used to distinguish low dystrophin signals from background: the peak signal-to-noise ratio (S / N) given by the software must be ≥10, and the peak height / baseline ratio (manually calculated from the peak height and baseline values ​​given by the software) must be ≥3 (adapted from Beekman et al., 2018). In the final quantification, the signal was normalized to the total protein of each sample.

[0366] result

[0367] The dystrophin restoration assay was performed using the MyoScreen platform, which uses culture conditions optimized for differentiation, maturation, and longevity of cultured myotubes and allows quantification of dystrophin restoration by immunofluorescence. Figure 5A Shown are pictures of healthy cells and cells from DMD patients on the MyoScreen platform, which were immunofluorescently stained for dystrophin-positive fibers. Healthy cells (left panel) and cells from DMD patients transfected with hEx44_Ac7_26 (right panel) show the presence of dystrophin, as indicated by positive cell immunofluorescent staining, while cells from DMD patients do not express any dystrophin, as demonstrated by the lack of immunofluorescent staining (middle panel).

[0368] Quantitative analysis of immunofluorescence staining for restoration of dystrophin in patient-derived cells transfected with PMO44 indicated that hEx44_Ac7_26 efficiently restored dystrophin in a dose-dependent manner in primary myotubes derived from three patients (two primary cells and one immortalized cell line with exon 45 deletion). Figure 5B ). hEx44_Ac7_26 was able to restore 100% of dystrophin in immortalized cell lines derived from DMD patients compared to wild-type cells (healthy primary cells), and hEx44_Ac7_26 was able to induce up to 70% dystrophin restoration in both DMD patient-derived primary cells compared to wild-type cells. The variation in dystrophin restoration levels may depend on the DMD donor cells.

[0369] Additionally, Jess capillary Western blot was used to quantify dystrophin restoration levels in healthy cells and immortalized cells from DMD patients ( Figure 5C ). The results indicated that hEx44_Ac7_26 was able to restore dystrophin expression levels in cells derived from DMD patients by up to 50% compared to dystrophin levels in healthy primary cells.

[0370] Overall, hEx44_Ac7_26 was able to restore dystrophin and DAPC in primary and immortalized cells derived from DMD patients, and the extent of dystrophin restoration depended on the DMD donor cells.

[0371] Example 6: In vitro dose-dependent exon 44 skipping activity in wild-type monkey myotubes treated with hEx44_Ac7_26

[0372] Wild-type cynomolgus monkey primary skeletal muscle cells (batch number SKM110414) were obtained from Worldwide Primate (WWP). Cells were grown in Zenbio GM medium (SKM-M) and plated on 24-well plates coated with 1% matrigel (Corning) (20,000 cells / well). Myoblasts were induced to form myotubes in Zenbio DM medium (SKM-D) for 2 days according to the manufacturer's instructions. PMO was synthesized by GeneTools. PMO was formulated in water, heated at 65-70°C for 5-10 minutes, and diluted into warm culture medium with 1 μM Endo-Porter (Gene Tools, #EP6P1-1) to promote PMO absorption into cells. Cells were harvested 48 hours after transfection. Cells were collected in Trizol and stored at -80°C until processed for RNA isolation using Direct-zol-96 RNA isolation kit (Zymo) according to the manufacturer's instructions. Total RNA concentration was quantified spectroscopically. cDNA was prepared from 100-500ng of purified RNA using a high-capacity cDNA reverse transcription kit (Applied Biosystems) in a SimpliAmp thermal cycler (Applied Biosystems). In a QX200 automatic droplet generator (BioRad) and a combination of 60X Taqman probes (ThermoFischer) targeting the skipped DMD (ID AP7DUYJ) across exon 43-45 junctions and the total DMD (ID Mf01049436_m1) across exon 39-40 junctions, Taqman probes (ThermoFischer), 2X ddPCR supermix (without dUTP) (BioRad) and BamHI restriction enzyme (BioRad), 40ng cDNA was divided into droplets in triplicate. After droplet generation, the mixture was loaded into a deep well C1000 Touch thermal cycler (BioRad) for PCR amplification. Absolute quantification of target RNA molecules was measured in a QX200 Droplet Digital PCR System (BioRad) using QX Manager software (BioRad).Percent dystrophin exon skipping was calculated by normalizing counts of the targeted exon to total gene expression.

[0373] result

[0374] Since the acceptor sequence for exon 44 in the monkey DMD gene is identical to that in humans, we used ddPCR to assess exon 44 skipping activity in primary healthy monkey myotubes treated with increasing concentrations of hEx44_Ac7_26. Figure 6A-6B As shown in , hEx44_Ac7_26 induced a strong dose-dependent response of exon 44 skipping in primary healthy monkey myotubes in vitro. hEx44_Ac7_26 induced greater than 25% exon 44 skipping in healthy monkey myotubes ( Fig. 6A ) and up to 100 exon 44 skipped copies / μl ( Figure 6B ). Interestingly, when compared to dystrophin mRNA copies in the control group, hEx44_Ac7_26 reduced the total number of DMD copies / μl to less than 400. Similar to healthy human myotubes (see Example 4), total dystrophin mRNA copies in healthy monkey cells transfected by hEx44_Ac7_26 were reduced by up to 25% compared to DMD cells and may be attributed to out-of-frame mutations in the dystrophin mRNA that lead to mRNA instability of the skipped exons.

[0375] Overall, these results indicate that hEx44_Ac7_26 is able to reduce DMD mRNA levels in primary healthy monkey cells and that PMO-induced exon 44 skipping in healthy cells reduces DMD gene expression that may be caused by out-of-frame mutations in DMD mRNA.

[0376] Example 7: Biodistribution of exon 44 skipped copies in muscle and non-muscle tissues of cynomolgus monkeys administered a single dose of hEx44_Ac7_26-AOC at a dose of 159.9 mg / kg on day 0, corresponding to a PMO (hEx44-Ac7-26) dose level of 30 mg / kg.

[0377] Scheme 1: Synthesis and purification of hEx44_Ac7_26-AOC

[0378] Anti-human transferrin receptor antibodies were generated. hEx44_Ac7_26PMO was synthesized by GeneTools. The antibody (10 mg / ml) in borate buffer (25 mM sodium tetraborate, 25 mM NaCl, 1 mM diethylenetriamine pentaacetic acid, pH 8.0) was reduced by adding 4 equivalents of tris (2-carboxyethyl) phosphine (TCEP) in water and incubated at 37 ° C for 4 hours. SMCC was coupled to the primary amine on the 3' end of hEx44_Ac7_26PMO by incubating hEx44_Ac7_26PMO (50 mg / ml) in DMSO with 10 equivalents of 4 (N-maleimidomethyl) cyclohexanecarboxylic acid N-hydroxysuccinimide ester (SMCC) (10 mg / ml) in DMSO for one hour. Unconjugated SMCC was removed by ultrafiltration using an Amicon Ultra-15 centrifugal filter unit with a MWCO of 3 kDa. hEx44_Ac7_26PMO-SMCC was washed three times with acetate buffer (10 mM sodium acetate, pH 6.0) and used immediately. The reduced antibody was mixed with 2.25 equivalents of hEx44_Ac7_26PMO-SMCC and incubated overnight at 4°C. The pH of the reaction mixture was then lowered to 7.5, and 8 equivalents of N-ethylmaleimide were added to the mixture at room temperature for 30 minutes to quench unreacted cysteine.

[0379] The reaction mixture was purified with an AKTA Explorer FPLC using HIC Method- 1. Depending on the conjugate, fractions containing conjugates with a drug to antibody ratio of one (DAR 1), two (DAR 2), three (DAR 3), four (DAR 4), five (DAR 5), six (DAR 6), seven (DAR 7), eight (DAR 8) or fractions containing conjugates with a drug to antibody ratio of 3+ (DAR 3+), 4+ (DAR 4+), 5+ (DAR 5+), 6+ (DAR 6+), 7+ (DAR 7+), (DAR 8+) or fractions containing conjugates with an average drug to antibody ratio of one (DAR 1), two (DAR 2), three (DAR 3), four (DAR 4), five (DAR 5), six (DAR 6), seven (DAR 7) or eight (DAR 8) were combined and concentrated using an Amicon Ultra-15 centrifugal filter unit with a MWCO of 50 kDa. The concentrated conjugate was buffer exchanged with PBS (pH 7.4) using an Amicon Ultra-15 centrifugal filter unit prior to analysis.

[0380] Hydrophobic Interaction Chromatography (HIC) Method-1

[0381] Column: GE, HiScreen Butyl HP, 4.7ml

[0382] Solvent A: 50 mM phosphate buffer, 0.7 M ammonium sulfate, pH 7.0; Solvent B: 80% 50 mM phosphate buffer, 20% IPA, pH 7.0; Flow rate: 1.0 ml / min

[0383] gradient:

[0384]

[0385] hEx44_Ac7_26-AOC was quantified via BCA and analyzed by HIC (average DAR≈3.8-4.0), SEC (3.3% HMW) and LAL (<0.025 EU / mg anti-transferrin receptor antibody). The product was stored at 4°C.

[0386] Scheme 2: Synthesis and purification of hEx44_Ac7_26-AOC

[0387] Anti-human transferrin receptor antibodies were generated. hEx44_Ac7_26PMO was synthesized. The antibody (20.4 mg / ml) in citrate buffer (50 mM sodium citrate, 300 mM sucrose, pH 6.5) was combined with ethylenediaminetetraacetic acid (EDTA, 0.5 M, 0.591 mL) and reduced by adding 2 equivalents of tris(2-carboxyethyl)phosphine (TCEP) in water and incubating at 37°C for 2 hours. SMCC was coupled to the primary amine on the 3' end of hEx44_Ac7_26PMO by incubating hEx44_Ac7_26PMO (50 mg / ml) in 50 mM phosphate buffer (pH 7.2) with 3 equivalents of 4-(N-maleimidomethyl)cyclohexanecarboxylic acid N-hydroxysuccinimide ester (SMCC) (50 mg / ml) in DMSO for one hour. Unconjugated SMCC was removed by tangential flow filtration (TFF) and acetate buffer (10mM sodium acetate, pH 6.0) with a membrane MWCO of 3kDa. The reduced antibody was mixed with 4.75 equivalents of hEx44_Ac7_26PMO-SMCC and incubated at room temperature for 1 hour. N-ethylmaleimide (10 equivalents, 15mg / ml, 25mg in DMSO) was added to the mixture at room temperature for 30 minutes to quench unreacted cysteine. The reaction was diluted to 1L with endotoxin-free water. Excess PMO and NEM were removed via SCX purification (GE SP / HP 1610 resin) using SCX method-1. The buffer of the combined fractions was replaced with citrate buffer (50mM sodium citrate, 60mM NaCl, pH 5.5) via TFF and concentrated to approximately 25mg Ab / mL. The solution was sterile filtered with a 0.22 μm membrane.

[0388] Strong Cation Chromatography (SCX) Method-1

[0389] Column: GE HiScale 50, HiPrep SP HP, 200ml

[0390] Solvent A: 25 mM acetate, 25 mM PB, pH 6; Solvent B: 25 mM acetate, 25 mM PB (pH 6), 0.5 mM NaCl; Flow rate: 30 ml / min

[0391] gradient:

[0392]

[0393] hEx44_Ac7_26-AOC was quantified via BCA and analyzed by HIC (average DAR≈3.8-4.0), SEC (3.3% HMW) and LAL (<0.025 EU / mg anti-transferrin receptor antibody). The product was stored at 4°C.

[0394] Scheme 3: Synthesis and purification of hEx44_Ac7_26-AOC

[0395] Anti-human transferrin receptor antibody was produced in citrate buffer (50mM sodium citrate, 300mM sucrose, pH 6.5). hEx44_Ac7_26PMO-SMCC was synthesized by coupling 4 (N-maleimidomethyl) cyclohexanecarboxylic acid N-hydroxysuccinimide ester (SMCC) with the primary amine on the 3' end of hEx44_Ac7_26PMO. Ethylenediaminetetraacetic acid (EDTA, 0.5M, 0.05mL) was added to the antibody and the solution was thoroughly mixed. Antibodies were reduced by adding tris (2-carboxyethyl) phosphine (TCEP, 20mg / mL in H2O, 10 equivalents, 19.5mg, 0.973mL), and the solution was incubated at 37°C for two hours. The reduced antibody solution was taken out from the incubator and cooled to room temperature. hEx44_Ac7_26PMO-SMCC solution (12 equivalents, 27.4mg / ml, 26.1mL in 10mM acetate (pH 6)) was added to the reduced antibody solution and mixed thoroughly. The reaction was carried out at room temperature for one hour. n-ethylmaleimide (NEM) solution (10 equivalents, 25mg / mL in DMSO, 8.5mg, 0.34ml) was added to the reaction mixture, and the reaction was carried out at room temperature for 30 minutes to quench unreacted cysteine. The reaction mixture was diluted to 0.2L with endotoxin-free water. Excess PMO and NEM were removed by strong cation chromatography purification SCX method-1. The buffer of the combined fractions was replaced into histidine buffer (20mM histidine, 10mM methionine, 120mM sucrose, pH 6.0) using spin filtration, and the component was quantified (0.79g, 79% yield) via BCA determination. The solution was sterile filtered with a 0.22 μm membrane. PMO44-AOC was quantified via BCA and analyzed by hydrophobic interaction chromatography (average DAR≈8), size exclusion chromatography (3.3% HMW), reducing capillary gel electrophoresis (average DAR≈7.8-8.0) and ELISA binding affinity to human transferrin receptor (74.5 pM Kd). The affinity of hEx44_Ac7_26-AOC DAR8 AOC is equivalent to that of unconjugated anti-transferrin receptor antibody, such as Figure 7 as shown in .

[0396] Exon 44 skipping assay

[0397] Cynomolgus monkeys received a single intravenous (IV) infusion of hEx44_Ac7_26-AOC at 159.9 mg / kg, which corresponds to a PMO dose level of 30 mg / kg. Muscle tissue and non-muscle biopsy samples were obtained from cynomolgus monkeys on day 43 / 44 (before necropsy). In the vehicle control group, animals did not receive any of the hEx44_Ac7_26-AOC. Four male animals per group were analyzed.

[0398] Cynomolgus monkey muscle tissue and non-muscle samples ranging from 20-50 mg were homogenized in 1 mL TRIzol (Thermo Fisher) on an OMNI Bead Ruptor Elite system (OMNI International). RNA was isolated from tissue homogenate supernatants using the Direct-zol-96 RNA kit (Zymo Research) according to the manufacturer's instructions. 250 ng of purified RNA was converted to cDNA using a high-capacity cDNA reverse transcription kit (Applied Biosystems) and a SimpliAmp thermal cycler (Applied Biosystems). ddPCR was performed on 50 ng of cDNA in a reaction containing a commercial total DMD Taqman assay (Mf01049436_m1 VIC-MGB, Thermo Fisher), a custom skipped DMD Taqman assay (forward primer: AAGGACCGACAAGGGAACT (SEQ ID NO: 93); probe (FAM-MGB): TTCTGACAACAGTTTGCCGCTGC (SEQ ID NO: 94); reverse primer: GCTGAATTATTTCTTCCGCAGTTG (SEQ ID NO: 95), Thermo Fisher), ddPCR supermix for probe (without dUTP, Bio-Rad), BamHI-HF restriction enzyme (New England BioLabs), and Ambion nuclease-free water (Thermo Fisher). Each sample was divided into droplets in triplicate runs in a QX200 automated droplet generator (Bio-Rad). After droplet generation, the samples were transferred to a C1000 Touch thermal cycler (Bio-Rad) with a 96-deep well reaction module. After PCR amplification, the samples were loaded into a QX200 droplet reader (Bio-Rad). Data were analyzed using QX Manager software standard version 1.2 (Bio-Rad). The distinction between positive and negative droplets was achieved by manually applying a fluorescence amplitude threshold. The exon skipping percentage was calculated as 100*(number of copies of exon 44 skipped per μL / total DMD copies per μL).

[0399] result

[0400] Cynomolgus monkeys received a single IV infusion of hEx44-Ac7-26-AOC on day 0 at a dose of 159.9 mg / kg, corresponding to a PMO (hEx44-Ac7-26) dose level of 30 mg / kg. Muscle and non-muscle tissues from the animals were collected 43 / 44 days after dosing, and the number of copies of exon 44 skipped in these tissues was measured by ddPCR. No exon 44 skipping activity was detected in samples injected with PBS. After 44 days after a single IV infusion of hEx44_Ac7_26-AOC at 159.9 mg / kg, exon 44 skipping activity was detected in all muscle tissues, but not in non-muscle tissues including liver and kidney (see Figure 8 ). Exon 44 skipping activity in muscle was detected in skeletal muscle as well as cardiac muscle. The highest exon 44 skipping activity level in muscle tissue was detected in the rectus femoris, with more than 25 skipped copies of exon 44 per ng cDNA, and the lowest exon 44 skipping activity level was detected in the biceps, with less than 5 copies per ng cDNA. In addition, exon 44 skipping activity was measured in the atria and ventricles of the heart as an average of approximately 7 skipped copies of exon 44 per ng cDNA. These results indicate that hEx44_Ac7_26-AOC specifically targets muscle tissue (both skeletal and cardiac muscle) and induces exon 44 skipping in these specific tissues. Exon 44 skipping activity was detected 43 days after a single IV infusion of hEx44_Ac7_26-AOC, confirming its persistent activity in the targeted tissues. In summary, the exon 44 skipping activity induced by hEx44_Ac7_26-AOC was specific to muscle tissue, and hEx44_Ac7_26-AOC had persistent exon 44 skipping activity in muscle tissue.

[0401] Although preferred aspects of the present disclosure have been shown and described herein, it is obvious to those skilled in the art that such aspects are provided only as examples. Without departing from the present disclosure, those skilled in the art will now expect many variations, changes and substitutions. It should be understood that various alternatives of the aspects of the present disclosure described herein may be adopted when implementing the present disclosure. It is intended to limit the scope of the present disclosure with the appended claims, and thus cover methods and structures and their equivalents within the scope of these claims.

Claims

1. A phosphorodiamidate morpholino oligonucleotide (PMO) conjugate comprising an anti-transferrin receptor antibody or an antigen-binding fragment thereof conjugated to a PMO molecule, wherein the PMO molecule comprises a sequence selected from SEQ ID NOs: 100-133.

2. The PMO conjugate of claim 1, wherein the PMO molecule hybridizes to an acceptor splice site, a donor splice site, or an exonic splicing enhancer element of a pre-mRNA transcript of a DMD gene and induces exon 44 skipping in the pre-mRNA transcript to generate an mRNA transcript encoding a truncated DMD protein.

3. The PMO conjugate of claim 1 or claim 2, wherein the PMO molecule is at least about 10 to about 30 nucleotides in length.

4. The PMO conjugate of any one of claims 1-3, wherein the PMO molecule is delivered into muscle cells.

5. The PMO conjugate of any one of claims 1-4, wherein the PMO molecule hybridizes at an exon 44 acceptor splice site of the pre-mRNA transcript of the DMD gene in a pre-mRNA transcript to generate an mRNA transcript encoding a truncated dystrophin protein.

6. The PMO conjugate of any one of claims 1 to 5, wherein the anti-transferrin receptor antibody or antigen-binding fragment thereof comprises a humanized antibody or antigen-binding fragment thereof, a chimeric antibody or antigen-binding fragment thereof, a monoclonal antibody or antigen-binding fragment thereof, a monovalent Fab', a divalent Fab2, a single-chain variable fragment (scFv), a diabody, a minibody, a nanobody, a single domain antibody (sdAb), or a camelid antibody or antigen-binding fragment thereof.

7. The PMO conjugate of any one of claims 1 to 6, wherein the PMO molecule is conjugated to the anti-transferrin receptor antibody or antigen-binding fragment thereof via a linker.

8. The PMO conjugate of claim 7, wherein the linker is a cleavable linker.

9. The PMO conjugate of claim 7, wherein the linker is a non-cleavable linker.

10. The PMO conjugate of claim 7, wherein the linker is selected from a heterobifunctional linker, a homobifunctional linker, a maleimide group, a dipeptide moiety, a benzoic acid group or a derivative thereof, a C1-C6 alkyl group, and combinations thereof.

11. The PMO conjugate of any one of claims 1-10, wherein the PMO conjugate has a PMO molecule to antibody ratio (DAR) of about 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1 or higher.

12. The PMO conjugate of any one of claims 1-10, wherein the PMO conjugate has an average DAR of about 1, 2, 3, 4, 5, 6, 7, 8 or more.

13. The PMO conjugate of any one of claims 1-10, wherein the average DAR of the PMO conjugate is in the range of 3.5-4.

5.

14. The PMO conjugate of any one of claims 1-10, wherein the average DAR of the PMO conjugate ranges from 7.5 to 8.

5.

15. The PMO conjugate of any one of claims 1-10, wherein the average DAR of the PMO conjugate is about 4.

16. The PMO conjugate of any one of claims 1-10, wherein the average DAR of the PMO conjugate is about 8.

17. The PMO conjugate of any one of claims 1-10, wherein the DAR of the PMO conjugate is about 4.

18. The PMO conjugate of any one of claims 1-10, wherein the DAR of the PMO conjugate is about 8.

19. The PMO conjugate of any one of claims 1-17, wherein the PMO conjugate is formulated for parenteral administration.

20. The PMO conjugate of any one of claims 1-19, wherein the truncated dystrophin modulates muscular dystrophy.

21. The PMO of claim 19, wherein the muscular dystrophy is Duchenne muscular dystrophy or Becker muscular dystrophy.

22. A method for treating muscular dystrophy in a subject in need thereof, the method comprising administering to the subject a phosphodiamidate morpholino oligonucleotide (PMO) conjugate, the PMO conjugate comprising an anti-transferrin receptor antibody or antigen-binding fragment thereof conjugated to a PMO molecule, the PMO molecule comprising a sequence selected from SEQ ID NOs: 100-133; wherein the PMO molecule hybridizes to an acceptor splice site, a donor splice site, or an exonic splicing enhancer element of a pre-mRNA transcript of a DMD gene and induces exon 44 skipping in the pre-mRNA transcript to generate an mRNA transcript encoding a truncated dystrophin protein.

23. The method of claim 22, wherein the PMO molecule is delivered into muscle cells.

24. The method of any one of claims 22-23, wherein the anti-transferrin receptor antibody or antigen binding fragment thereof comprises a humanized antibody or antigen binding fragment thereof, a chimeric antibody or antigen binding fragment thereof, a monoclonal antibody or antigen binding fragment thereof, a monovalent Fab', a divalent Fab2, a single chain variable fragment (scFv), a diabody, a minibody, a nanobody, a single domain antibody (sdAb) or a camelid antibody or antigen binding fragment thereof.

25. The method of any one of claims 22-23, wherein the PMO molecule is at least about 10 to about 30 nucleotides in length.

26. The method of any one of claims 22-24, wherein the PMO molecule is conjugated to the anti-transferrin receptor antibody or antigen-binding fragment thereof via a linker.

27. The method of claim 26, wherein the linker is a cleavable linker.

28. The method of claim 26, wherein the linker is a non-cleavable linker.

29. The method of claim 26, wherein the linker is selected from a heterobifunctional linker, a homobifunctional linker, a maleimide group, a dipeptide moiety, a benzoic acid group or a derivative thereof, a C1-C6 alkyl group, and combinations thereof.

30. The method of any one of claims 22-29, wherein the PMO conjugate has an average PMO molecule to antibody ratio (DAR) of about 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, or 8:

1.

31. The method of any one of claims 22-29, wherein the PMO conjugate has an average DAR in the range of 3.5-4.

5.

32. The method of any one of claims 22-29, wherein the PMO conjugate has an average DAR in the range of 7.5-8.

5.

33. The method of any one of claims 22-29, wherein the PMO conjugate has an average DAR of about 4.

34. The method of any one of claims 22-29, wherein the PMO conjugate has an average DAR of about 8.

35. The method of any one of claims 22-34, wherein the PMO conjugate is administered parenterally.

36. The method of any one of claims 22-35, wherein the truncated dystrophin modulates muscular dystrophy.

37. The method of claim 36, wherein the muscular dystrophy is Duchenne muscular dystrophy or Becker muscular dystrophy.

38. A method for inducing exon 44 skipping in a targeted pre-mRNA transcript of a DMD gene, the method comprising: a) contacting a muscle cell with a phosphodiamidate morpholino oligonucleotide (PMO)-antibody conjugate, wherein the PMO-antibody conjugate comprises an anti-transferrin receptor antibody or an antigen-binding fragment thereof and a PMO molecule, wherein the PMO molecule targets an acceptor splice site, a donor splice site, or an exonic splicing enhancer element of the targeted pre-mRNA transcript of the DMD gene; wherein the PMO molecule induces exon 44 skipping in the targeted pre-mRNA transcript, and wherein the PMO-antibody conjugate is preferentially delivered to the muscle cell; b) hybridizing the PMO molecule to the targeted pre-mRNA transcript to induce exon 44 skipping in the targeted pre-mRNA transcript; and c) translating in the muscle cell an mRNA transcript produced from the targeted pre-mRNA transcript processed in step b) to produce a truncated dystrophin protein.

39. The method of claim 38, wherein the anti-transferrin receptor antibody or antigen binding fragment thereof comprises a humanized antibody or antigen binding fragment thereof, a chimeric antibody or antigen binding fragment thereof, a monoclonal antibody or antigen binding fragment thereof, a monovalent Fab', a divalent Fab2, a single chain variable fragment (scFv), a diabody, a minibody, a nanobody, a single domain antibody (sdAb), or a camelid antibody or antigen binding fragment thereof.

40. The method of claim 38 or claim 39, wherein the PMO molecule is at least about 10 to about 30 nucleotides in length.

41. The method of any one of claims 38-40, wherein the PMO molecule has at least 90%, 95%, 99% or 100% sequence identity to a sequence selected from SEQ ID NOs: 100-133.

42. The method of any one of claims 38-41, wherein the PMO molecule targets the acceptor site of exon 44.

43. The method of any one of claims 38-42, wherein the PMO molecule is conjugated to the anti-transferrin receptor antibody or antigen-binding fragment thereof via a linker.

44. The method of claim 43, wherein the linker is a cleavable linker.

45. The method of claim 43, wherein the linker is a non-cleavable linker.

46. ​​The method of claim 43, wherein the linker is selected from a heterobifunctional linker, a homobifunctional linker, a maleimide group, a dipeptide moiety, a benzoic acid group or a derivative thereof, a C1-C6 alkyl group, and combinations thereof.

47. The method of any one of claims 38-46, wherein the PMO conjugate has an average PMO to antibody ratio (DAR) of about 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1 or higher.

48. The method of any one of claims 38-46, wherein the PMO conjugate has a DAR of about 1, 2, 3, 4, 5, 6, 7, 8 or more.

49. The method of any one of claims 38-47, wherein the PMO conjugate has an average DAR in the range of 3.5-4.

5.

50. The method of any one of claims 38-47, wherein the PMO conjugate has an average DAR in the range of 7.5-8.

5.

51. The method of any one of claims 38-47, wherein the PMO conjugate has an average DAR of about 4.

52. The method of any one of claims 38-47, wherein the PMO conjugate has an average DAR of about 8.

53. The method of any one of claims 38-52, wherein the method is an in vivo method.

54. A method of inducing exon 44 skipping in a DMD subject in need thereof, the method comprising administering to the subject a phosphodiamidate morpholino oligonucleotide (PMO) conjugate, the PMO conjugate comprising an anti-transferrin receptor antibody or antigen-binding fragment thereof conjugated to a PMO molecule, the PMO molecule comprising a sequence selected from SEQ ID NOs: 100-133; wherein the PMO molecule hybridizes to an exon 44 acceptor splice site of a pre-mRNA transcript of a DMD gene and induces exon 44 skipping in the pre-mRNA transcript to generate an mRNA transcript encoding a truncated dystrophin protein.

55. A method of restoring dystrophin in a DMD subject in need thereof, the method comprising administering to the subject a phosphodiamidate morpholino oligonucleotide (PMO) conjugate, the PMO conjugate comprising an anti-transferrin receptor antibody or antigen-binding fragment thereof conjugated to a PMO molecule, the PMO molecule comprising a sequence selected from SEQ ID NOs: 100-133; wherein the PMO molecule hybridizes to an exon 44 acceptor splice site of a pre-mRNA transcript of a DMD gene and induces exon 44 skipping in the pre-mRNA transcript to generate an mRNA transcript encoding a truncated dystrophin.

56. A method for producing a truncated dystrophin protein in a DMD subject in need thereof, the method comprising administering to the subject a phosphodiamidate morpholino oligonucleotide (PMO) conjugate, the PMO conjugate comprising an anti-transferrin receptor antibody or antigen-binding fragment thereof conjugated to a PMO molecule, the PMO molecule comprising a sequence selected from SEQ ID NOs: 100-133; wherein the PMO molecule hybridizes to an exon 44 acceptor splice site of a pre-mRNA transcript of a DMD gene and induces exon 44 skipping in the pre-mRNA transcript to produce an mRNA transcript encoding a truncated dystrophin protein.

Images