Sigma factor modification for biosynthetic production

Abstract

The present invention relates to the biosynthetic production of a heterologous product in a genetically engineered cell comprising a heterologous nucleic acid encoding the heterologous product and / or a polypeptide required to produce the heterologous product, wherein the expression of the growth phase and / or stationary phase RNA polymerase sigma factor in the cell is modulated.

Description

Technical Field

[0001] The field of the invention relates to the biosynthetic production of heterologous products in genetically engineered cells, wherein the cells have reduced or eliminated functionality to enter the stationary phase, for example by reducing and / or eliminating the functionality of an RNA polymerase sigma factor active in the stationary phase of the cell, such as sigma factor S (RpoS) in Gram-negative bacteria, or similar stress response factors in other cells, such as sigma factor B (SigB) in Gram-positive bacteria. Background Art

[0002] The design and construction of bacterial cell factories for the production of heterologous products, especially more complex heterologous products, are crucial to providing innovative and scalable solutions for future more complex products.

[0003] To this end, rational strain engineering principles are often applied to single bacterial cells. Such principles generally involve a) manipulating or introducing desired biosynthetic pathways into the host, b) increasing the cellular pools of relevant precursors and intermediates required as donors and / or acceptors in the desired enzymatic reactions, c) optimizing the import and export of produced products and / or intermediates by enhancing natural import / export systems or by introducing heterologous transporters into the production cell, and d) partially or completely introducing genes encoding heterologous products or enzymes capable of producing heterologous products.

[0004] In the biosynthetic production of heterologous products, using genetically engineered cells, the expression levels of various polypeptides (e.g., enzymes, transporters, transcription factors, etc.) may lead to bottlenecks / contractions in production. In particular, in the production of heterologous products that require the interaction of multiple enzymes within the cell, such as in the production of HMOs (see, for example, Yu et al. 2021 ACSS Synth. Biol. 10, 923-938 and Bych et al. 2019 Current Opinion in Biotechnology 56: 130–137), the balance of expression of individual enzymes is important. Increasing the expression of related glycosyltransferases, such as by increasing the number of copies of individual genes, may benefit the yield of the final product, which may increase the expression of enzymes involved in the formation of donors for enzymatic processes or proteins involved in substrate uptake or product output.

[0005] A major challenge in scaling up aerobic fermentation processes is heterogeneity caused by inefficient mixing. Perfect mixing in large-scale bioreactors of approximately 1000 L and more is not feasible, so gradients of substrate (Bylund et al. 1998 Bioprocess Engineering, 18(3), 171–180), nutrients, pH, and dissolved gases can form. In this case, the culture is exposed to various harsh conditions and heterogeneity. For example, such glucose gradients have been shown to trigger overflow metabolism in Escherichia coli (E. coli) in areas of high glucose concentration (Lara et al. 2009 Biotech Bioengineering 104(6), 1153–1161), as well as increase the maintenance requirements of the cells, ultimately leading to performance losses.

[0006] Metabolites produced in aerobic fermentations of different microorganisms due to glucose overflow metabolism are, for example, ethanol, acetate, glutamate, and mixed acids, such as lactate and formate. Elevated overflow metabolite levels can lead to cell stress, which in turn leads to the termination of the exponential growth phase and stimulation towards the stationary phase. Cell stress is a ubiquitous problem that hinders cell growth, induces cell quiescence or cell death, and thus limits the product yield of heterologous products.

[0007] Therefore, avoiding bottlenecks in the enzymatic processes required for the production of heterologous products and avoiding or reducing cellular stress responses are of paramount importance when aiming to enhance the production of heterologous products in biosystems on an industrial scale.

[0008] The stationary phase RNA polymerase sigma factor (encoded by the rpoS gene in Escherichia coli) regulates the transcription of a set of genes in microorganisms such as E. coli during stationary phase or under carbon-deficient and other stress conditions, effectively promoting the cells to exit the growth phase.

[0009] Suppression of the rpoS gene in E. coli results in increased transcription and, therefore, also gene expression of most TCA cycle enzymes, including citrate synthase, isocitrate dehydrogenase, malate dehydrogenase, and succinate dehydrogenase. Although acetate production in these ΔrpoS strains was significantly reduced (Choi et al. 2012, Metabolic Engineering, 14 477-486), the inability of the mutants to utilize acetate as a secondary carbon source is responsible for the low biomass yield and premature entry into the stationary phase (Rahman et al. 2006, Biotechnol Bioeng, Jun 20; 94(3): 585-95). In addition to the upregulated L-threonine metabolism, pyruvate, phosphoenolpyruvate, and oxaloacetate accumulate in ΔrpoS strains during the growth phase.

[0010] In WO 2008 / 020654, it was reported that the survival rate of strains lacking the rpoS gene was significantly reduced under acidic conditions, while the growth rate was increased. Nevertheless, this shift from the cellular stress response to the growth phase was shown to enhance the natural production of acidic products such as L-glutamate.

[0011] Qian et al. 2009, Biotechnology and Bioengineering, Vol. 104, No. 4: 651 reported that the production of the natural product 1,4-diaminobutane (putrescine) in Escherichia coli was improved by deleting rpoS.

[0012] Another example of enhancing the production of natural products in E. coli by deleting rpoS is provided by Choi et al., in which the authors used the upregulation of the threonine pathway induced by deleting rpoS in E. coli to enhance the production of 1-propanol (Choi et al. 2012., Metabolic Engineering, 14477-486). 1-Propanol is naturally produced by some microbial cells, such as Clostridium sp. and yeast, and can also be produced by E. coli under certain conditions (Letoffe et al. 2017 PLOS Genetics https: / / doi.org / 10.1371 / journal.pgen.1006800).

[0013] Therefore, attempts have been made to use rpoS gene-deficient strains to enhance the production of natural products produced primarily in stationary phase, but have not been considered a solution for enhancing the production of heterologous products during the growth phase of bacterial cultures. Instead, they have been found to produce low biomass yields. Summary of the Invention

[0014] The present invention relates to the biosynthetic production of heterologous products using genetically engineered cells with modified RNA transcription pathways. The present invention relates to a genetically engineered cell for the biosynthetic production of one or more heterologous products, wherein the cell has a modulated RNA transcription pathway that extends the growth phase of the cell and inhibits entry into stationary phase, in response to, for example, limited carbon fed during a fermentation process. In this regard, in an embodiment, the present invention relates to a genetically engineered cell for the biosynthetic production of one or more heterologous products, wherein the cell has reduced and / or eliminated functionality to enter stationary phase, for example by reducing or eliminating the functionality of a stationary phase RNA polymerase sigma factor, such as RpoS in Escherichia coli or SigB in Bacillus or similar stress response factors in other cells.

[0015] Furthermore, in an embodiment, the present invention relates to a genetically engineered cell for the biosynthetic production of one or more heterologous products, wherein the genetically engineered cell comprises at least one heterologous nucleic acid encoding a heterologous product and / or a polypeptide involved in the production of the heterologous product, wherein the transcription and / or expression of the heterologous nucleic acid is regulated by a promoter that is recognized by a cellular sigma factor that is active during the cell's growth phase, and wherein the function of the cellular sigma factor that is active during the cell's stationary phase is reduced or eliminated. Preferably, the genetically engineered cell is genetically engineered such that the function of the cellular sigma factor that is active during the cell's stationary phase is reduced or eliminated.

[0016] The reduced or eliminated function of RpoS or SigB can be achieved, for example, by complete or partial inactivation of the gene encoding RpoS or SigB and / or by limiting the function of one or more factors that promote RpoS function, for example, by reducing or eliminating the function of one or more RpoS promoting factors (for example, but not limited to, one or more RpoS promoting factors selected from ArcZ, DksA, GadX, DsrA, DeaD, RprA, and Crl). On the other hand, the reduced or eliminated function of RpoS can be achieved, for example, by enhancing the function of one or more factors that inhibit RpoS function, for example, by enhancing the function of RpoS inhibitory factors, for example, by overexpressing said RpoS inhibitory factors, for example, but not limited to, overexpressing one or more RpoS inhibitory factors selected from rssB, RNase III, H-NS, ArcA, CRP, Fur, MqsA, OxyS, and CyaR.

[0017] To enable production of heterologous products in the genetically engineered cells of the present invention, in embodiments, the cells may further comprise at least one heterologous nucleic acid encoding the heterologous product and / or a polypeptide involved in the production of the heterologous product. Typically, RNA polymerase recognizes specific DNA sequences to initiate transcription of nucleic acid sequences in the cell. Specifically, certain promoter elements within a DNA sequence are recognized by one or more specific RNA transcription factors. Sequence recognition by RNA polymerase can enhance or reduce gene transcription, resulting in decreased or increased expression of the gene product. In this regard, in embodiments of the present invention, expression of a product encoded by a heterologous nucleic acid according to the present invention is increased when RpoS functionality is reduced. Therefore, in further embodiments, the heterologous nucleic acid is transcribed in the absence of RpoS. In further embodiments, expression of an endogenous nucleic acid sequence involved in the formation of a heterologous product can be manipulated by exchanging endogenous promoter elements with recombinant promoter elements. This is referred to herein as a "recombinant endogenous gene" or "recombinant endogenous nucleic acid." In further embodiments, when RpoS functionality is reduced, the exchange increases expression of the endogenous nucleic acid. Alternatively, when the functionality of RpoS is reduced, additional copies of the endogenous gene can be inserted into the cell under the control of a recombinant promoter element, which increases expression of the endogenous nucleic acid.

[0018] As mentioned above, RNA polymerase transcription factors, such as but not limited to RpoS (also known as σ S or σ38), RpoD (also known as σ D or σ70), RpoE (also known as σ E or σ24) and RpoH (also known as σ H or σ32), recognizes specific elements upstream of a coding sequence, such as, but not limited to, a promoter, which initiates RNA transcription of the DNA sequence.

[0019] In this regard, in an embodiment of the invention, the genetically engineered cell comprises at least one heterologous nucleic acid encoding a protein involved in the production of a heterologous product, wherein the expression of the heterologous nucleic acid is regulated by a promoter that is recognized by the cell growth phase as the housekeeping transcription factor RpoD.

[0020] In a preferred embodiment, the promoter of the present invention is recognized by the RNA polymerase transcription factor RpoD. In an even more preferred embodiment, recognition of the promoter by RpoD promotes expression of at least one heterologous nucleic acid. In an embodiment, such a promoter comprises a consensus motif TT(G / C / T)(A / T)C(A / G)(A / G)(n) located between 5 and 40 nucleotides upstream of the translation start codon AUG in the 5' region of the heterologous nucleic acid. 14-18 TA(T / A)(A / G)(A / T)T, where "n" represents any nucleotide.

[0021] Furthermore, in an embodiment of the present invention, the expression of at least one heterologous nucleic acid is regulated by a promoter that is positively regulated by cyclic AMP receptor protein (CRP) bound by cAMP. Thus, in an embodiment of the present invention, the promoter of the present invention further comprises one or more motifs recognized by CRP, such as, but not limited to, the consensus motif (A / G)TGAnnnnnn(A / T)CAC located upstream of the translation start codon AUG, wherein "n" represents any nucleotide, and wherein said recognition by CRP enhances the expression of at least one heterologous nucleic acid.

[0022] Thus, in an embodiment, the promoter of the present invention is selected from PglpF, Plac, PmglB_70UTR, PglpA_70UTR and PglpT_70UTR (SEQ ID NOs: 35, 44, 32, 33 and 34, respectively), and variants thereof, such as those listed in Table 1.

[0023] Regarding heterologous products, there are theoretically no limitations. The combination of reduced or eliminated RpoS function and correct promoter selection can be used to enhance the production of any heterologous product, such as small molecules, carbohydrates, oligosaccharides, complex macromolecules and / or polypeptides, such as peptides, proteins and / or enzymes.

[0024] Thus, in one embodiment of the present invention, the heterologous nucleic acid of the present invention encodes a heterologous product and / or polypeptide to be produced by the genetically engineered cell.

[0025] In other embodiments of the invention, the heterologous nucleic acid of the invention encodes an enzyme, such as a glycosyltransferase or an enzyme involved in the formation of activated sugars from nucleotides, or a transporter involved in substrate import, carbon source, or export of a heterologous product.

[0026] In an embodiment of the invention, the at least one heterologous nucleic acid of the invention comprises one or more genes selected from the group consisting of one or more genes encoding glycosyltransferases, one or more transporter genes, one or more CMP-N-acetylneuraminic acid pathway genes, one or more recombinant GDP-fucose pathway genes, and one or more nucleic acids encoding a heterologous product to be produced by the genetically engineered cell.

[0027] In a further embodiment of the present invention, the heterologous product is one or more oligosaccharides, preferably one or more human milk oligosaccharides (HMOs), such as but not limited to HMOs selected from the group consisting of lacto-N-triose II (LNT-II), lacto-N-tetraose (LNT), lacto-N-neotetraose (LNnT), lacto-N-neohexaose (LNnH), p-lacto-N-neohexaose (pLNnH), p-lacto-N-hexaose (pLNH), lacto-N-hexaose (LNH), 2'-fucosyllactose (2'-FL), lacto-N-fucopentaose I (LNFP-I), lacto-N-difucohexaose I (LNDFH-I), 3-fucosyllactose (3-FL), difucosyllactose (DFL), lacto-N-fucopentaose II (LNFP-II ... Algal pentasaccharide III (LNFP-III), lacto-N-difucohexaose III (LNDFH-III), fucosyl-lacto-N-hexaose II (FLNH-II), lacto-N-fucopentasaccharide V (LNFP-V), lacto-N-difucohexaose II (LNDFH-II), fucosyl-lacto-N-hexaose I (FLNH-I), fucosyl-p-lacto-N-hexaose I (FpLNH-I), fucosyl-p-lacto-N-neohexaose II (F-pLNnHII), fucosyl-lacto-N-neohexaose (FLNnH), 3'-sialyllactose (3'-SL), 6'-sialyllactose (6'-SL), 3-fucosyl-3'-sialyllactose (FSL), 3'-O-sialyllactose-N-tetraose a (LST a), fucosyl-LST a (FLSTa), 6'-O-sialylacto-N-tetraose b (LST b), fucosyl-LST b (FLST b), 6'-O-sialylacto-N-neotetraose (LST c), fucosyl-LST c (FLST c), 3'-O-sialylacto-N-neotetraose (LST d), fucosyl-LST d (FLST d), sialyl-lacto-N-hexaose (SLNH), sialyl-lacto-N-neohexaose I (SLNH-I), sialyl-lacto-N-neohexaose II (SLNH-II), and disialyl-lacto-N-tetraose (DSLNT).

[0028] In this regard, the genetically engineered cells according to the invention in embodiments comprise a de novo GDP-fucose pathway and / or a heterologous CMP-N-acetylneuraminic acid pathway.

[0029] In a further embodiment, the genetically engineered cell according to the present invention comprises and / or overexpresses a biosynthetic pathway for the production of at least one sugar nucleotide selected from the group consisting of GDP-fucose, glucose-UDP-GlcNAc, UDP-galactose, UDP-glucose, UDP-N-acetylglucosamine, UDP-N-acetylgalactosamine (GlcNAc) and CMP-N-acetylneuraminic acid.

[0030] Furthermore, in an embodiment of the present invention, one or more oligosaccharides are fucosylated or sialylated.

[0031] In a further embodiment of the present invention, the genetically engineered cells according to the present invention that produce one or more fucosylated oligosaccharides further comprise overexpressed mannose-6-phosphate isomerase (manA) and / or phosphomannose mutase (manB) genes, i.e., the manA and / or manB genes are overexpressed. In this regard, overexpression can be achieved by introducing additional copies of the genes encoding manA and / or manB into the cell on a chromosome or plasmid. Thus, in an embodiment, the genetically engineered cells of the present invention comprise at least two copies of manA and / or at least three copies of manB.

[0032] The production of one or more oligosaccharides can also be optimized by increasing the import / export of one or more substrates, metabolites and / or heterologous products into the cell. Thus, in an embodiment, lactose import into the cells of the invention is increased by expressing one or more lactose permeases (for example, but not limited to, the lactose permease is LacY), and wherein the nucleic acid sequence encoding LacY is under the control of a promoter disclosed herein.

[0033] In addition to input / output substrates, metabolites and / or heterologous products, it is also considered advantageous to expand the genetic modification of genetically engineered cells to rely on different carbon source growth capabilities. Therefore, in an embodiment, the cell also expresses a functional sucrose utilization system, such as the heterologous sucrose utilization system encoded by the scrYA and scrBR operons. The sucrose utilization system enables cells that originally could not utilize sucrose as a carbon source to utilize sucrose as a carbon source. The functional sucrose utilization system can be considered advantageous in large-scale manufacturing. Therefore, in an embodiment of the present invention, the genetically engineered cell comprises a functional sucrose utilization system.

[0034] In addition, the import and export of metabolites and / or heterologous products produced by the cell are enhanced by the expression of specific transporters. Thus, in an embodiment, the genetically engineered cells of the present invention express at least one heterologous Major Facilitator Superfamily (MFS) transporter, such as a heterologous MFS transporter selected from Nec, YberC, Fred, Bad, and Vag.

[0035] The production of one or more oligosaccharides may also include the expression of one or more functional enzymes capable of producing a heterologous product. In one embodiment, the genetically engineered cells of the present invention express at least one heterologous glycosyltransferase. In a further embodiment, the at least one heterologous glycosyltransferase is selected from the group consisting of β-1,3-N-acetyl-glucosaminyltransferase, β-1,3-galactosyltransferase, β-1,4-galactosyltransferase, α-1,2-fucosyltransferase, α-1,3-fucosyltransferase, α-2,3-sialyltransferase, and α-2,6-sialyltransferase.

[0036] About genetically engineered cell of the present invention, in fact there is no restriction.In this respect, in embodiments, genetically engineered cell is prokaryotic organism, for example bacterium.In a preferred embodiment, described bacterium is selected from gram-positive bacteria for example Bacillus (Bacillus sp.), Lactobacillus (lactobacillus sp.), Corynebacterium (corynebacteriumsp.) and Campylobacter (Campylobacter sp.) and gram-negative bacteria for example Escherichia (Escherichiasp.), preferably, described genetically engineered cell is Escherichia coli.

[0037] In some embodiments, a further functional benefit of reduced levels of RpoS relates to the formation of acidic metabolites. Thus, in embodiments, the cells have reduced acetate and / or glutamate formation.

[0038] The present invention also relates to a method for producing a heterologous product, comprising culturing a genetically engineered cell according to the present invention. In an embodiment, the cultivation of the genetically engineered cell is carried out in the presence of a carbon source selected from glucose, sucrose, fructose, xylose and glycerol. In an embodiment of the invention, the pH during the cultivation is maintained above 6.0, preferably above 6.5. In an embodiment, the method relates to the production of a heterologous product. In a further embodiment, the product is a human milk oligosaccharide (HMO). In a further embodiment, lactose is added as a substrate for the formation of the HMO during the cultivation of the genetically engineered cell. In an embodiment, the produced human milk oligosaccharide (HMO) is recovered from the culture medium and / or the genetically engineered cell.

[0039] The present invention also relates to the use of the genetically engineered cells of the invention for the production of heterologous products, such as for the production of HMOs, or for example for the production of polypeptides. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] Figure 1 Shown are the relative production of HMOs in an E. coli production strain containing a functional sigma factor gene (strain 1) and in E. coli production strains in which different sigma factors have been deleted: ΔrpoS (strain 2), ΔrpoZ (strain 12), and ΔrpoF (strain 13).

[0041] Figure 2 The relative production of HMOs in E. coli production strains containing a functional rpoS gene (strains 1, 3, 5, 7, 9) or in which the rpoS gene was deleted (ΔrpoS, strains 2, 4, 6, 8, 10) is shown. Figure 2 A) DFL( Figure 2 B) 3FL( Figure 2 C), 3'SL( Figure 2 D) or 6'SL( Figure 2 E).

[0042] Figure 3 Shown are the relative production of 2'FL in an E. coli 2'FL production strain containing a functional crl gene (strain 1) or an E. coli 2'FL production strain in which the crl gene was deleted (Δcrl, strain 11).

[0043] Figure 4 The relative production of acetic acid in E. coli HMO-producing strains grown overnight in minimal medium containing glucose is shown. Figure 4 A) 3FL( Figure 4 B) or 6'SL( Figure 4 C).

[0044] Figure 5 The relative production of acetic acid in E. coli 3FL production strains 5 (+rpoS) and 6 (ΔrpoS) during fermentation is shown. Samples were collected at six different time points and the amount of acetic acid was measured. These values ​​are given relative to strain 5 at time 21 hours.

[0045] Figure 6 Shown are the glutamate production rates in E. coli 3FL production strains 5 (+rpoS) and 6 (ΔrpoS) during fermentation.

[0046] Figure 7The relative production of 3FL during fermentation of strain 5 (+rpoS) and strain 6 (ΔrpoS) is shown. Samples were collected at six different time points and the amount of HMO was determined. These values ​​were normalized to strain 5 at the end of the fermentation.

[0047] Figure 8 Shown are the relative production of 2'FL during fermentation of strain 1 (+rpoS) and strain 2 (ΔrpoS). Fermentations of strains 1 and 2 were performed in duplicate. Samples were collected at six different time points and the amount of HMO was determined. These values ​​were normalized to strain 1 at the end of the fermentation.

[0048] Figure 9 The relative transcription between strain 2 (ΔrpoS) and strain 1+ (+rpoS) during fermentation is shown ( Figure 6 RT-qPCR was performed to measure the relative transcription of 19 genes (lacY, manB, manB, futC, gmd, nec, scrY, crp, and cra) at two different time points in the fermentation (41 and 113 h).

[0049] Figure 10 The relative protein content of heterologous gene expression from futC in E. coli 2'FL production strains containing a functional rpoS gene (strain 1, RpoS_pos, solid line) and 2'FL production strains lacking the rpoS gene (strain 2, RpoS_neg, dotted line) is shown. The scale on the Y axis is the relative amount of protein in log2.

[0050] Figure 11 Shown are the relative protein contents of selected endogenous genes in an E. coli 2'FL production strain containing a functional rpoS gene (strain 1, rpoS_pos, solid line) and a 2'FL production strain lacking the rpoS gene (strain 2, rpoS_neg, dashed line). Figure 11 A shows ManB protein levels, B shows ManC levels, C shows Gmd levels, D shows Fcl levels, E shows SucA levels, F shows ScrB levels, G shows Suc D levels, and H shows GltA levels. The scale on the Y axis is the relative amount of protein in log2.

[0051] Figure 12 The relative production of 2'FL during fermentation of control strain 2 (ΔrpoS) and ManAB+ strain 14 (ΔrpoS, manA+, manB+) is shown. Replicate fermentations were performed with two control strain curves (solid lines) and two ManAB+ strain curves (dashed lines). DETAILED DESCRIPTION

[0052] The biosynthetic production of heterologous products is a common way to produce chemical and biological products in industrial-scale settings. Bacterial pathway engineering is often used to enhance the production of natural products in bacterial cells. Genetic engineering to optimize the formation of products naturally produced by cells rarely requires the insertion of heterologous nucleic acid sequences encoding proteins that are not endogenously present in the cell. On the other hand, in the production of heterologous products, a combination of pathway engineering and the introduction of heterologous genes that, when expressed, require a specific function or encode a desired product is often used.

[0053] A common problem in bacterial production is the expression of large amounts of heterologous products, which can be toxic to the cells due to intracellular product accumulation, metabolic overflow, intracellular or extracellular acidification, or metabolite accumulation, all of which can induce cellular stress responses.

[0054] To overcome the above problems, different strategies can be applied, some involving genetic engineering to stabilize host cells under large-scale fermentation conditions and / or to increase the yield of the desired product.

[0055] In the present invention, it was surprisingly shown that for five different heterologous HMO products (Examples 2, 5 and 6), the stationary phase σ transcription factor RpoS (also known as σ38 (σ 38 Inhibition of cellular stress responses and stationary phase gene expression by σS or σS can increase product yields between 30% and 700%. In addition, Example 8 shows a 2.3-fold increase in the heterologous protein product FutC.

[0056] RNA polymerase sigma factor

[0057] Sigma factors are essential components of the RNA polymerase holoenzyme in bacteria and archaea. At the start of the transcription process, σ factors are required to recognize genomic locations that initiate promoter-specific transcription. In Escherichia coli, the σ factor system consists of the housekeeping σ factor 70, or σ factor D (rpoD), and six alternative σ factors: RpoN / σ54 (nitrogen limitation), RpoS / σ38 (stationary phase), RpoH / σ32 (heat shock), RpoF / σ28 (flagellation and chemotaxis), RpoE / σ24 (extreme heat stress), and σ19 (iron transport and metabolism) (transcribed from the genes rpoN, rpoS, rpoH, rpoF, rpoE, and fecI, respectively); and the omega factor RpoZ (assembly of the RNA polymerase holoenzyme). Depending on which σ factors are present in the RNA polymerase holoenzyme, different genes will be transcribed in the cell. Other bacteria and archaea also contain σ factor systems, in which each σ factor plays a different role, as illustrated above for the E. coli σ factor. In the context of the present invention, when the term RpoD is used, it refers to the housekeeping sigma factor active during the cell growth phase, similarly, when the term RpoS is used, it refers to the sigma factor that is primarily active under stress conditions such as starvation and stationary phase.

[0058] RNA polymerase sigma factors, such as RpoS (also known as σ S , σ factor s or σ factor 38), RpoD (also known as σ70, σ factor 70 or σ factor D), RpoE (also known as σ E , σ factor 24) and RpoH (also known as σ H , sigma factor H or sigma factor 32), recognizes specific elements upstream of the coding sequence, such as the promoter, which initiates RNA transcription of the DNA sequence. Therefore, cells use RNA polymerase transcription factors to regulate gene expression based on external or internal stimuli.

[0059] Reduction in the function of the stationary phase σ transcription factor RpoS results in increased expression of genes that would otherwise have reduced expression upon RpoS activation. 70 The expression of some genes regulated by RpoS (or housekeeping σ factors) decreases in response to cellular stress and entry into a stable phase due to the exchange of σ70 with σ38 in the RNA polymerase holoenzyme. In this sense, genes transcribed by RpoD, which contains RNA polymerase, can be downregulated upon enhanced expression of RpoS in cells. RNA polymerase transcription factors, such as RpoS (also known as σ S ), RpoD (also known as σ70), RpoE (also known as σ E σ factor 24) and RpoH (also known as σ H The RNA polymerases and transcription factors (or sigma factors) recognize specific elements upstream of a coding sequence, such as a promoter, which initiates RNA transcription of the DNA sequence. Thus, cells use RNA polymerase transcription factors to regulate gene expression based on external or internal stimuli.

[0060] Natural bacteria fermentation follows four stages, i.e. lag phase (lag phase), growth phase (growth phase), stationary phase (stationary phase) and decay phase (death phase). In industrial fed-batch fermentation, cells grow in two stages, the first stage of exponential cell growth in the substratum guaranteed by the carbon source, and the second stage of cell growth in the substratum run under carbon restriction, wherein the carbon source is added continuously, thereby allowing to form product in this stage. Carbon (sugar) limits the stage in the fermentation, wherein the concentration kinetics of the carbon source (sugar) in the substratum controls growth rate, and the concentration of the carbon source (sugar) is then determined by the carbon addition rate (sugar feed rate) added to fermentor tank. Before significant cell decay occurs, industrial fermentation will always be stopped.

[0061] For each phase, and other special cellular conditions, specific transcription factors come into play and promote or reduce the expression of specific genes based on their sequence specificity. In this context, the term "growth phase and / or stationary phase RNA polymerase sigma factor" is used for RNA polymerase sigma factors that are active in the cell growth phase and / or stationary phase of a cell.

[0062] Because different transcription factors recognize specific consensus sequences in the promoter upstream of the start codon of the corresponding gene to be expressed, each gene is expressed at different stages of bacterial growth. Therefore, cells reconfigure expression patterns according to the specific cell state and the transcription factors expressed. For example, after the exponential growth phase, once the nutrients in the culture medium are exhausted or limited, the bacterial culture will show a reduced growth rate or enter a stationary phase, which is characterized in that the balance between the number of dividing and dying cells and represents the stagnation phase in the growth curve.

[0063] In industrial production, product production typically occurs under carbon-limited conditions, which control cell growth without the cells actually entering stationary phase. Based on the present results, it can be speculated that this transition from exponential growth to limited growth leads to increased formation of RpoS, even though the cells are not in stationary phase.

[0064] The promoter landscape and transcription factors involved in regulating transcription are quite complex, and assigning specific promoters that are effective throughout the fermentation process has proven to be highly complex and difficult, as cells are often faced with very different conditions; once introduced into large-scale fermentation, some cells may face mechanical stress, others may face anaerobic conditions or excessive sugar influx or starvation.

[0065] Therefore, finding promoters suitable for expressing genes throughout the fermentation process and under different fermentation conditions has proven challenging.

[0066] In the present disclosure, the inventors address this problem by combining a) a promoter recognized by a sigma factor active during cell growth (housekeeping sigma factor) with b) reduction of the stationary phase sigma factor. This approach provides an elegant method to prevent reduced gene expression in genes transcribed from promoters recognized by housekeeping sigma factors (RpoD or SigA). Reduced expression occurs in the presence of RpoS due to competition between the stationary phase sigma factor (RpoS or SigB) and the housekeeping sigma factor (RpoD or SigA).

[0067] These examples clearly demonstrate that the approach disclosed herein for the first time employing reduced RpoS levels in combination with an RpoD driven promoter can improve production yields.

[0068] Stationary phase transcription factors

[0069] Without being bound by theory, we believe there are at least three potential mechanisms that lead to the increased production of heterologous products produced by the genetically engineered cells of the present invention.

[0070] In Escherichia coli, σD (RpoD) is the primary σ factor during exponential growth. Together with RNA polymerase, it forms the holoenzyme that transcribes most genes in growing cells by recognizing a consensus sequence in their promoters. A shift away from typical growth conditions, such as exponential growth toward stationary phase, results in the replacement of σD with σS (RpoS) within the RNA polymerase holoenzyme complex. When this occurs, the RNA polymerase holoenzyme no longer recognizes the same transcriptional targets, leading to a decrease in the levels of many RNAs and proteins, including components of the protein synthesis machinery.

[0071] It is well known that there is competition between the housekeeping sigma factor D in the RNA polymerase holoenzyme and the stationary phase sigma factor S. Therefore, when sigma factor S is removed or its amount decreases in the cell, sigma factor D will remain in the RNA polymerase holoenzyme and continue to transcribe genes necessary for normal growth and genes involved in the protein synthesis machinery.

[0072] The above is an exemplary description of the σ factor system of Escherichia coli, and similar systems are also present in other prokaryotes. In the context of the present invention, it should be understood that when referring to RpoD, it can be extended to σ factors of other species, wherein the σ factor is active in the cell growth phase and acts as a housekeeping σ factor, and an example of a σ factor with a similar function is σ factor A (SigA) from Bacillus subtilis or other Gram-positive bacteria. Similarly, when referring to RpoS, it can be extended to σ factors of other species, wherein the σ factor is a stress response or stationary phase σ factor, and an example is σ factor B (SigB) from Bacillus subtilis or other Gram-positive bacteria (see, for example, Haldenwang 1995 Microbiological Reviews, mar. 1995, p. 1–30).

[0073] In an embodiment of the present invention, the RpoSσ factor is encoded by the nucleic acid sequence of SEQ ID NO: 1 or a functional homolog thereof, and the functional homolog has at least 80%, such as at least 85%, such as at least 90%, such as at least 95% or 100% sequence identity with SEQ ID NO: 1.

[0074] In an embodiment of the invention, the RpoSσ factor comprises the amino acid sequence of SEQ ID NO: 90 or a functional homologue thereof, which has at least 80%, such as at least 85%, such as at least 90%, such as at least 95% or 100% sequence identity with SEQ ID NO: 90.

[0075] In an embodiment of the present invention, the SigBσ factor is encoded by the nucleic acid sequence of SEQ ID NO: 93 or a functional homologue thereof, and the functional homologue has at least 80%, such as at least 85%, such as at least 90%, such as at least 95% or 100% sequence identity with SEQ ID NO: 93.

[0076] In an embodiment of the invention, the SigBσ factor comprises the amino acid sequence of SEQ ID NO: 94 or a functional homologue thereof, which has at least 80%, such as at least 85%, such as at least 90%, such as at least 95% or 100% sequence identity with SEQ ID NO: 94.

[0077] Based on the results of the present invention, it is theorized that in host cells in which product formation is dependent on a protein encoded by a gene transcribed from a promoter recognized by a sigma factor of the cell, said sigma factor being active during the cell growth phase (a housekeeping sigma factor, such as sigma factor D or sigma factor A), the production of heterologous product will be increased in cells lacking or having a reduced amount of the cell's sigma factor active in the cell stationary phase (sigma factor S or sigma factor B), compared to cells with an unchanged ability to produce sigma factor S or sigma factor B. The increased production of heterologous product in cells lacking or having a reduced amount of the cell's sigma factor active in the cell stationary phase (sigma factor S or sigma factor B) may be explained by:

[0078] i) Increased transcription from promoters recognized by the housekeeping σ factor. This may favor the transcription of genes essential for normal growth, as well as genes directly or indirectly involved in the formation of heterologous products (if one or more genes involved in product formation are transcribed from promoters recognized by σD or σA),

[0079] ii) Increased expression levels of proteins involved in the protein synthesis machinery. This can lead to increased protein translation, which is beneficial to overall growth and / or product formation.

[0080] iii) Energy conservation in the cell due to reduced expression of the σS transcript gene.

[0081] Increased transcription in i) is particularly useful if the gene for which increased transcription is achieved is rate limiting in the production of the heterologous product. Thus, when transcription of a particular heterologous nucleic acid is not rate limiting for the process, in some cases, increasing the transcription of a heterologous nucleic acid involved in the production of the heterologous product may result in no change in product yield.

[0082] Example 1 of the present disclosure demonstrates that deletion of the RpoS gene from E. coli cells producing the heterologous product 2'-FL significantly increases product yield, while deletion of sigma factors H or F has no effect on 2'-FL formation. The inventors discovered that this increase correlates with a significant increase in the expression level of the heterologous nucleic acid incorporated into the genetically engineered cells.

[0083] Thus, the present invention relates to a genetically engineered cell for the biosynthetic production of one or more heterologous products, wherein the function of the cell's sigma factor (e.g., RpoS or SigB) active in the stationary phase of the cell is reduced or eliminated in the cell. Preferably, the cell is engineered such that the function of the cell's sigma factor (e.g., RpoS or SigB) active in the stationary phase of the cell is reduced or eliminated in the cell. Thus, it is not intended to encompass microorganisms that naturally (e.g., can be found in nature) lack RpoS or SigB but have been genetically engineered for other purposes.

[0084] Thus, the function of RpoS or SigB can be reduced in any number of ways known to those skilled in the art, such as by deleting the encoding gene or introducing mutations in the gene that reduce the function of RpoS or SigB, or it can be accomplished by regulating RpoS or SigB at the transcriptional or translational level, thereby reducing the expression level of RpoS or SigB. One way to reduce the level of transcription is to exchange endogenous regulatory elements with elements that result in lower levels of transcription (e.g., a weaker promoter), or by altering mRNA stability (e.g., by modifying sequences upstream of the rpoS / sigB start site or in the beginning of the gene). The RpoS or SigB gene can be inactivated in this sense by completely or partially deleting the corresponding nucleic acid sequence from the bacterial genome, or by mutating the gene sequence in such a way that it is not transcribed, or if transcribed, the transcript is not translated, or if translated into protein, it is regulated in such a way that the protein does not have the activity of the corresponding RNA transcription factor.

[0085] The level of RpoS or SigB can be reduced by any method known to those skilled in the art, such as, but not limited to, genomic deletion, silent mutation, missense mutation, knockdown by small interfering RNA (siRNA), and other methods known to those skilled in the art.

[0086] The term "complete or partial inactivation" with respect to a gene as described herein refers to inactivation of the target gene by complete or partial deletion of the corresponding nucleic acid sequence from the genome of the cell.

[0087] In an embodiment, the gene encoding RpoS or SigB is completely or partially inactivated. In an embodiment, the gene encoding RpoS or SigB is knocked down in the genetically engineered cell. In an embodiment, the gene encoding RpoS or SigB is knocked out in the genetically engineered cell. In an embodiment, the gene encoding RpoS or SigB is deleted from the genome of the genetically engineered cell.

[0088] The term "knocked down" relates to the non-genomic reduction of expression of a gene of interest, for example knockdown using a small inhibitory RNA that inhibits protein synthesis of the target gene, thereby obtaining reduced expression by non-genomic editing.

[0089] The term "knockout" relates to the complete deletion of a gene from the genome of a genetically engineered cell or the partial deletion of a gene, which results in a non-functional gene product.

[0090] RpoS regulatory factors

[0091] The level of RpoS is regulated by several factors (transcription factors and translation factors). The rpoS gene is recognized by the RNA polymerase complex containing RpoD, which triggers the expression of the rpoS gene. The transcribed mRNA of the rpoS gene is regulated by a number of additional factors that enhance or reduce the further translation of the mRNA product, such as, but not limited to, accessory proteins and / or small regulatory RNA molecules.

[0092] Thus, in embodiments, the function of one or more factors that promote RpoS function is reduced or eliminated. In further embodiments, the genes encoding one or more RpoS promoting factors are fully or partially inactivated.

[0093] In the present invention, a "factor that promotes" function is understood to mean a factor that enhances the function of a gene, DNA, RNA, and / or polypeptide compared to the basic function of the gene. In this regard, a promoting factor can be DNA, RNA, and / or a polypeptide. A promoting factor may exert its function at any biological level. In non-limiting examples, factors that promote gene transcription or RNA to polypeptide translation, or factors that promote the functionality of a functional polypeptide, are considered promoting factors. In this regard, a "factor" can be DNA, RNA, or a polypeptide, and can be an internal factor, such as RNA loop formation, or an external factor, such as, but not limited to, siRNA and a polypeptide that inhibits RpoS gene transcription or translation.

[0094] RpoS stimulatory factor

[0095] In an embodiment of the present invention, the function of the cellular sigma factor active in the stationary phase of the cell is reduced or eliminated by completely or partially inactivating or reducing one or more RpoS promoters. In a further embodiment, the one or more completely or partially inactivated RpoS promoters are selected from ArcZ, DksA, GadX, DsrA, DeaD, RprA, and Crl.

[0096] ArcZ (SEQ ID NO: 9 or a functional homolog thereof) is a conserved small regulatory RNA that increases translation of RpoS. In an embodiment, the small regulatory RNA ArcZ is fully or partially inactivated in the genetically engineered cells of the invention.

[0097] DksA (RNA polymerase binding transcription factor DksA, (SEQ ID NO: 97 or a functional homolog thereof) binds to guanosine tetraphosphate (pp Gpp) and destabilizes the promoter complex and reduces the activity of the RNAP holoenzyme containing the sigma factors RpoE, RpoS and RpoH, but enhances the activity of the RpoD-binding RNA polymerase. Therefore, after inactivation of the RpoS gene, it can be advantageous in connection with the present invention to increase the level of DksA. In an embodiment of the present invention, the rpoS gene translation promoting factor DksA is completely or partially inactivated in a cell comprising a functional rpoS gene. In a further embodiment, the gene encoding DksA (SEQ ID NO: 10 or a functional homolog thereof) is completely or partially inactivated in a cell comprising a functional rpoS gene.

[0098] The HTH-type transcriptional regulator GadX (SEQ ID NO: 98 or a functional homolog thereof) is a positive regulator of rpoS gene transcription and is essential for entering the stationary phase in response to acidic pH. Therefore, in one embodiment, the rpoS gene transcription promoter GadX is completely or partially inactivated in the genetically engineered cells of the present invention, which contain a functional rpoS gene. In a further embodiment, the gene encoding GadX (SEQ ID NO: 11 or a functional homolog thereof) is completely or partially inactivated in cells containing a functional rpoS gene.

[0099] The small regulatory RNA DsrA (SEQ ID NO: 12 or a functional homologue thereof) activates the translation of rpoS RNA, thereby activating the production of rpoS. Thus, in an embodiment, the small regulatory RNA DsrA is completely or partially inactivated in the genetically engineered cells of the invention.

[0100] The ATP-dependent RNA helicase DeaD (SEQ ID NO: 99 or a functional homolog thereof) appears to destabilize mRNA secondary structures in the translation initiation region of mRNA, and specifically destabilizes the inhibitory stem-loop structure in the 5'UTR of the rpoS mRNA transcript, thereby enabling annealing of the small regulatory RNA DsrA, which in turn enables translation of rpoS. Thus, in an embodiment, the gene encoding the ATP-dependent RNA helicase DeaD (SEQ ID NO: 13 or a functional homolog thereof) is completely or partially inactivated in the genetically engineered cells of the present invention.

[0101] In a further embodiment, the gene encoding the ATP-dependent RNA helicase DeaD (SEQ ID NO: 13 or a functional homolog thereof) and / or the gene encoding the small regulatory RNA DsrA (SEQ ID NO: 12 or a functional homolog thereof) is completely or partially inactivated in the genetically engineered cells of the present invention.

[0102] The small regulatory RNA RprA (SEQ ID NO: 14 or a functional homolog thereof) is required for the production of RpoS in response to osmotic shock. The small regulatory RNA RprA alters the secondary structure in the leader sequence of the rpoS mRNA transcript to promote RpoS translation and increase the accumulation and half-life of the rpoS mRNA transcript. Thus, in an embodiment, the gene encoding the small regulatory RNA RprA (RprA) is completely or partially inactivated in the genetically engineered cells of the present invention.

[0103] Ribonuclease III (RNase III, SEQ ID NO: 107 or a functional homolog thereof) is a double-stranded RNA-specific endoribonuclease that binds to or specifically cleaves double-stranded mRNA molecules, thereby inducing stability and / or changes in the molecular conformation. RNase III has been shown to be essential for the normal increase in RpoS levels under glucose deprivation. In an embodiment, RNase III is completely or partially inactivated in the genetically engineered cells of the present invention. In a further embodiment, the gene encoding RNase III (SEQ ID NO: 106 or a functional homolog thereof) is completely or partially inactivated in the genetically engineered cells of the present invention, preferably cells comprising a functional rpoS gene.

[0104] RNA polymerase holoenzyme assembly factor Crl (Crl, (SEQ ID NO: 92 or a functional homolog thereof) is an RNA polymerase holoenzyme assembly factor that promotes the binding of RpoS to RNA polymerase and switches expression from RpoD-driven to RpoS-driven expression. Therefore, in an embodiment, the rpoS gene translation promoting factor Crl is completely or partially inactivated in the genetically engineered cells of the present invention (comprising a functional rpoS gene). In a further embodiment, the gene encoding Crl (SEQ ID NO: 8 or a functional homolog thereof) is completely or partially inactivated in the genetically engineered cells of the present invention. Example 3 of the present invention demonstrates that the absence of Crl has a positive effect on 2'FL formation in RpoS-positive cells.

[0105] Factors that inhibit RpoS function

[0106] Along the same lines, overexpression of factors that inhibit RpoS function by reducing the amount of available RpoS by transcription, translation, or by functionally inhibiting the RpoS polypeptide can reduce the function of the stationary phase RNA polymerase sigma factor in cells.

[0107] Typically, an increase in protein / gene activity can be achieved by overexpressing the gene encoding the protein, by increasing gene copy number, by selecting a strong promoter, or by modulating gene transcription or translation factors. Thus, in an embodiment, the activity of one or more factors that inhibit RpoS function is increased. In a further embodiment, a nucleic acid encoding one or more factors that inhibit RpoS function is overexpressed. In a further embodiment, one or more factors that inhibit rpoS gene transcription are overexpressed. In a further embodiment, one or more factors that inhibit translation of rpoS gene mRNA transcripts are overexpressed. In an embodiment, the one or more factors that inhibit RpoS function are selected from RssB, RNase III, H-NS, ArcA, CRP, Fur, MqsA, OxyS, and CyaR.

[0108] The regulator of RpoS (RssB, SEQ ID NO: 100 or a functional homolog thereof) is an adaptor protein that promotes the degradation of RpoS. Therefore, in an embodiment, the gene encoding the regulator of RpoS (rssB, SEQ ID NO: 15 or a functional homolog thereof) is overexpressed in the genetically engineered cells of the present invention to increase the level of RssB having the amino acid sequence of SEQ ID NO: 100 or a functional homolog thereof.

[0109] The DNA-binding transcriptional regulator H-NS (HNS, SEQ ID NO: 101 or a functional homolog thereof) functions as a gene silencer in that it preferentially binds to the common AT-rich curved DNA sequence upstream of Escherichia coli promoters and can induce bending of non-curved DNA, thereby changing DNA conformation / topology and / or competing with RNAP and other regulators. Therefore, in an embodiment, the gene encoding the DNA-binding transcriptional regulator H-NS (hns, SEQ ID NO: 16 or a functional homolog thereof) is overexpressed in the genetically engineered cells of the present invention to increase the level of HNS having the amino acid sequence of SEQ ID NO: 101 or a functional homolog thereof.

[0110] Phosphorylated DNA binding transcriptional dual regulator ArcA (pArcA, SEQ ID NO: 102 or a functional homolog thereof) acts as a repressor of rpoS transcription. Thus, in an embodiment, the gene encoding the DNA binding transcriptional dual regulator ArcA (arcA) is overexpressed in the genetically engineered cells of the present invention.

[0111] The cAMP receptor protein (CRP, SEQ ID NO: 103 or a functional homolog thereof) regulates the expression of over 180 genes, wherein these cAMP-bound CRPs inhibit rpoS transcription. Thus, in an embodiment, the promoter of the present invention is positively regulated by cAMP-bound CRP. In a further embodiment, the gene encoding the cAMP receptor protein (crp, SEQ ID NO: 18 or a functional homolog thereof) is overexpressed in the genetically engineered cells of the present invention to increase the level of CRP having the amino acid sequence of SEQ ID NO: 101 or a functional homolog thereof.

[0112] The transcriptional activator Ferric Uptake Regulation (FUR, SEQ ID NO: 104 or its functional homolog), once Fe 2+ Thus, in one embodiment, the gene encoding Ferric Uptake Regulation (fur, SEQ ID NO: 19 or a functional homolog thereof) is overexpressed in the genetically engineered cells of the present invention to increase the level of FUR having the amino acid sequence of SEQ ID NO: 101 or a functional homolog thereof.

[0113] The DNA-binding transcriptional repressor MqsA (MqsA, SEQ ID NO: 105 or a functional homolog thereof) acts as a repressor of rpoS transcription. Thus, in an embodiment, the gene encoding the DNA-binding transcriptional repressor MqsA (mqsA, SEQ ID NO: 20 or a functional homolog thereof) is overexpressed in the genetically engineered cells of the present invention to increase the level of MqsA having the amino acid sequence of SEQ ID NO: 105 or a functional homolog thereof.

[0114] The small regulatory RNA CyaR (SEQ ID NO: 22 or a functional homolog thereof) is a small RNA that promotes degradation of, for example, rpoS gene mRNA transcripts in an Hfq-dependent manner. Therefore, in an embodiment, the gene encoding the small regulatory RNA CyaR is overexpressed in the genetically engineered cells of the present invention.

[0115] Small regulatory RNA OxyS (SEQ ID NO: 21 or a functional homolog thereof) is involved in the translation of rpoS gene mRNA transcripts, and OxyS is expressed in response to oxidative stress and impairs cell division. Therefore, in an embodiment, the gene encoding the small regulatory RNA OxyS is overexpressed in the genetically engineered cells of the present invention.

[0116] Sigma factors active during cell growth

[0117] Bacterial cells typically express sigma factors, which are active during cell growth and can therefore be considered housekeeping sigma factors. In Escherichia coli, the housekeeping sigma factor is sigma factor D (RpoD), and in Bacillus subtilis and other Gram-positive bacteria, the housekeeping sigma factor is sigma factor A (SigA).

[0118] RpoD, also known as σ70 (σ 70 ) is the major sigma factor during exponential growth, targeting RNA polymerase σ70 to a wide range of promoters, which is essential for normal growth. Deviations from typical growth conditions (such as heat shock or growth into stationary phase) result in the replacement of RpoD within the RNA polymerase holoenzyme complex with other sigma factors, such as RpoH or RpoS.

[0119] When RpoD binds to promoter DNA, it simultaneously contacts the −10 and −35 regions upstream of the translation start codon. In promoters with a −35 site, RpoD is more efficient when either the proximal half-site or the complete UP element is also present, whereas the stationary phase σRpoS has the opposite selectivity. During stationary phase growth, both σ70 and the RNA polymerase σ factor RpoS compete for available RNA polymerase core complexes.

[0120] In this application, the following motifs are predicted TT ( G / C / T)( A / T) C ( A / G)(n) 14 -18 TA ( T / A)( A / G)( A / T) T : represents the RhoD acceptable motif, which is based on the RopD motif TTGACAnnnnnnnnnnnnnnTATAAT disclosed in the review by Schellhorn (Frontiers in Microbiology 2020 Volume 11 Article 560099). The underlined letters in the RhoD acceptable motif correspond to the RhoD motif.

[0121] Thus, in an embodiment of the invention, the promoter sequence comprises a RhoD motif according to the invention comprising a consensus sequence of TTGACAnnnnnnnnnnnnnnTATAAT, wherein "n" represents any nucleotide. In a further embodiment, the promoter sequence comprises a RhoD motif comprising TT(G / C / T)(A / T)C(A / G)(n) 14-18 The consensus sequence of TA(T / A)(A / G)(A / T)T is a RhoD-acceptable motif.

[0122] Non-limiting examples of promoters containing a RhoD-acceptable motif are listed in Table 1. The promoter Plac (SEQ ID NO: 44) of the lac operon, the promoter PgatY (SEQ ID NO: 82) of tagatose-1,6-bisphosphate aldolase 2 (gatY), and the promoter PglpF (SEQ ID NO: 35) of the glycerol promoter (glpF), and the anaerobic glycerol-3-phosphate dehydrogenase subunit A (glpA) PglpA (SEQ ID NO: 83).

[0123] Other promoters, such as, but not limited to, the promoter Pmg1B (SEQ ID NO: 84) of the D-galactose / methylgalactoside ABC transporter periplasmic binding protein (mg1B), are recognized by both RpoD and RpoS and can therefore be transcribed by RNA polymerases bound by either RpoS or RpoD.

[0124] Reduction in RpoS levels reduces competition between RpoD and RpoS in the RNA polymerase holoenzyme complex, thereby enhancing transcription levels from RpoD-dependent promoters and leading to further overexpression of heterologous nucleic acids containing promoter sequences recognized by RpoD (e.g., PglpF, Plac, and / or PgatY).

[0125] Therefore, in an embodiment of the present invention, when the function of the stationary phase RNA polymerase sigma factor RpoS is reduced or eliminated in said cell, the mRNA transcription level of the at least one heterologous nucleic acid of the present invention is enhanced.

[0126] In an embodiment of the invention, when the function of the stationary phase RNA polymerase sigma factor RpoS is reduced or eliminated in the cell, the mRNA transcript level of the at least one heterologous nucleic acid of the present invention is increased by at least 2 times, such as at least 5 times, at least 10 times, at least 20 times, or such as at least 50 times, or such as by 2 to 10 times, such as by 10 to 50 times, such as by 10 to 20 times, such as by 25 to 50 times.

[0127] In a further embodiment, the mRNA transcription level of at least one heterologous nucleic acid of the present invention is increased when the function of the stationary phase RNA polymerase sigma factor RpoS is reduced or eliminated in the cell, and wherein the promoter of the at least one heterologous nucleic acid is selected from the group consisting of Plac, PgatY, PglpF and PglpA, and variants thereof.

[0128] In an embodiment, when the function of the stationary phase RNA polymerase sigma factor RpoS is reduced or eliminated in the cell, and when the promoter of the at least one heterologous nucleic acid is selected from the group consisting of Plac, PgatY, PglpF and PglpA, and functional variants thereof, the mRNA transcription level of the at least one heterologous nucleic acid encoding a glycosyltransferase is increased by at least 2 times, such as at least 5 times, at least 10 times, at least 20 times, or such as at least 50 times, or such as by 2 to 10 times, such as by 10 to 50 times, such as by 10 to 20 times, such as by 25 to 50 times.

[0129] In an embodiment, when the function of the stationary phase RNA polymerase sigma factor RpoS is reduced or eliminated in the cell, and when the promoter of the at least one heterologous nucleic acid is selected from the group consisting of Plac, PgatY, PglpF and PglpA, and functional variants thereof, the mRNA transcript level of at least one heterologous nucleic acid encoding a glycosyltransferase, one or more CMP-N-acetylneuraminic acid pathway genes, one or more sucrose utilization genes, an MFS transporter, a nucleic acid encoding a heterologous product, such as an antibody or an enzyme, is increased by at least 2 times, such as at least 5 times, at least 10 times, at least 20 times, or such as by at least 50 times, or such as by 2 times to 10 times, such as by 10 times to 50 times, such as by 10 times to 20 times, such as by 25 times to 50 times.

[0130] In an embodiment, when the function of the stationary phase RNA polymerase sigma factor RpoS is reduced or eliminated in the cell, and when the promoter of at least one recombinant endogenous nucleic acid is selected from Plac, PgatY, PglpF, PglpT and PglpA, and functional variants thereof, the mRNA transcription level of at least one recombinant endogenous gene is increased by at least 2 times, such as at least 5 times, at least 10 times, at least 20 times, or for example, at least 50 times, or for example, by 2 to 10 times, such as by 10 to 50 times, such as by 10 to 20 times, such as by 25 to 50 times, wherein the transcription of the endogenous gene is regulated by a promoter recognized by the RNA polymerase sigma factor RpoD, such as one or more colanic acid genes (gmd, wcaG, manC, manB and / or manA), other related endogenous pathway genes and / or lactose permease genes.

[0131] In an embodiment, when the function of the stationary phase RNA polymerase sigma factor RpoS is reduced or eliminated in the cell, and when the promoter of the at least one heterologous nucleic acid is Plac or a functional variant thereof, the level of mRNA transcription of the at least one heterologous nucleic acid encoding a polypeptide required for the production of one or more heterologous products is increased.

[0132] In an embodiment, when the function of the stationary phase RNA polymerase sigma factor RpoS is reduced or eliminated in the cell, and when the promoter of the at least one heterologous nucleic acid is PglpF or a functional variant thereof, the mRNA transcription level of the at least one heterologous nucleic acid encoding the polypeptide required for the production of one or more heterologous products is increased.

[0133] In an embodiment, when the function of the stationary phase RNA polymerase sigma factor RpoS is reduced or eliminated in the cell, and when the promoter of the at least one heterologous nucleic acid is PglpA or a functional variant thereof, the mRNA transcription level of the at least one heterologous nucleic acid encoding the polypeptide required for the production of one or more heterologous products is increased.

[0134] In an embodiment, when the function of the stationary phase RNA polymerase sigma factor RpoS is reduced or eliminated in the cell, and when the promoter of the at least one heterologous nucleic acid is PgatY or a functional variant thereof, the mRNA transcription level of the at least one heterologous nucleic acid encoding the polypeptide required for the production of one or more heterologous products is increased.

[0135] In an embodiment, when the function of the stationary phase RNA polymerase sigma factor RpoS is reduced or eliminated in the cell, and when the promoter of the at least one heterologous nucleic acid is PglpT or a functional variant thereof, the mRNA transcription level of the at least one heterologous nucleic acid encoding the polypeptide required for the production of one or more heterologous products is increased.

[0136] In embodiments, expression of the at least one heterologous nucleic acid comprises expression of at least one gene selected from the group consisting of one or more glycosyltransferase genes, one or more CMP-N-acetylneuraminic acid pathway genes, one or more transporter genes, and one or more nucleic acids encoding a heterologous product to be produced by the genetically engineered cell, driven by a promoter recognized by RpoD.

[0137] In an embodiment, when the function of the stationary phase RNA polymerase sigma factor RpoS is reduced or eliminated in the cell, the expression of at least one heterologous nucleic acid is increased, including the expression of at least one gene selected from the group consisting of one or more glycosyltransferase genes, one or more CMP-N-acetylneuraminic acid pathway genes, one or more transporter genes, and one or more nucleic acids encoding a heterologous product to be produced by the genetically engineered cell.

[0138] In an embodiment of the present invention, the RpoDσ factor is encoded by the nucleic acid sequence of SEQ ID NO: 2 or a functional homolog thereof, which has at least 80%, such as at least 85%, such as at least 90%, such as at least 95% or 100% sequence identity with SEQ ID NO: 2.

[0139] In an embodiment of the present invention, the RpoDσ factor comprises the amino acid sequence of SEQ ID NO: 91 or a functional homologue thereof, said functional homologue having at least 80%, such as at least 85%, such as at least 90%, such as at least 95% or 100% sequence identity with SEQ ID NO: 91.

[0140] In an embodiment of the present invention, the SigAσ factor is encoded by the nucleic acid sequence of SEQ ID NO: 95 or a functional homologue thereof, said functional homologue having at least 80%, such as at least 85%, such as at least 90%, such as at least 95% or 100% sequence identity with SEQ ID NO: 95.

[0141] In an embodiment of the present invention, the SigAσ factor comprises the amino acid sequence of SEQ ID NO: 96 or a functional homologue thereof, said functional homologue having at least 80%, such as at least 85%, such as at least 90%, such as at least 95% or 100% sequence identity with SEQ ID NO: 96.

[0142] Heterologous or recombinant natural nucleic acid sequences

[0143] The present invention relates to genetically engineered cells comprising a heterologous nucleic acid involved in the production of a heterologous product. The heterologous nucleic acid may encode the heterologous product itself and / or a heterologous polypeptide required for the production of the heterologous product.

[0144] Preferably, expression of the heterologous nucleic acid is controlled by a promoter recognized by a sigma factor in cells actively growing during the growth phase, such as the RNA transcription factors RpoD or SigA. Since expression of some RpoD- or SigA-driven genes decreases upon entry into stationary phase, the exchange of RpoD or SigA with RpoS or SigB in the RNA polymerase holoenzyme complex, upon deletion of RpoS or SigB, respectively, can enhance expression of some nucleic acids regulated by RpoD or SigA. Therefore, in embodiments, expression of the heterologous nucleic acid increases when the functionality of RpoS or SigB is reduced. In further embodiments, the heterologous nucleic acid is transcribed in the absence of RpoS or SigB. Preferably, transcription of the heterologous nucleic acid is increased in the absence of RpoS or SigB.

[0145] In this context, the terms "heterologous nucleic acid sequence," "heterologous gene / nucleic acid / nucleotide sequence / DNA code," or "coding nucleic acid sequence" are used interchangeably and refer to a nucleic acid sequence that is of a different origin than the cell into which it is inserted, e.g., a sequence derived from a different species than the host cell. A heterologous nucleic acid sequence can be produced in vitro using standard laboratory methods for making nucleic acid sequences and is typically artificial in that it is codon-optimized for the host into which it is inserted. A heterologous nucleic acid comprises a set of consecutive, non-overlapping triplets (codons) that are transcribed into mRNA and translated into protein when under the control of appropriate control sequences (i.e., promoter sequences). Preferably, the promoter is recognized by RpoD or SigA.

[0146] When a promoter is recognized by a specific RNA transcription factor, transcription of the DNA sequence downstream of the recognized motif (i.e., the promoter) is initiated or decreased. In the present invention, the indented function achieved by promoter recognition by RpoD or SigA is the transcription of the nucleic acid sequence downstream of the recognized promoter sequence.

[0147] In addition, the present invention also relates to " recombinant nucleic acid sequence " or " recombinant endogenous / natural nucleic acid sequence or gene " in the present disclosure, it is meant the nucleic acid sequence that has been manipulated compared with the natural sequence present in the host cell. In this respect, the recombinant nucleic acid sequence can be the natural / endogenous gene in the non-natural nucleic acid construct that is inserted into the cell for expression. The recombinant nucleic acid sequence can also be the natural gene expressed from the natural or non-natural chromosomal position in the cell, wherein the regulatory element (such as promoter) upstream of the transcription start codon has been replaced by a regulatory element different from the regulatory element that usually regulates the natural gene. The example of recombinant endogenous nucleic acid can be, for example, the colonic acid operon of the present invention, wherein the original promoter sequence has been replaced by another natural promoter sequence (such as PglpF promoter (SEQ ID NO:35)), resulting in a specific configuration of two elements (PglpF promoter and CA operon) that do not exist in the natural host cell, i.e., they are not naturally operably connected in the host and are therefore considered to be recombinant endogenous / natural nucleic acid sequences. Heterologous nucleic acids can also be considered to be recombinant nucleic acids because they are non-natural for the host cell by definition.

[0148] The boundaries of the coding sequence are generally determined by the ribosome binding site, transcription start codon (AUG, GUG or UUG) and translation stop codon (UAA, UGA or UAG) upstream of the open reading frame at the 5' end of the mRNA. The coding sequence may include, but is not limited to, genomic DNA, cDNA, synthetic and heterologous nucleic acid sequences.

[0149] The term "nucleic acid" includes RNA, DNA and cDNA molecules. It will be understood that due to the degeneracy of the genetic code, multiple nucleic acid sequences encoding a given protein can be generated.

[0150] The heterologous nucleic acid sequence can be a coding DNA sequence, such as a gene, or a non-coding DNA sequence, such as regulatory DNA, for example a promoter sequence or other non-coding regulatory sequence, such as a small regulatory RNA.

[0151] The term "nucleic acid construct" refers to an artificially constructed nucleic acid fragment, particularly a DNA fragment, which is intended to be inserted into a host cell, such as a bacterium, to modify the expression of genes in the cell genome, or to express genes / coding DNA sequences, which may be included in the construct.

[0152] The present invention also relates to heterologous nucleic acid constructs comprising a coding nucleic acid sequence and a promoter sequence recognized by the RNA transcription factors RpoD or SigA, wherein the nucleic acid construct is intended for expression in genetically engineered cells in which the function of the stationary phase RNA polymerase sigma factor RpoS or SigB is reduced or eliminated. Thus, the nucleic acid constructs of the present invention may comprise one or more heterologous DNA sequences encoding a gene of interest, such as one or more glycosyltransferase genes, one or more CMP-N-acetylneuraminic acid pathway genes, and one or more transporter genes, one or more nucleic acids encoding a heterologous product to be produced, and further comprise one or more non-coding regulatory DNA sequences, such as one or more promoter DNA sequences, for example, promoter sequences recognized by the RNA transcription factors RpoD or SigA, such as a promoter derived from the promoter sequence of the lac operon or the glp operon, or a promoter sequence derived from another genomic promoter DNA sequence recognized by the RNA transcription factor RpoD, or a synthetic promoter sequence recognized by the RNA transcription factor RpoD, wherein the coding sequence and the promoter sequence are operably linked.

[0153] Another nucleic acid construct of the present invention may comprise a recombinant endogenous gene, wherein its transcription is regulated by a promoter recognized by the RNA transcription factor RpoD or SigA, such as a promoter derived from the promoter sequence of the lac operon or the glp operon, or a promoter sequence derived from another genomic promoter DNA sequence recognized by the RNA transcription factor RpoD, or a synthetic promoter sequence recognized by the RNA transcription factor RpoD, and wherein the coding sequence and the promoter sequence are operably linked. In an embodiment of the present invention, the recombinant endogenous nucleic acid can be selected from the de novo GDP-fucose pathway, such as one or more genes from the colanic acid gene cluster (gmd-wcaG--manC-manB-manA), in particular mannose-6-phosphate isomerase (manA) and / or phosphomannose mutase (manB), lactose permease, one or more genes involved in the biosynthetic pathway for the preparation of at least one sugar nucleotide, wherein the sugar nucleotide is selected from glucose-UDP-GlcNAc, UDP-galactose, UDP-glucose, UDP-N-acetylglucosamine and UDP-N-acetylgalactosamine (GlcNAc).

[0154] The term "operably linked" refers to a functional relationship between two or more nucleic acid (e.g., DNA) segments. It refers to the functional relationship of a transcriptional regulatory sequence to a transcribed sequence. For example, a promoter sequence is operably linked to a coding sequence if it stimulates or regulates transcription of the coding sequence in an appropriate host cell or other expression system.

[0155] In embodiments, the nucleic acid construct of the present invention may be part of a vector DNA. In other embodiments, the construct is an expression cassette / cassette that is integrated into the genome of a genetically engineered cell.

[0156] Furthermore, in an embodiment of the present invention, at least one heterologous nucleic acid involved in the production of the heterologous product is under the control of a promoter recognized by the RNA transcription factor RpoD. In a further embodiment, the heterologous nucleic acid is under the control of a promoter selected from the group consisting of PglpF, Plac, PmglB_70UTR, PglpA_70UTR and PglpT_70UTR (SEQ ID NOs: 35, 44, 32, 33, 34, respectively) and variants thereof, preferably a strong promoter selected from the group consisting of PglpF and variants thereof (SEQ ID NOs: 30, 35, 36, 37, 38, 40, 41, 42, 45 and 46, respectively).

[0157] Preferably, the heterologous nucleic acid sequence or the recombinant endogenous nucleic acid sequence is under the control of a promoter sequence selected from the promoter sequences of the nucleic acid sequences shown in Table 1.

[0158] Table 1 - Selected promoter sequences

[0159]

[0160] *Promoter activity was assessed in the LacZ assay described below, with the PglpF promoter in the same assay serving as a positive reference. For comparison across assays, activity was calculated relative to the PglpF promoter, and ranges indicate results from multiple assays.

[0161] The promoter may be of heterologous origin, naturally present in the genetically engineered cell, or it may be a recombinant promoter, a combination of heterologous and / or naturally occurring elements.

[0162] One way to increase the yield of a heterologous product is to enhance the expression of a heterologous nucleic acid sequence and / or a recombinant endogenous nucleic acid sequence involved in the production of the heterologous product, for example by increasing the production of an enzyme activity required for the production of the heterologous product, such as, but not limited to, in the case of human milk oligosaccharides, a glycosyltransferase or an enzyme in a biosynthetic pathway involved in the synthesis of a precursor.

[0163] Increasing the strength of the promoter that drives the expression of the desired enzyme is one way to do this. The strength of the promoter can be determined using the lacZ enzyme assay, in which β-galactosidase activity is determined as previously described (see, for example, Miller J.H. Experiments in molecular genetics, Cold spring Harbor Laboratory Press, NY, 1972). Briefly, cells are diluted in Z buffer and permeabilized with sodium dodecyl sulfate (0.1%) and chloroform. The lacZ assay is performed at 30°C. The sample is preheated, the assay is started by adding 200 μl of o-nitro-phenyl-β-galactosidase (4 mg / ml), and the assay is stopped by adding 500 μl of 1 M Na2CO3 when the sample turns slightly yellow. The release of o-nitrophenol is then determined as the change in optical density at 420 nm. Specific activity is reported in Miller units (MU) [A420 / (min*ml*A600)]. Regulatory elements with an activity greater than 10,000 MU are considered strong, those with an activity less than 3,000 MU are considered weak, and those in between have intermediate strength. An example of a strong regulatory element is the PglpF promoter, which has an activity of approximately 14,000 MU, while an example of a weak promoter is Plac, which has an activity of approximately 2,300 MU when induced with IPTG.

[0164] In an embodiment, expression of the heterologous nucleic acid and / or recombinant endogenous nucleic acid sequence of the present invention is under the control of the following promoter: PglpF (SEQ ID NO: 35) or Plac (SEQ ID NO: 44) or PmglB_UTR70 (SEQ ID NO: 32) or PglpA_70UTR (SEQ ID NO: 33) or PglpT_70UTR (SEQ ID NO: 34) promoter or a variant thereof (e.g., the promoters shown in Table 1). Other suitable variants of the PglpF, PglpA_70UTR, PglpT_70UTR and PmglB_70UTR promoter sequences are described in or WO2019 / 123324 and WO2020 / 255054, respectively (incorporated herein by reference).

[0165] When using the PglpF, PglpA or PglpT promoter, it may be necessary to delete the glpR gene (which encodes the DNA-binding transcriptional repressor GlpR) to eliminate the transcriptional repression exerted by GlpR on all PglpF, PglpA or PglpT promoters in the cell and in this way enhance gene expression from all PglpF, PglpA or PglpT-based cassettes.

[0166] When using the Plac promoter, it may be necessary to delete the lacI gene (which encodes the DNA-binding transcriptional repressor LacI) to eliminate the transcriptional repression exerted by LacI on all Plac promoters in the cell and in this way enhance gene expression from all Plac-based cassettes.

[0167] When using the PgatY promoter, it may be necessary to delete the gatR gene (which encodes the DNA-binding transcriptional repressor GatR) to eliminate transcriptional repression exerted by GatR on all PgatY promoters in the cell and in this way enhance gene expression from all PgatY-based cassettes.

[0168] When using the PmglB promoter, it may be necessary to delete the galR or galS gene (which encodes the DNA-binding transcriptional repressors GalR and GalS) to eliminate transcriptional repression exerted by GalR or GalS on all PmglB promoters in the cell and in this way enhance gene expression from all PmglB-based cassettes.

[0169] In an embodiment, the expression of the heterologous nucleic acid and / or recombinant endogenous nucleic acid sequence is under the control of a regulatory element of medium or low strength, which can be selected from PglpF_SD9 (SEQ ID NO:40), PglpF_SD7 (SEQ ID NO:41), PglpF_SD6 (SEQ ID NO:42), PglpA_16UTR (SEQ ID NO:43), PglpF_SD6 (SEQ ID NO:445), PglpF_SD6 (SEQ ID NO:46) and Plac (SEQ ID NO:44).

[0170] In an embodiment, the expression of the heterologous nucleic acid and / or recombinant endogenous nucleic acid sequence is under the control of a high-strength regulatory element, which can be selected from Plac_70UTR (SEQ ID NO:26), PglpF_SD4 (SEQ ID NO:30), PglpA_70UTR (SEQ ID NO:33), PglpT_70UTR (SEQ ID NO:34), PglpF (SEQ ID NO:35), PglpF_SD10 (SEQ ID NO:36), PglpF_SD5 (SEQ ID NO:37) and PglpF_SD8 (SEQ ID NO:38).

[0171] In an embodiment, the Pmg1B-derived promoters in Table 1 are used only in RpoS-negative strains.

[0172] Integration of the nucleic acid construct of interest contained in the construct (expression cassette) into the bacterial genome can be achieved by conventional methods, for example by using a linear cassette containing flanking sequences homologous to specific sites on the chromosome, such as the attTn7 site (Waddell CS and Craig NL, Genes Dev. (1988) Feb; 2(2): 137-49); methods for genomic integration of nucleic acid sequences, wherein recombination is mediated by the Red recombinase function of bacteriophage λ or the RecE / RecT recombinase function of the Rac prophage (Murphy, J Bacteriol. (1998); 180(8): 2063-7; Zhang et al., Nature Genetics (1998) 20: 123-128; Muyrers et al., EMBO Rep. (2000) 1(3): 239-243); methods based on Red / ET recombination (Wenzel et al., Chem. Biol. (2001); 1(3): 239-243); Biol. (2005), 12(3):349-56; Vetcher et al., Appl Environ Microbiol. (2005); 71(4):1829-35); or positive clones, ie clones carrying the expression cassette, can be selected, for example, by loss or gain of marker gene or gene function.

[0173] In one or more exemplary embodiments, the present disclosure relates to one or more heterologous or native nucleic acid sequences as shown in SEQ ID NOs: 1 to 46, 57, 58, 82 to 84, 93, 95, 106, 108 to 111 and 113.

[0174] In particular, the present disclosure relates to one or more heterologous or natural nucleic acid sequences (a) and / or functional homologues thereof, which have a sequence that is at least 70% identical to SEQ ID NOs: 1 to 46, 57, 58, 82 to 84, 93, 95, 106, 108 to 111 and 113, such as at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 98% identical or 100% identical.

[0175] Sequence identity

[0176] The term "sequence identity" as used herein describes the dependency of two amino acid sequences or two nucleotide sequences based on their paired comparisons, i.e., a candidate sequence (e.g., a sequence of the present disclosure) and a reference sequence (e.g., a prior art sequence). For purposes of the present disclosure, the sequence identity between two amino acid sequences is determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mo / . Biol. 48: 443-453), which is implemented in the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277), preferably version 5.0.0 or higher versions (available at https: / / www.ebi.ac.uk / Tools / psa / emboss needle / ). The parameter used is gap open penalty (gap open penalty) 10, gap extension penalty (gap extension penalty) 0.5, and EBLOSUM62 (EMBOSS version of 30BLOSUM62) substitution matrix.The output (using-nobrief option to obtain) of Needle that is labeled as " longest identity " is used as percentage identity, and is calculated as follows: (identical residual x 100) / (the total number of gaps in the comparison length-comparison).

[0177] For the purpose of the present disclosure, use in EMBOSS bag (EMBOSS:The European Molecular BiologyOpen Software Suite, Rice et al., 2000, Trends Genet.16:276-277), the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, the same) implemented in the Needle program of 10 preferred versions 5.0.0 or higher versions determines the sequence identity between two nucleotide sequences.The parameter used is gap open penalty (gap open penalty) 10, gap extension penalty (gap extension penalty) 0.5, and DNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix.The output (using-nobrief option to obtain) of the Needle that is labeled as " longest identity " is used as identity percentage, and is calculated as follows: (identical deoxyribonucleotide x 100) / (the total number of spaces in comparison length-comparison).

[0178] Functional homologs

[0179] Functional homologues or functional variants of protein / nucleic acid sequences as described herein are protein / nucleic acid sequences in which the genetic code has been altered, which retains its original function. Functional homologues can be obtained by induced mutagenesis, or can be naturally occurring variants from the same or other species. Compared to the function of the protein / nucleic acid sequence, the functional homologue should have at least 50%, for example at least 60%, 70%, 80%, 90% or 100% residual function. In an embodiment of the present invention, the functional homologue has at least 80% identity, for example at least 85% identity, for example at least 90% identity to the protein / nucleic acid sequence indicated by a given protein, nucleic acid or gene.

[0180] Functional homologs of any of the disclosed amino acid or nucleic acid sequences may also have increased functionality. In addition to qPCR primer sequences, functional homologs of any of the amino acid or nucleic acid sequences shown in Table 2 should ideally be capable of participating in the biosynthetic production of heterologous products, in terms of increased yield, export of product out of the cell, or input of substrate for production, such as input of precursors to heterologous products, improved purity / byproduct formation, viability of genetically engineered cells, robustness of genetically engineered cells according to the present disclosure, or reduction in consumables required for production.

[0181] Heterologous products

[0182] In this context, term " heterologous product " should be construed as not being a product produced by the endogenous (natural) production of the host cell, that is, for the host cell producing the heterologous product, the host cell needs genetic engineering, and in addition the heterologous product is the product to be separated / purified from the organism it produces. In an embodiment, the heterologous product can not be produced by the endogenous production of the host cell before the genetic engineering of the cell. In this respect, the heterologous product is not limited and can be any product produced by the genetically engineered cell, which is not produced by the endogenous production of the cell. Therefore, typical L-amino acids such as L-glutamic acid and L-threonine are not considered to be heterologous products. The natural products produced by the host cell, such as 1-propyl alcohol, are also not considered to be heterologous products as described above. In one embodiment of the invention, the heterologous product is not an alcohol, such as ethanol, 1-propyl alcohol, 1-butanol or not an amino acid such as L-glutamic acid and L-threonine.

[0183] In another embodiment of the invention, the heterologous product is not an antigen, in particular an antigen for vaccination.

[0184] In an embodiment, the heterologous product is a polypeptide. In a further embodiment, the heterologous product is a mammalian polypeptide, such as, but not limited to, albumin, polypeptide hormones, antibodies, fragments thereof, and / or enzymes. In an embodiment, the heterologous product is a polypeptide enzyme, such as, but not limited to, amylases, amidases, proteases, lipases, cellulases, xylanases, mannanases, catalases, pectinases, pullulanases, phytases, prolyl oligopeptidases, and lactases (see, for example, Singh et al. 2016 3Biotech, 6(2):174).

[0185] In other embodiments, the heterologous product is a product of an enzymatic reaction in the cell. In further embodiments, the heterologous product is a product produced by the cell in the absence of addition of an external substrate to the culture medium.

[0186] In a further embodiment, the heterologous product is an oligosaccharide. In a further embodiment, the heterologous product is a human milk oligosaccharide.

[0187] In further embodiments, the heterologous product is a vitamin, such as, but not limited to, vitamin A, D, E, K, B1, B2, B3, B5, B6, B9, B12, B7, or vitamin C. In further embodiments, the heterologous product is a cannabinoid. In further embodiments, the heterologous product is a carotenoid, such as, but not limited to, canthaxanthin, apocarotene, or beta-carotene.

[0188] In one embodiment of the present invention, the heterologous product is selected from the group consisting of heterologous polypeptides and heterologous oligosaccharides, such as HMOs.

[0189] In an embodiment, the heterologous product is selected from the group consisting of albumin, peptides, polypeptides, antibodies and fragments thereof, enzymes, oligosaccharides, vitamins, cannabinoids and carotenoids.

[0190] Oligosaccharides

[0191] In a preferred embodiment of the present invention, the heterologous product is an oligosaccharide.

[0192] In this context, term " oligosaccharide " refers to the glycopolymer containing at least three monosaccharide units, that is, three, four, five, six or higher oligosaccharides. Oligosaccharides can have the straight chain or branched structure comprising the monosaccharide units connected to each other by glycosidic bond. Especially, oligosaccharides are included in the lactose residue at the reducing end and the monosaccharide of one or more naturally occurring 5-9 carbon atoms selected from aldose (such as glucose, galactose, ribose, arabinose, xylose etc.), ketose (such as fructose, sorbose, tagatose etc.), deoxy sugar (such as rhamnose, fucose etc.), deoxy amino sugar (such as N-acetyl-glucosamine, N-acetyl-mannosamine, N-acetyl-galactosamine etc.), uronic acid and ketouronic acid (such as N-acetylneuraminic acid).

[0193] In an embodiment, the heterologous product is one or more oligosaccharides.

[0194] Preferably, the oligosaccharide is an HMO.

[0195] Human milk oligosaccharides (HMOs)

[0196] Preferred oligosaccharides of the present disclosure are human milk oligosaccharides (HMOs).

[0197] In the present context, the term "human milk oligosaccharide" or "HMO" refers to a complex carbohydrate found in human breast milk. HMOs have a core structure comprising a lactose unit at the reducing end, which may be extended by one or more β-N-acetyl-lactosaminyl and / or one or more β-lacto-N-diosyl units, and which may be substituted with α-L-fucopyranosyl and / or α-N-acetyl-neuraminyl (sialic acid) moieties. The HMO structure is disclosed, for example, by Xi Chen in Advances in Carbohydrate Chemistry and Biochemistry, Vol. 72, Chapter 4, 2015.

[0198] HMOs have a core structure comprising a lactose unit at the reducing end, which may be extended by one or more β-N-acetyl-lactosamine and / or one or more β-lacto-N-biosyl units, and which may be substituted with α-L-fucopyranosyl and / or α-N-acetyl-neuraminoyl (sialyl) moieties. In this regard, non-acidic (or neutral) HMOs lack sialic acid residues, while acidic HMOs have at least one sialic acid residue in their structure. Non-acidic (or neutral) HMOs may be fucosylated or non-fucosylated. Examples of such neutral non-fucosylated HMOs include lacto-N-triose 2 (LNT-2), lacto-N-tetraose (LNT), lacto-N-neotetraose (LNnT), lacto-N-neohexaose (LNnH), p-lacto-N-neohexaose (pLNnH), p-lacto-N-hexaose (pLNH), and lacto-N-hexaose (LNH). Examples of neutral fucosylated HMOs include 2'-fucosyllactose (2'-FL), lacto-N-fucopentaose I (LNFP-I), lacto-N-difucohexaose I (LNDFH-I), 3-fucosyllactose (3-FL), difucosyllactose (DFL), lacto-N-fucopentaose II (LNFP-II), lacto-N-fucopentaose III (LNFP-III), lacto-N-difucohexaose LNnH-III), fucosyl-lacto-N-hexaose II (FLNH-II), lacto-N-fucopentaose V (LNFP-V), lacto-N-difucohexaose II (LNDFH-II), fucosyl-lacto-N-hexaose I (FLNH-I), fucosyl-p-lacto-N-hexaose I (FpLNH-I), fucosyl-p-lacto-N-neohexaose II (F-pLNnH II), and fucosyl-lacto-N-neohexaose (FLNnH). Examples of acidic HMOs include 3'-sialyllactose (3'-SL), 6'-sialyllactose (6'-SL), 3-fucosyl-3'-sialyllactose (FSL), 3'-O-sialyllacto-N-tetraose a (LST a), fucosyl-LST a (FLSTa), 6'-O-sialyllacto-N-tetraose b (LST b), fucosyl-LST b (FLST b), 6'-O-sialyllacto-N-neotetraose (LST c), fucosyl-LST c (FLST c), 3'-O-sialyllacto-N-neotetraose (LST d), fucosyl-LST d (FLST d). d), sialyl-lacto-N-hexaose (SLNH), sialyl-lacto-N-neohexaose I (SLNH-I), sialyl-lacto-N-neohexaose II (SLNH-II) and disialyl-lacto-N-tetraose (DSLNT). In the context of the present invention, lactose is not considered to be an HMO substance.

[0199] In an embodiment, the heterologous product is one or more human milk oligosaccharides (HMOs).

[0200] In an embodiment, the heterologous product is one or more, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or such as 10, human milk oligosaccharides (HMOs). In a preferred embodiment, the HMO product comprises 1 to 5 different HMOs, e.g., 1 HMO, e.g., 2, 3, 4, or 5 HMOs.

[0201] In an embodiment, the human milk oligosaccharide is selected from the group consisting of lacto-N-triose II (LNT-II), lacto-N-tetraose (LNT), lacto-N-neotetraose (LNnT), lacto-N-neohexaose (LNnH), p-lacto-N-neohexaose (pLNnH), p-lacto-N-hexaose (pLNH), lacto-N-hexaose (LNH), 2'-fucosyllactose (2'-FL), lacto-N-fucopentaose I (LNFP-I), lacto-N-difucohexaose I (LNDFH-I), 3-fucosyllactose (3-FL), difucosyllactose (DFL), lacto-N-fucopentaose II (LNFP-II), lacto-N-fucopentaose III (LNFP-III), lacto-N-difucopentaose ... LNDFH-III, fucosyl-lacto-N-hexaose II (FLNH-II), lacto-N-fucopentaose V (LNFP-V), lacto-N-difucohexaose II (LNDFH-II), fucosyl-lacto-N-hexaose I (FLNH-I), fucosyl-p-lacto-N-hexaose I (FpLNH-I), fucosyl-p-lacto-N-neohexaose II (F-pLNnHII) and fucosyl-lacto-N-neohexaose (FLNnH), 3'-sialyllactose (3'-SL), 6'-sialyllactose (6'-SL), 3-fucosyl-3'-sialyllactose (FSL), 3'-O-sialyllactose-N-tetraose a (LST a), fucosyl-LST a (FLSTa), 6'-O-sialylacto-N-tetraose b (LST b), fucosyl-LST b (FLST b), 6'-O-sialylacto-N-neotetraose (LST c), fucosyl-LST c (FLST c), 3'-O-sialylacto-N-neotetraose (LST d), fucosyl-LST d (FLST d), sialyl-lacto-N-hexaose (SLNH), sialyl-lacto-N-neohexaose I (SLNH-I), sialyl-lacto-N-neohexaose II (SLNH-II), and disialyl-lacto-N-tetraose (DSLNT).

[0202] In an embodiment, the one or more HMOs are one or more fucosylated HMOs, such as, but not limited to, one or more fucosylated HMOs selected from the group consisting of 2'-FL, 3-FL, DFL, LNFP-I, LNFP-II, LNFP-III, LNFP-V, LNFP-VI, LNDFH-I, LNDFH-II, TF-LNH, F-LNH-I, F-LNH-II, F-LNH-III, DF-LNH-I, and DF-LNH-II.

[0203] In an embodiment, the one or more HMOs are one or more neutral HMOs, such as, but not limited to, one or more neutral HMOs selected from the group consisting of LNT-II, LNT, LNnT, LNH, and LNnH.

[0204] In an embodiment, the one or more HMOs are one or more sialylated HMOs, such as, but not limited to, one or more sialylated HMOs selected from the group consisting of 3'SL, 6'SL, DSLNT, LST-a, LST-b, LST-c, DS-LNH-I, FDS-LNH-I, FDS-LNH-II, and FSL (3'-S-3-FL).

[0205] In one embodiment, the genetically modified cell produces one or more fucosylated HMOs selected from the group consisting of 2'FL, 3FL, DFL, and LNFP-I.

[0206] In one embodiment, the genetically modified cell produces one or more sialylated HMOs selected from 3'SL, 6'SL, LST-a, and LST-c. In one embodiment, the genetically modified cell produces one or more HMOs selected from 2'FL, 3FL, DFL, 3'SL, and 6'SL.

[0207] In an embodiment, the one or more HMOs include one or more complex HMOs comprising five or more sugar units. In a further embodiment, the heterologous product is a mixture of HMOs comprising at least one complex HMO and one or more precursors of the complex HMO. For example, the HMO mixture can be a mixture comprising LNFP-I, LNFP-II, LNFP-III, LNFP-V, and / or LNFP-VI as complex HMOs and LNT-II, LNT, and / or LNnT as precursor HMOs. The HMO mixture can further comprise byproduct HMOs, such as a mixture of HMOs comprising LNFP-I, LNFP-II, LNFP-III, LNFP-V, and / or LNFP-VI as complex HMOs and LNT-II, LNT, and / or LNnT as precursor HMOs and / or 2'FL, 3-FL, and / or DFL as byproduct HMOs. For the purposes of this invention, the term "byproduct HMO" is understood to mean an HMO that is directly involved in the synthetic pathway from lactose to a complex HMO, for example, the synthetic route for LNFP-1: lactose is modified to form LNT-II; LNT-II is modified to form LNT; and LNT is modified to form LNFP-1. Thus, in the specific synthesis of LNFP-1, 2'FL can be considered a byproduct HMO.

[0208] In preferred embodiments, the cells are capable of producing one or more human milk oligosaccharides (HMOs).

[0209] Genetic modification to produce one or more human milk oligosaccharides (HMOs)

[0210] In addition to at least one heterologous nucleic acid involved in the production of a heterologous product, the genetically modified cells of the present invention may also encompass other modifications that enable them to produce one or more human milk oligosaccharides.

[0211] Such modifications involve metabolic engineering and the introduction and expression of functional enzymes that enable the production of the one or more HMOs from a starting material, typically lactose.

[0212] Thus, the ability of a cell to produce one or more HMOs requires multiple genetic modifications. Thus, the genetically modified cells of the present invention capable of producing one or more HMOs comprise a) one or more glycosyltransferase genes, b) one or more nucleotide-activated sugar pathway genes, such as one or more de novo GDP-fucose pathway genes, one or more CMP-N-acetylneuraminic acid pathway genes, one or more UDP-galactose pathway genes, and / or one or more UDP-N-acetylgalactosamine (GlcNAc) pathway genes; and c) optionally one or more transporter genes.

[0213] Thus, in an embodiment, the genetically engineered cells of the invention comprise at least one heterologous nucleic acid encoding one or more glycosyltransferases and / or one or more transporters.

[0214] As described above, for cells capable of synthesizing one or more HMOs, in addition to having reduced or eliminated function of the stationary phase RNA polymerase sigma factor, RpoS, the genetically modified cells of the present invention must contain at least one heterologous nucleic acid, wherein the heterologous nucleic acid sequence encodes one or more functional enzymes having glycosyltransferase activity. As described with respect to the heterologous nucleic acid sequences of the present invention, the glycosyltransferase gene can be integrated into the genome of the genetically modified cell (via chromosomal integration), or alternatively, it can be contained in a plasmid and expressed in a plasmid-borne manner. If two or more glycosyltransferases are desired for use in genetically modified cells capable of producing HMOs, two or more heterologous nucleic acids encoding enzymes having different glycosyltransferase activities can be incorporated into the nucleic acid construct of the present invention, or they can be separate nucleic acid sequences that can be integrated into the genome and / or expressed from a plasmid. For example, when lactose is used as the initial substrate, in order to produce DFL, two glycosyltransferase activities are required, namely a combination of α-1,2-fucosyltransferase (a first heterologous nucleic acid sequence encoding a first glycosyltransferase) and α-1,3-fucosyltransferase (a second heterologous nucleic acid sequence encoding a second glycosyltransferase), wherein the first and second heterologous nucleic acid sequences can be integrated into the chromosome or introduced into separate plasmids independently of each other, or they can be combined into a nucleic acid construct, optionally contained in the nucleic acid construct of the present invention, which also includes the above-mentioned features.

[0215] In a preferred embodiment, both the first heterologous nucleic acid encoding one or more glycosyltransferases and the second heterologous nucleic acid are stably integrated into the chromosome of the genetically modified cell. In another preferred embodiment, the first heterologous nucleic acid encoding one or more glycosyltransferases and the second heterologous nucleic acid are integrated independently of the heterologous nucleic acid sequence encoding the heterologous polypeptide of the present invention. In another embodiment, the first heterologous nucleic acid encoding one or more glycosyltransferases and the second heterologous nucleic acid are integrated into the disclosed nucleic acid construct of the present invention. In another embodiment, at least one of the heterologous nucleic acid sequences encoding the glycosyltransferases is plasmid-borne.

[0216] In an embodiment, the glycosyltransferase is selected from β-1,3-N-acetyl-glucosaminyltransferase, β-1,3-galactosyltransferase, β-1,4-galactosyltransferase, α-1,2-fucosyltransferase, α-1,3-fucosyltransferase, α-2,3-sialyltransferase, and α-2,6-sialyltransferase.

[0217] β-1,3-N-acetyl-glucosaminyltransferase

[0218] β-1,3-N-acetyl-glucosaminyltransferase is any protein that has the ability to transfer N-acetylglucosamine of UDP-N-acetylglucosamine to lactose or another acceptor molecule in a β-1,3-linked manner. Preferably, the β-1,3-N-acetyl-glucosaminyltransferase used herein is not derived from a species of genetically engineered cells, i.e., the gene encoding the β-1,3-galactosyltransferase is of heterologous origin. Non-limiting examples of β-1,3-N-acetyl-glucosaminyltransferase are given in Table 3. β-1,3-N-acetyl-glucosaminyltransferase variants may also be useful, preferably such variants have at least 80%, such as at least 85%, such as at least 90%, such as at least 95% identity to one of the β-1,3-N-acetyl-glucosaminyltransferases in Table 3.

[0219] Table 3. List of β-1,3-N-acetyl-glucosaminyltransferases

[0220]

[0221]

[0222] β-1,6-N-acetyl-glucosaminyltransferase

[0223] β-1,6-N-acetyl-glucosaminyltransferase is any protein with the ability to transfer the N-acetylglucosamine of UDP-N-acetylglucosamine to an acceptor molecule in a β-1,6-linked manner. Preferably, the β-1,6-N-acetyl-glucosaminyltransferase used herein is not derived from a species of genetically engineered cells, i.e., the gene encoding the β-1,6-galactosyltransferase is of heterologous origin. In the context of the present invention, the acceptor molecule is an acceptor oligosaccharide of at least three or four monosaccharide units, such as LNT or LNnT, or a more complex HMO structure. Some of the following examples use a heterologous β-1,6-N-acetylglucosaminyltransferase from Chryseobacterium sp.KBW03, named Csp2 (NCBI accession number WP_22844786.1) or a variant thereof to produce, for example, LNH or LNnH.

[0224] β-1,3-galactosyltransferase

[0225] A β-1,3-galactosyltransferase is any protein that has the ability to transfer the galactose of UDP-galactose to the N-acetylglucosamine moiety of an acceptor molecule in a β-1,3-linked manner. Preferably, the β-1,3-galactosyltransferase used herein is not derived from a genetically engineered cell species, i.e., the gene encoding the β-1,3-galactosyltransferase is of heterologous origin. Non-limiting examples of β-1,3-galactosyltransferases are provided in Table 4. β-1,3-galactosyltransferase variants may also be useful, preferably such variants having at least 80%, such as at least 85%, such as at least 90%, such as at least 95%, identity to one of the β-1,3-galactosyltransferases in Table 4.

[0226] Table 4. List of β-1,3-glycosyltransferases

[0227]

[0228] β-1,4-galactosyltransferase

[0229] β-1,4-galactosyltransferase is any protein that has the ability to transfer the galactose of UDP-galactose to the N-acetylglucosamine portion. Preferably, the β-1,4-galactosyltransferase used herein is not derived from a species of genetically engineered cell, i.e., the gene encoding the β-1,4-galactosyltransferase is of heterologous origin. Table 5 provides non-limiting examples of β-1,4-galactosyltransferases. β-1,4-galactosyltransferase variants may also be useful, preferably such variants have at least 80%, such as at least 85%, such as at least 90%, such as at least 95% identity to one of the β-1,4-galactosyltransferases in Table 5.

[0230] Table 5. List of β-1,4-glycosyltransferases

[0231] Protein name GenBank ID source HMO products GalT WP_001262061.1 Helicobacter pylori LNJ LgT AAF42257.1 Neisseria meningitidis MC58 LNJ

[0232] α-1,2-fucosyltransferase

[0233] α-1,2-fucosyltransferase is a protein that has the ability to catalyze the transfer of fucose from a donor substrate (e.g., GDP-fucose) to an acceptor molecule in an α-1,2-linked manner. Preferably, the α-1,2-fucosyltransferase used herein is not derived from a species of genetically engineered cells, i.e., the gene encoding the α-1,2-fucosyltransferase is of heterologous origin. Table 6 gives non-limiting examples of α-1,2-fucosyltransferases. α-1,2-fucosyltransferase variants may also be useful, preferably, such variants have at least 80%, such as at least 85%, such as at least 90%, such as at least 95% identity to one of the α-1,2-fucosyltransferases in Table 6.

[0234] Table 6 List of α-1,2-fucosyltransferases

[0235]

[0236]

[0237] α-1,3-fucosyltransferase

[0238] α-1,3-fucosyltransferase refers to a glycosyltransferase that catalyzes the transfer of fucose from a donor substrate (e.g., GDP-fucose) to an acceptor molecule in an α-1,3-linked manner. Preferably, the α-1,3-fucosyltransferase used herein is not derived from a species of genetically engineered cells, i.e., the gene encoding the α-1,3-fucosyltransferase is of heterologous origin. Non-limiting examples of α-1,3-fucosyltransferases are given in Table 7. α-1,3-fucosyltransferase variants may also be useful, preferably, such variants have at least 80%, such as at least 85%, such as at least 90%, such as at least 95% identity to one of the α-1,3-fucosyltransferases in Table 7.

[0239] Table 7 List of α-1,3-fucosyltransferases

[0240]

[0241] α-1,3 / 4-fucosyltransferase

[0242] α-1,3 / 4-fucosyltransferase refers to a glycosyltransferase that catalyzes the transfer of fucose from a donor substrate (e.g., GDP-fucose) to an acceptor molecule in an α-1,3- or α1,4-linked manner. Preferably, the α-1,3 / 4-fucosyltransferase used herein is not derived from a species of genetically engineered cells, i.e., the gene encoding the α-1,3 / 4-fucosyltransferase is of heterologous origin. Non-limiting examples of α-1,3 / 4-fucosyltransferases are given in Table 8. α-1,3 / 4-fucosyltransferase variants may also be useful, preferably, such variants have at least 80%, such as at least 85%, such as at least 90%, such as at least 95% identity to one of the α-1,3 / 4-fucosyltransferases in Table 8.

[0243] Table 8 List of α-1,3 / 4-fucosyltransferases

[0244]

[0245] α-2,3-sialyltransferase

[0246] Alpha-2,3-sialyltransferase refers to a glycosyltransferase that catalyzes the transfer of sialic acid from a donor substrate (e.g., CMP-N-acetylneuraminic acid) to an acceptor molecule in an α-2,3-linked manner. Preferably, the α-2,3-sialyltransferase used herein is not derived from a species of genetically engineered cells, i.e., the gene encoding the 2,3-sialyltransferase is of heterologous origin. Non-limiting examples of α-2,3-sialyltransferases are given in Table 9. α-2,3-sialyltransferase variants may also be useful, preferably such variants have at least 80%, such as at least 85%, such as at least 90%, such as at least 95% identity to one of the α-2,3-sialyltransferases in Table 9.

[0247] Table 9. List of α-2,3-sialyltransferases

[0248]

[0249]

[0250] α-2,6-sialyltransferase

[0251] Alpha-2,6-sialyltransferase refers to a glycosyltransferase that catalyzes the transfer of sialic acid from a donor substrate (e.g., CMP-N-acetylneuraminic acid) to an acceptor molecule in an α-2,6-linked manner. Preferably, the α-2,6-sialyltransferase used herein is not derived from a species of genetically engineered cells, i.e., the gene encoding the 2,6-sialyltransferase is of heterologous origin. Non-limiting examples of α-2,6-sialyltransferases are given in Table 10. α-2,6-sialyltransferase variants may also be useful, preferably such variants have at least 80%, such as at least 85%, such as at least 90%, such as at least 95% identity to one of the α-2,6-sialyltransferases in Table 10.

[0252] Table 10. List of α-2,6-sialyltransferases

[0253]

[0254] Pathway for producing nucleotide-activated sugars

[0255] When carrying out the method for the present invention, it is preferred that the sugar nucleotides activated therein are used as the glycosylation reaction mediated by the glycosyltransferase of the donor. The activated sugar nucleotides usually have the phosphorylated glycosyl residue connected to the nucleoside, and the specific glycosyltransferase only accepts the specific sugar nucleotides. Therefore, it is preferred that the following activated sugar nucleotides participate in the glycosyl transfer: glucose-UDP-GlcNAc, GDP-fucose, UDP-galactose, UDP-glucose, UDP-N-acetylglucosamine, UDP-N-acetylgalactosamine (GlcNAc) and CMP-N-acetylneuraminic acid. Genetically modified cells according to the present disclosure can include one or more pathways of producing nucleotide activated sugars selected from glucose-UDP-GlcNAc, GDP-fucose, UDP-galactose, UDP-glucose, UDP-N-acetylglucosamine, UDP-N-acetylgalactosamine and CMP-N-acetylneuraminic acid.

[0256] Table 11 below provides non-limiting examples of glycosyl donors and HMO products that can be used to produce them; this list is not necessarily exhaustive.

[0257] Table 11. Glycosyl donor HMO product list

[0258]

[0259] In one embodiment of the method, genetically engineered cells can produce the above-mentioned one or more activated sugar nucleotides by de novo pathways. In this regard, activated sugar nucleotides are produced by cells under the action of enzymes participating in the de novo biosynthetic pathway of the corresponding sugar nucleotides, starting from simple carbon sources such as glycerol, fructose or glucose, with a stepwise reaction sequence (a review of monosaccharide metabolism is shown in, for example, HH Freeze and AD Elbein: Chapter 4: Glycosylation precursors, in: Essentials of Glycobiology, 2nd edition (Eds. A. Varki et al.), Cold Spring Harbour Laboratory Press (2009)). The enzymes participating in the de novo biosynthetic pathway of activated sugar nucleotides can be naturally present in cells, or can be introduced into cells by gene technology or recombinant DNA technology, all of which are part of common sense of those skilled in the art. In an embodiment, the expression of one or more enzymes participating in the synthesis of activated sugar nucleotides is regulated by promoters according to the present invention.

[0260] In another embodiment, genetically modified cells can utilize salvaged monosaccharides for the production of activated sugar nucleotides. In the salvage pathway, monosaccharides from degraded oligosaccharides are phosphorylated by kinases and converted into nucleotide sugars by pyrophosphorylases. The enzymes involved in this process can be heterologous enzymes, or can be natural enzymes of the cells used for genetic modification.

[0261] Sialic acid catabolism and biosynthesis pathways

[0262] In some embodiments, the genetically modified cells comprise a defective sialic acid catabolic pathway. A "sialic acid catabolic pathway" refers to a sequence of reactions typically controlled and catalyzed by an enzyme that results in the degradation of sialic acid. An exemplary sialic acid catabolic pathway as described herein is an E. coli pathway. In this pathway, sialic acid (Neu5Ac; N-acetylneuraminic acid) is degraded by the enzymes NanA (N-acetylneuraminic acid lyase) and NanK (N-acetylmannosamine kinase) and NanE (N-acetylmannosamine-6-phosphate isomerase), all encoded by the nanATEK-yhcH operon and suppressed by NanR (http: / / ecocyc.org / ECOLI). By introducing mutations in endogenous nanA (N-acetylneuraminic acid lyase) (e.g., GenBank accession number D00067.1 (GL216588)) and / or nanK (N-acetylmannosamine kinase) (e.g., GenBank accession number (amino acids) BAE77265.1 (GL85676015)), and / or nanE (N-acetylmannosamine-6-phosphate epimerase, G1:947745, incorporated herein by reference), a defective sialic acid catabolic pathway is produced in an E. coli host. Alternatively, the nanT (N-acetylneuraminic acid transporter) gene is also inactivated or mutated. Other intermediates of sialic acid metabolism include: (ManNAc-6-P) N-acetylmanosamine-6-phosphate; (GlcNAc-6-P) N-acetylglucosamine-6-phosphate; (GlcN-6-P) glucosamine-6-phosphate and (Fruc-6-P) fructose-6-phosphate. In some preferred embodiments, nanA is mutated. In other preferred embodiments, nanA and nanK are mutated, while nanE remains functional. In another preferred embodiment, nanA and nanE are mutated, while nanK is not mutated, inactivated or deleted. The mutation is one or more changes in the nucleic acid sequence encoding the gene product of nanA, nanK, nanE and / or nanT. For example, the mutation can be 1, 2, at most 5, at most 10, at most 25, at most 50 or at most 100 changes in the nucleic acid sequence. For example, the nanA, nanK, nanE and / or nanT genes are mutated by null mutation. Null mutations as described herein include amino acid substitutions, additions, deletions or insertions that result in either loss of enzyme function (i.e., reduced or no activity) or loss of enzyme (i.e., no gene product). "Delete" refers to a coding region that is completely or partially removed so that no (functional) gene product is produced.Inactivation means that the polypeptide coding sequence has been altered such that the resulting gene product is functionally inactive, or the activity of the encoded gene product is less than 100%, such as 90%, 80%, 70%, 60%, 50%, 40%, 30% or 20% of the native, naturally occurring, endogenous gene product. A "non-mutated" gene or protein does not differ from the native, naturally occurring or endogenous coding sequence by 1, 2, at most 5, at most 10, at most 20, at most 50, at most 100, at most 200 or at most 500 or more codons, or from the corresponding encoded amino acid sequence.

[0263] In addition, bacteria (eg, E. coli) may also contain sialic acid synthesis capabilities. For example, the bacteria include sialic acid synthesis capability by providing exogenous UDP-GlcNAc 2-epimerase (e.g., neuC of Campylobacter jejuni (GenBank AAK91727.1) or equivalent (e.g., (GenBank CAR04561.1)), Neu5Ac synthase (e.g., neuB of Campylobacter jejuni (GenBank AAK91726.1) or equivalent (e.g., Flavobacterium limnosediminis sialic acid synthase, GenBank WP_023580510.1), and / or CMP-Neu5Ac synthase (e.g., neuA of Campylobacter jejuni (GenBank AAK91728.1) or equivalent (e.g., Vibrio brasiliensis CMP-sialic acid synthase, GenBank WP_006881452.1).

[0264] Colanic acid gene cluster

[0265] For the production of fucosylated HMOs, the de novo GDP-fucose pathway is important to ensure the presence of sufficient GDP-fucose. The colanic acid gene cluster of Escherichia coli is responsible for the production of the extracellular polysaccharide colanic acid, the major oligosaccharide of the bacterial cell wall.

[0266] To produce GDP-fucose, four genes in the colanic acid gene cluster encode enzymes involved in de novo GDP-fucose synthesis (gmd, wcaG, manB, and manC), while one or more genes downstream of GDP-L-fucose (e.g., wcaJ) can be deleted to prevent the conversion of GDP-fucose to colanic acid. wcaH and wcaI are also part of the colanic acid gene cluster (operon) but are not required for GDP-fucose production. However, another enzyme, ManA, is part of the de novo GDP-fucose pathway and is encoded by a gene independent of the colanic acid gene cluster.

[0267] In order to ensure a sufficient amount of GDP-fucose, the promoter of the natural colanic acid (colanic acid) gene cluster can be replaced with a stronger promoter to produce the recombinant colanic acid gene cluster to drive the extra production of GDP-fucose. In addition, as described in the Examples, an extra copy of the colanic acid gene cluster can be introduced into genetically engineered cells. With regard to the present invention, the colanic acid gene cluster is preferably regulated by a promoter, the promoter being identified by the σ factor (e.g., RpoD or SigA) of the cell active in the cell growth phase. The promoter can be selected from Table 1, particularly a promoter derived from PglpF.

[0268] In embodiments, the colanic acid gene cluster can be expressed from its native genomic locus. Expression can be actively modulated. Expression can be modulated by exchanging the native promoter with a desired promoter and / or by expressing the gene cluster from an alternative, non-native, genomic locus, or by episomal expression of the colanic acid gene cluster or a specific gene thereof to increase the number of copies of the colanic acid gene encoding the protein.

[0269] In connection with the present disclosure, the term "natural genomic locus", with respect to the corazol gene cluster, relates to the original and natural location of the gene cluster in the genome of a genetically engineered cell.

[0270] The de novo GDP-fucose pathway genes responsible for GDP-fucose formation include or consist of the following genes:

[0271] i) manA, which encodes the protein mannose-6-phosphate isomerase (EC 5.3.1.8, UniProt accession nr. P00946), which promotes the interconversion of fructose 6-phosphate (F6P) and mannose-6-phosphate;

[0272] ii) manB, which encodes a protein phosphomannosemutase (EC 5.4.2.8, UniProt accession number nrP24175), which is involved in the biosynthesis of GDP-mannose by catalyzing the conversion of mannose-6-phosphate to mannose-1-phosphate;

[0273] iii) manC, which encodes the protein mannose-1-phosphate guanylyltransferase (EC: 2.7.7.13, UniProt accession number nr P24174), which is involved in the GDP-mannose biosynthesis process of synthesizing GDP-mannose from GTP and α-D-mannose-1-phosphate;

[0274] iv) gmd, which encodes the protein GDP-mannose-4,6-dehydratase (UniProt accession number nr P0AC88), which catalyzes the conversion of GDP-mannose to GDP-4-dehydro-6-deoxy-D-mannose;

[0275] v) wcaG (fcl), which encodes the protein GDP-L-fucose synthase (EC 1.1.1.271, UniProt accession number nrP32055), which catalyzes the two-step NADP-dependent conversion of GDP-4-dehydro-6-deoxy-D-mannose to GDP-fucose.

[0276] Thus, it is preferred that when producing one or more fucosylated heterologous products, the genetically engineered cells overexpress the entire colonic acid gene cluster and / or one or more genes of the de novo GDP-fucose pathway selected from manA, manB, manC, gmd and wcaG.

[0277] In a further embodiment, overexpression of one or more genes of the de novo GDP-fucose pathway is obtained by adding additional copies of one or more genes encoding the entire colanic acid gene cluster or one or more genes of the colanic acid gene cluster and / or ManA, preferably using a promoter recognized by a sigma factor of the cell that is active in the cell growth phase, such as RpoD or SigA upstream of one or more additional colanic acid gene cluster genes.

[0278] In an embodiment, fucosylated oligosaccharides are produced by genetic engineering and mannose-6-phosphate isomerase (manA) and / or phosphomannose mutase (manB) are overexpressed.

[0279] In an embodiment, the oligosaccharide is a fucosylated oligosaccharide and an extra copy of manA encoding mannose-6-phosphate isomerase is inserted into the genome of the genetically modified cell. Preferably, a promoter is used that is recognized by a sigma factor (e.g., RpoD or SigA) of the cell that is active in the growth phase.

[0280] In an embodiment, the oligosaccharide is a fucosylated oligosaccharide and an extra copy of manB encoding phosphomannose mutase is inserted into the genome of the genetically modified cell.Preferably, a promoter is used that is recognized by the cell's sigma factor (e.g. RpoD or SigA) that is active in the cell growth phase.

[0281] In an embodiment, the oligosaccharide is a fucosylated oligosaccharide and additional copies of manA and manB are inserted into the genome of the genetically modified cell. Preferably, a promoter is used which is recognized by the cell's sigma factor (eg RpoD or SigA) which is active during the cell growth phase.

[0282] In an embodiment, the genetically engineered cells of the invention comprise at least one additional copy of manB compared to the number of copies of manC (encoding mannose-1-phosphate guanylyltransferase), gmd (encoding GDP-D-mannose-4,6-dehydratase), and wcaG (encoding GDP-L-fucose synthase).

[0283] In an embodiment, the genetically engineered cells of the invention comprise at least the same or more copies of manA compared to the number of copies of manC (encoding mannose-1-phosphate guanylyltransferase), gmd (encoding GDP-D-mannose-4,6-dehydratase), and wcaG (encoding GDP-L-fucose synthase).

[0284] In an embodiment, the genetically engineered cells of the present invention comprise at least two copies of manA and three copies of manB. In the context of the present invention, when assessing the copy number of a gene, the natural endogenous copies are included in the count. Thus, three copies of manB can be achieved from the insertion of the natural colanic acid gene cluster and an additional colanic acid gene cluster (SEQ ID NO: 57) and the insertion of a manB coding sequence independent of the colanic acid gene cluster.

[0285] Lactose permease

[0286] Lactose permease is a membrane protein that is a member of the major facilitator superfamily and can be classified as a symporter, which uses the proton gradient toward the cell to transport β-galactosides such as lactose into the cell in the same direction. Among oligosaccharides, especially in the production of human milk oligosaccharides (HMOs), lactose is generally the initial substrate for any HMO of interest that is modified to produce a biotransformation that occurs inside the cell. Therefore, when preparing HMOs, it is desirable to be able to introduce lactose into the cell, for example, by expressing a lactose permease such as lacY from Escherichia coli K.-12. In an embodiment, the nucleic acid encoding the lactose permease is under the control of a promoter recognized by the RNA transcription factor RpoD according to the present invention.

[0287] In an embodiment, the lactose permease is represented by SEQ ID NO:85, or a functional homologue thereof having an amino acid sequence that is at least 80% identical to SEQ ID NO:85, such as at least 85%, 90% or 95% identical.

[0288] In a further embodiment, the lactose permease is LacY, and the nucleic acid sequence encoding LacY is under the control of a promoter recognized by a cellular sigma factor active in the cell growth phase (eg, RpoD or SigA).

[0289] In an embodiment, the expression of the lactose permease is regulated by a promoter according to the present invention.

[0290] β-galactosidase

[0291] Host cells suitable for HMO production, such as E. coli, can contain an endogenous β-galactosidase gene or an exogenous β-galactosidase gene. For example, E. coli includes an endogenous lacZ gene (e.g., GenBank Accession No. V00296 (GI:41901)). For the purposes of the present invention, when producing HMOs, the genetically engineered cells are genetically manipulated to not contain any β-galactosidase genes or to contain an inactivated β-galactosidase gene. The gene can be inactivated by completely or partially deleting the corresponding nucleic acid sequence from the bacterial genome, or the gene sequence can be mutated so that it is not transcribed, or if transcribed, the transcript is not translated or, if converted into a protein (i.e., β-galactosidase), the protein does not have the corresponding enzymatic activity. In this way, the HMO-producing bacteria accumulate an increased intracellular lactose pool, which is beneficial for HMO production.

[0292] Major facilitator superfamily (MFS) transporters

[0293] Heterologous products such as HMOs can accumulate within cells and in the extracellular matrix. The product can be transported to the supernatant in a passive manner, that is, it diffuses outside the cell membrane. More complex heterologous products may remain in the cell, which may ultimately impair cell growth, thereby affecting the possible total yield of product from a single fermentation. Product transport, particularly HMO transport, can be facilitated by transport proteins from the master facilitator superfamily that promote the efflux of sugar derivatives from the cell to the supernatant. Master facilitator superfamily transport proteins can be heterologous or native and can be overexpressed under fermentation conditions to enhance the export of products or their derivatives, such as HMOs. The specificity of a particular heterologous product (e.g., an HMO with a specific sugar moiety) can be altered by mutation using known recombinant DNA techniques.

[0294] Therefore, the genetically engineered cells according to the invention may further comprise a nucleic acid sequence encoding a transporter protein of the major facilitator superfamily capable of exporting a heterologous product or products.

[0295] In recent years, several new and potent major facilitator superfamily transporters have been identified, each specific for a different recombinantly produced HMO, and the development of recombinant cells expressing said proteins is advantageous for large-scale industrial HMO manufacturing.

[0296] Therefore, in one or more exemplary embodiments, the genetically engineered cells according to the methods described herein further comprise heterologous nucleic acids encoding a transporter that serves as a major facilitator superfamily transporter. The gene product that serves as a major facilitator superfamily transporter can be encoded by a heterologous nucleic acid sequence expressed in the genetically engineered cells. The heterologous nucleic acid sequence encoding the major facilitator superfamily transporter can be integrated into the genome of the genetically engineered cells or expressed using a plasmid.

[0297] In one embodiment, the genetically engineered cells of the invention comprise a nucleic acid sequence encoding a major facilitator superfamily transporter protein capable of exporting a heterologous product.

[0298] Thus, in an embodiment, the genetically engineered cell expresses at least one heterologous MFS sugar transporter. In a further embodiment, the heterologous MFS sugar transporter is selected from the group consisting of Nec, YberC, Fred, Bad, and Vag.

[0299] Thus, in an embodiment, the genetically engineered cells of the present disclosure express a heterologous MFS transporter selected from the group consisting of: Vag, Nec, Fred, Marc, YberC, Bad, and a functional homolog of any one of Vag, Nec, Fred, Marc, YberC, or Bad, the amino acid sequence of which is at least 70%, such as at least 75%, 80%, 85%, 90%, 95%, or 99% identical to the amino acid sequence of any one of SEQ ID NO: 89, 88, 52, 86, 51, or 87.

[0300] Preferably, the MFS transporter is selected from Nec (SEQ ID NO: 51) or Marc (SEQ ID NO: 52) and functional homologues thereof, the amino acid sequence of which is at least 70%, such as at least 75%, 80%, 85%, 90%, 95% or 99% identical to the amino acid sequence of SEQ ID NO: 51 or 52.

[0301] Nec

[0302] In the context of the present invention, the MFS transporter is preferably a heterologous gene encoding a putative MFS (major facilitator superfamily) transporter derived from the bacterium Rosenbergiella nectarea, herein identified as Nec. Nec has the amino acid sequence of SEQ ID NO: 51; the amino acid sequence identified herein as SEQ ID NO: 51 is an amino acid sequence that is 100% identical to the amino acid sequence having GenBank Accession No. WP_092672081.1.

[0303] In one or more exemplary embodiments, the MFS transporter expressed according to the present disclosure is Nec. Thus, the genetically engineered cells of the present disclosure, in one or more exemplary embodiments, express a heterologous MFS transporter having at least 80%, such as at least 85%, such as at least 90%, such as at least 95% or 100% sequence identity to the amino acid sequence of SEQ ID NO: 51.

[0304] In a further embodiment, the nucleic acid sequence encoding Nec is under the control of a promoter that is recognized by a cellular sigma factor (eg, RpoD or SigA) that is active in the cell growth phase.

[0305] Bad

[0306] The MFS transporter, identified interchangeably herein as "Bad protein," "Bad transporter," or "Bad," has the amino acid sequence of SEQ ID NO:86; the amino acid sequence identified herein as SEQ ID NO:86 is an amino acid sequence that is 100% identical to the amino acid sequence having GenBank Accession No. WP_017489914.1. In one or more exemplary embodiments, the MFS transporter expressed according to the present disclosure is Bad. Thus, in one or more exemplary embodiments, the genetically engineered cells of the present disclosure express a heterologous MFS transporter that has at least 80%, such as at least 85%, such as at least 90%, such as at least 95%, or 100% sequence identity to the amino acid sequence of SEQ ID NO:86.

[0307] In a further embodiment, the nucleic acid sequence encoding Bad is under the control of a promoter that is recognized by a cellular sigma factor (eg, RpoD or SigA) that is active in the cell's growth phase.

[0308] YberC

[0309] The MFS transporter, identified interchangeably herein as "YberC protein" or "YberC transporter" or "YberC," has the amino acid sequence of SEQ ID NO:87; the amino acid sequence identified herein as SEQ ID NO:87 is an amino acid sequence that is 100% identical to the amino acid sequence having GenBank Accession No. EEQ08298.1.

[0310] In one or more exemplary embodiments, the MFS transporter expressed according to the present disclosure is Yber C. Thus, in one or more exemplary embodiments, the genetically engineered cells of the present disclosure express a heterologous MFS transporter having at least 80%, such as at least 85%, such as at least 90%, such as at least 95% or 100% sequence identity to the amino acid sequence of SEQ ID NO: 57.

[0311] In a further embodiment, the nucleic acid sequence encoding YberC is under the control of a promoter that is recognized by a cellular sigma factor (eg, RpoD or SigA) that is active in the cell's growth phase.

[0312] Fred

[0313] The MFS transporter, identified interchangeably herein as "Fred protein" or "Fred transporter" or "Fred," has the amino acid sequence of SEQ ID NO:88; the amino acid sequence identified herein as SEQ ID NO:88 is an amino acid sequence that is 100% identical to the amino acid sequence having GenBank Accession No. WP_087817556.1.

[0314] In one or more exemplary embodiments, the MFS transporter expressed according to the present disclosure is Fred. Thus, the genetically engineered cells of the present disclosure, in one or more exemplary embodiments, express a heterologous MFS transporter having at least 80%, such as at least 85%, such as at least 90%, such as at least 95% or 100% sequence identity to the amino acid sequence of SEQ ID NO: 88.

[0315] In a further embodiment, the nucleic acid sequence encoding Fred is under the control of a promoter that is recognized by a cellular sigma factor (eg, RpoD or SigA) that is active in the cell's growth phase.

[0316] Vag

[0317] The MFS transporter, identified interchangeably herein as "Vag protein" or "Vag transporter" or "Vag," has the amino acid sequence of SEQ ID NO:89; the amino acid sequence identified herein as SEQ ID NO:89 is an amino acid sequence that is 100% identical to the amino acid sequence having GenBank Accession No. WP_048785139.1.

[0318] In one or more exemplary embodiments, the MFS transporter expressed according to the present disclosure is Vag. Thus, the genetically engineered cells of the present disclosure, in one or more exemplary embodiments, express a heterologous MFS transporter having at least 80%, such as at least 85%, such as at least 90%, such as at least 95% or 100% sequence identity to the amino acid sequence of SEQ ID NO: 89.

[0319] In a further embodiment, the nucleic acid sequence encoding Vag is under the control of a promoter that is recognized by a cellular sigma factor (eg, RpoD or SigA) that is active in the cell's growth phase.

[0320] Marc

[0321] The MFS transporter, identified interchangeably herein as "Marc protein" or "Marc transporter" or "Marc," has the amino acid sequence of SEQ ID NO:52; the amino acid sequence identified herein as SEQ ID NO:52 is an amino acid sequence that is 100% identical to the amino acid sequence having GenBank Accession No. WP_060448169.1.

[0322] In embodiments, the MFS transporter expressed according to the present disclosure is Marc. Thus, the genetically engineered cells of the present disclosure, in one or more exemplary embodiments, express a heterologous MFS transporter having at least 80%, such as at least 85%, such as at least 90%, such as at least 95% or 100% sequence identity to the amino acid sequence of SEQ ID NO: 52.

[0323] In a further embodiment, the nucleic acid sequence encoding Marc is under the control of a promoter that is recognized by a cellular sigma factor (eg, RpoD or SigA) that is active in the cell's growth phase.

[0324] In an embodiment, expression of the heterologous MFS transporter is regulated by a promoter according to the invention.

[0325] Genetically engineered cells

[0326] In this context, the terms "genetically modified cells" and "genetically engineered cells" are used interchangeably. As used herein, a "genetically engineered cell" is a host cell whose genetic material has been altered by human intervention using genetic engineering techniques, such as, but not limited to, transformation or transfection with heterologous polynucleotide sequences, Crisper / Cas editing, and / or random mutagenesis.

[0327] Described herein are genetically engineered cells for the biosynthetic production of one or more heterologous products, wherein

[0328] a. said genetically engineered cell comprises at least one heterologous nucleic acid encoding a heterologous product and / or a polypeptide required for producing said one or more heterologous products,

[0329] b. wherein the transcription and / or expression of the heterologous nucleic acid is regulated by a promoter that is recognized by a sigma factor of a cell that is actively growing, and

[0330] c. wherein the function of the cell's sigma factor active in the stationary phase of the cell is reduced or abolished in said cell.

[0331] In an embodiment, the genetically engineered cell comprises at least one heterologous nucleic acid involved in the production of a heterologous product, said heterologous nucleic acid being controlled by a promoter recognized by a cellular sigma factor (eg, RpoD or SigA) that is active in the cell's growth phase.

[0332] Furthermore, it will be understood that genetic modifications can be, for example, selected from heterologous nucleic acids encoding heterologous products and / or from enzymes required for the production of one or more heterologous products, such as, but not limited to, glycosyltransferases and / or metabolic pathway engineering and specific transporters and regulatory factors as described in the above sections, which a person skilled in the art will know how to incorporate into a genetically engineered cell capable of producing one or more heterologous products.

[0333] In currently preferred embodiments, the genetically engineered cells are capable of producing heterologous products, particularly cell-free heterologous products.

[0334] The genetically engineered cells are preferably microbial cells, such as prokaryotic cells. Suitable microbial cells that can be used as host cells include bacterial cells and archaeal cells.

[0335] In a preferred embodiment, the genetically engineered cell is a bacterial cell. In another embodiment, the bacterial cell is a gram-negative bacterium. In another embodiment, the bacterial cell is a gram-positive bacterium.

[0336] host cells

[0337] Regarding bacterial host cells, there are generally no restrictions; they can be fungal (Gram-positive or Gram-negative) or archaea, as long as they allow genetic manipulation to insert the gene of interest and can be cultured on a manufacturing scale. Preferably, the host cells have properties that allow cultivation to high cell densities. Non-limiting examples of bacterial host cells suitable for the recombinant industrial production of HMOs according to the present invention may be Erwinia herbicola (Pantoea agglomerans), Citrobacter freundii, Campylobacter sp, Pantoea citrea, Pectobacterium carotovorum, or Xanthomonas campestris. Bacillus bacteria, including Bacillus subtilis, Bacillus licheniformis, Bacillus coagulans, Bacillus thermophilus, Bacillus laterosporus, Bacillus megaterium, Bacillus mycoides, Bacillus pumilus, Bacillus lentus, Bacillus cereus, and Bacillus circulans, may also be used.Similarly, bacteria of the genera Lactobacillus and Lactococcus, including but not limited to Lactobacillus acidophilus, Lactobacillus salivarius, Lactobacillus plantarum, Lactobacillus helveticus, Lactobacillus delbrueckii, Lactobacillus rhamnosus, Lactobacillus bulgaricus, Lactobacillus crispatus, Lactobacillus gasseri, Lactobacillus casei, Lactobacillus reuteri, Lactobacillus jensenii, and Lactococcus lactis, can be engineered using the methods described herein. Streptococcus thermophiles and Proprionibacterium freudenreichii are also suitable bacterial species for the invention described herein. Also included are strains engineered as described herein from the genera Enterococcus (e.g., Enterococcus faecium and Enterococcus thermophiles), Bifidobacterium (e.g., Bifidobacterium longum, Bifidobacterium infantis, and Bifidobacterium bifidum), Sporolactobacillus spp., Micromomospora spp., Micrococcus spp., Rhodococcus spp., and Pseudomonas (e.g., Pseudomonas fluorescens and Pseudomonas aeruginosa).

[0338] In an embodiment, the microbial strain is not a Salmonella strain that has been attenuated for vaccination purposes.

[0339] In one or more exemplary embodiments, the genetically engineered cell is selected from Escherichia coli, Corynebacterium glutamicum, Lactococcus lactis, Bacillus subtilis, Streptomyces lividans, and the like.

[0340] In one or more exemplary embodiments, the genetically engineered cell is a Gram-positive bacterium. In another embodiment, the Gram-positive bacterium is selected from Bacillus subtilis, Corynebacterium glutamicum, Lactococcus lactis, Bacillus subtilis, and Streptomyces lividans.

[0341] In one or more exemplary embodiments, the genetically engineered cell is Bacillus subtilis.

[0342] In one or more exemplary embodiments, the genetically engineered cell is Corynebacterium glutamicum.

[0343] In one or more exemplary embodiments, the genetically engineered cell is a Gram-negative bacterium. In a further embodiment, the Gram-negative bacterium is selected from Escherichia coli and Gluconobacter oxydans.

[0344] In one or more exemplary embodiments, the genetically engineered cell is Escherichia coli.

[0345] In one or more exemplary embodiments, the present invention relates to a genetically engineered cell, wherein the cell is derived from E. coli K-12 strain or DE3.

[0346] In one or more exemplary embodiments, the present invention relates to a genetically engineered cell, wherein the cell is derived from Escherichia coli K-12 DH1 or DH5-α strain.

[0347] Uses of genetically engineered cells

[0348] The present invention relates to the use of a genetically engineered cell according to the invention for the production of a heterologous product. In an embodiment, the genetically engineered cell is used to produce one or more HMOs as described herein.

[0349] In embodiments, genetically engineered cells are used to produce polypeptides, such as antibodies, functional antibody fragments, or enzymes described herein.

[0350] In an embodiment, the genetically engineered cells are used to produce oligosaccharides, such as the human milk oligosaccharides described herein.

[0351] Methods for producing heterologous products

[0352] The present invention relates to a method for producing a heterologous product, said method comprising culturing a genetically engineered cell according to the invention.

[0353] Specifically, the production method of the heterologous product includes:

[0354] a. providing a genetically engineered cell as described herein,

[0355] b. culturing the genetically engineered cells in a culture medium under conditions that allow production of the heterologous product; and optionally

[0356] c. recovering the heterologous product from the culture.

[0357] In one aspect, the method of the present invention is used to produce one or more HMOs and comprises providing an acceptor sugar comprising at least two monosaccharide units, which is exogenously added to the culture medium and / or has been produced by separate microbial fermentation and is selected from lactose and LNT-II. In a preferred embodiment, the substrate for HMO formation is lactose, which is supplied to the culture during fermentation of the genetically engineered cells.

[0358] The produced heterologous product is recovered from the culture medium and / or genetically engineered cells. In an embodiment, the recovered heterologous product is cell-free, meaning that no living cells are present in the product, preferably cells have been removed from the heterologous product.

[0359] Cultivation or fermentation (used interchangeably herein) in a controlled bioreactor typically comprises (a) a first phase of exponential cell growth in a medium ensured by a carbon source, and (b) a second phase of cell growth in a medium operated under carbon limitation, wherein the carbon source is continuously added along with additional components (e.g., an acceptor oligosaccharide, such as lactose) to allow formation of the HMO product during this phase.

[0360] In a preferred embodiment, the cultivation is a fed-batch fermentation or a continuous fed-batch fermentation (feed and bleed fermentation), wherein the carbon source is fed continuously to the fermentation broth during the fermentation. Preferably, the feed phase is operated under carbon limiting conditions.

[0361] For the present invention, the pH is above 6, e.g., above 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7.0, 7.1, 7.2 or 7.3, preferably above 6.5 and below 8. In an embodiment, the pH during cultivation is kept above 6.0, preferably above 6.5.

[0362] The terms "manufacturing" or "manufacturing scale" or "large-scale production" or "large-scale fermentation" are used interchangeably and define, in the sense of the present invention, a fermentation with a minimum volume of 100 L, e.g., 1000 L, e.g., 10,000 L, e.g., 100,000 L, e.g., 200,000 L of culture medium. Typically, a "manufacturing scale" process is defined as a process capable of handling large volumes of the heterologous product of interest, e.g., in the case of therapeutic compounds or compositions, to meet the needs of toxicity testing, clinical trials, and market supply. In addition to the large volumes, unlike simple laboratory-scale methods such as shake flask cultures, manufacturing-scale methods are characterized by technical systems using bioreactors (fermenters) equipped with means for stirring, aeration, nutrient feeding, monitoring and control of process parameters (pH, temperature, dissolved oxygen tension, back pressure, etc.). To a large extent, the behavior of the expression system in laboratory-scale methods, such as shake flasks, bench-top bioreactors, or the deepwell format described in the embodiments of the present disclosure, does allow prediction of the behavior of the system in the complex environment of the bioreactor.

[0363] Regarding the suitable cell culture medium used in the fermentation process, there are no restrictions. The culture medium can be semi-defined, i.e. containing complex culture medium compounds (e.g., yeast extract, soy peptone, casamino acids, etc.), or it can be chemically defined, without any complex compounds. The carbon source can be selected from glucose, sucrose, fructose, xylose, and glycerol. In an embodiment, the culture medium is supplemented with one or more carbon sources selected from glycerol, sucrose, and glucose.

[0364] In one or more exemplary embodiments, the culture medium comprises sucrose as the sole carbon source. In one or more exemplary embodiments, the genetically engineered cells comprise one or more heterologous nucleic acid sequences encoding one or more heterologous polypeptides that enable the utilization of sucrose as the sole carbon source for the genetically engineered cells.

[0365] In one or more exemplary embodiments, the genetically engineered cell comprises a PTS-dependent sucrose utilization system further comprising the scrYA and scrBR operons described in WO 2015 / 197082 (incorporated herein by reference).

[0366] The proteins encoded by the two operons are a sucrose-specific porin (scrY) represented by SEQ ID NO: 53 or a functional homolog thereof, a sucrose transporter proteinase II (ScrA) represented by SEQ ID NO: 54 or a functional homolog thereof, a scrB invertase (ScrB) represented by SEQ ID NO: 55 or a functional homolog thereof, and a Scr repressor protein (ScrR) represented by SEQ ID NO: 56 or a functional homolog thereof.

[0367] In a further embodiment, the nucleic acid sequences encoding the scrYA and scrBR operons are under the control of a promoter that is recognized by a cellular sigma factor (eg, RpoD or SigA) that is active in the growth phase of the cell.

[0368] After carrying out the method of the present invention, the produced sialylated HMOs can be collected from the cell culture or fermentation broth in a conventional manner.

[0369] Recycling / Harvesting

[0370] Recovering heterologous products from culture medium and / or genetically engineered cells. In this context, the term "recovering" is used interchangeably with the term "harvesting." Both "recovering" and "harvesting" in this context refer to collecting the produced heterologous products, such as HMOs, from the culture medium / fermentation broth after fermentation has terminated. In one or more exemplary embodiments, this may include collecting the heterologous products, such as HMOs, contained in both the biomass (i.e., host cells) and the culture medium, i.e., before / without separation of the fermentation broth from the biomass. In other embodiments, the produced HMOs may be collected separately from the biomass and the fermentation broth, i.e., after / after separation of the biomass from the culture medium (i.e., fermentation broth). In embodiments, the heterologous products, such as HMOs, do not contain any living cells, and preferably are isolated heterologous products, such as HMOs, that are separated from the biomass and are therefore cell-free.

[0371] Separation of the cells from the culture medium can be performed by any method known to those skilled in the art, such as any suitable type of centrifugation or filtration. Separation of the cells from the culture medium can be performed immediately after harvesting the fermentation broth, or at a later stage after storing the fermentation broth under appropriate conditions. Recovering the produced HMOs from the remaining biomass (or total fermentation broth) includes extracting them from the biomass (i.e., the producer cells).

[0372] After recovery from fermentation, HMOs are available for further processing and purification.

[0373] Heterologous products can be purified according to methods known to those skilled in the art.

[0374] For example, HMOs can be purified according to methods known in the art, for example, as described in WO 2015 / 188834, WO 2017 / 182965 or WO 2017 / 152918, the latter of which describes the purification of sialylated HMOs. The purified HMOs can be used as nutraceuticals, pharmaceuticals or for any other purpose, such as for research.

[0375] At the end of the culture period, the product can accumulate within the cells and in the extracellular matrix.

[0376] Biosynthetic production

[0377] Term " biosynthetic production " according to the present invention relates to the production of one or more heterologous products of the present invention, wherein synthesis / production is carried out by genetically engineered cells, and product is purified from cells to obtain cell-free product.Therefore, biosynthetic production can be a single-step or multi-step, potential enzyme-catalyzed method, wherein substrate is converted into more complex product in the host organism.For example, in some biosynthetic reactions, simple compounds are modified and / or converted into other compounds and / or connected to form macromolecules.Therefore, biosynthetic production generally includes metabolic pathway engineering of host cells, to achieve and / or promote the biosynthetic production of heterologous products.Some of these biosynthetic pathways are located in single organelles, while other pathways relate to enzymes located in multiple organelles.The non-limiting examples of metabolic pathway engineering relate to the engineering of one or more biosynthetic pathways, for the preparation of at least one sugar nucleotide, engineered substrate import, engineered pathway to export the heterologous product produced and / or express one or more functional enzymes.

[0378] manufactured products

[0379] The term "manufactured product" as used in reference to genetically engineered cells or nucleic acid constructs refers to one or more heterologous products, such as but not limited to HMOs, that are intended as the product or products. Various products are described above.

[0380] Advantageously, the methods disclosed herein provide for increased overall yields of the product. Thus, less by-product formation associated with product formation promotes increased product production and improves the efficiency of the production and product recovery processes, thereby providing a superior HMO manufacturing process.

[0381] The manufactured product may be a powder, composition, suspension or gel comprising one or more HMOs.

[0382] Modes for Carrying Out the Invention

[0383] 1. A genetically engineered cell for biosynthetically producing one or more heterologous products, wherein

[0384] a. the genetically engineered cell comprises at least one heterologous nucleic acid encoding a heterologous product and / or a polypeptide required for producing one or more heterologous products,

[0385] b. wherein the transcription and / or expression of the heterologous nucleic acid is regulated by a promoter that is recognized by a sigma factor of a cell that is actively growing, and

[0386] c. wherein the function of the cell's sigma factor, which is active in the stationary phase of the cell, is reduced or eliminated in said cell.

[0387] 2. The genetically engineered cell according to item 1, wherein the genetically engineered cell is not a vaccine strain.

[0388] 3. The genetically engineered cell according to item 1 or 2, wherein the heterologous product is selected from the group consisting of albumin, peptides, polypeptides, antibodies and fragments thereof, enzymes, oligosaccharides, vitamins, cannabinoids and carotenoids.

[0389] 4. The genetically engineered cell according to any one of the preceding items, wherein the heterologous product is not an antigen for vaccination.

[0390] 5. The genetically engineered cell according to items 1 to 4, wherein the stationary phase RNA polymerase sigma factor is SigB.

[0391] 6. The genetically engineered cell according to item 1 or 4, wherein the stationary phase RNA polymerase sigma factor is RpoS.

[0392] 7. The genetically engineered cell according to any one of the preceding items, wherein the cell has been engineered such that the function of the cell's sigma factor, which is active in the stationary phase of the cell, is reduced or eliminated.

[0393] 8. The genetically engineered cell according to any one of the preceding items, wherein the function of the stationary phase RNA polymerase sigma factor is reduced or eliminated by:

[0394] a. Complete or partial inactivation of the genes encoding RpoS or SigB

[0395] b. Reducing or eliminating the function of one or more factors that promote RpoS or SigB function.

[0396] 9. The genetically engineered cell according to item 8, wherein the gene encoding one or more RpoS or SigB promoting factors is completely or partially inactivated.

[0397] 10. The genetically engineered cell according to item 8 or 9, wherein the one or more RpoS promoting factors are selected from ArcZ, DksA, GadX, DsrA, DeaD, RprA and Crl.

[0398] 11. The genetically engineered cell according to any one of the preceding items, wherein the function of the stationary phase RNA polymerase sigma factor is reduced or eliminated by increasing the function of one or more factors that inhibit the function of RpoS or SigB.

[0399] 12. The genetically engineered cell according to item 11, wherein nucleic acids encoding one or more RpoS or SigB inhibitors are overexpressed.

[0400] 13. The genetically engineered cell of any one of items 11 to 12, wherein the one or more RpoS inhibitors are selected from rssB, RNase III, H-NS, ArcA, CRP, Fur, MqsA, OxyS and CyaR.

[0401] 14. The genetically engineered cell according to any of the preceding items, wherein transcription of the heterologous nucleic acid is increased when the functionality of the cell's sigma factor, which is active in the stationary phase of the cell, is reduced.

[0402] 15. The genetically engineered cell according to any of the preceding items, wherein the heterologous nucleic acid is transcribed in the absence of a cellular sigma factor that is active in the stationary phase of the cell.

[0403] 16. The genetically engineered cell according to any one of the preceding items, wherein the sigma factor of the cell that is active in the growth phase of the cell is a housekeeping transcription factor, such as RpoD or SigA.

[0404] 17. The genetically engineered cell according to any one of the preceding items, wherein the promoter comprises the consensus motif TT(G / C / T)(A / T)C(A / G)(n) 14-18 TA(T / A)(A / G)(A / T)T, which is located in the 5' region of the heterologous nucleic acid, 5 to 40 nucleotides upstream of the translation start codon AUG.

[0405] 18. The genetically engineered cell according to any one of the preceding items, wherein the promoter is positively regulated by cAMP-bound CRP.

[0406] 19. The genetically engineered cell according to item 18, wherein the promoter comprises the motif (A / G)TGAnnnnnn(A / T)CAC located upstream of the translation start codon AUG of the heterologous nucleic acid.

[0407] 20. The genetically engineered cell according to any one of the preceding items, wherein the promoter is selected from PglpF, Plac, PmglB_70UTR, PglpA_70UTR and PglpT_70UTR listed in Table 1 (SEQ ID NOs: 35, 44, 32, 33 and 34, respectively), and variants thereof.

[0408] 21. The genetically engineered cell of any one of the preceding items, wherein the heterologous nucleic acid is selected from the group consisting of: one or more glycosyltransferase genes, one or more CMP-N-acetylneuraminic acid pathway genes, one or more transporter genes, and one or more nucleic acids encoding a heterologous product to be produced by the genetically engineered cell.

[0409] 22. The genetically engineered cell according to any one of the preceding items, wherein the heterologous product is one or more oligosaccharides.

[0410] 23. The genetically engineered cell of any preceding item, wherein the heterologous product is one or more human milk oligosaccharides (HMOs).

[0411] 24. The genetically engineered cell according to item 23, wherein the human milk oligosaccharide is selected from the group consisting of lacto-N-triose II (LNT-II), lacto-N-tetraose (LNT), lacto-N-neotetraose (LNnT), lacto-N-neohexaose (LNnH), p-lacto-N-neohexaose (pLNnH), p-lacto-N-hexaose (pLNH), lacto-N-hexaose (LNH), 2'-fucosyllactose (2'-FL), lacto-N-fucopentaose I (LNFP-I), lacto-N-difucohexaose I (LNDFH-I), 3-fucosyllactose (3-FL), difucosyllactose (2'-FL), lacto-N-fucopentaose I (LNFP-I), lacto-N-difucohexaose I (LNDFH-I), lacto-N-difucohexaose I (LNDFH-I), lacto-N-difucohexaose I (LNDFH-I), lacto-N-difucosyllactose (3-FL ... Sugar (DFL), lacto-N-fucopentaose II (LNFP-II), lacto-N-fucopentaose III (LNFP-III), lacto-N-difucohexaose III (LNDFH-III), fucosyl-lacto-N-hexaose II (FLNH-II), lacto-N-fucopentaose V (LNFP-V), lacto-N-difucohexaose II (LNDFH-II), fucosyl-lacto-N-hexaose I (FLNH-I), fucosyl-p-lacto-N-hexaose I (FpLNH-I), fucosyl-p-lacto-N-neohexaose II (F-pLNNH-II), fucosyl-p-lacto-N-neohexaose II (F-pLNNH-II), fucosyl-p-lacto-N-hexa ...hexaose II (F-pLNNH-II), fucosyl-p-lacto-N- II), fucosyl-lacto-N-neohexaose (FLNnH), 3'-sialyllactose (3'-SL), 6'-sialyllactose (6'-SL), 3-fucosyl-3'-sialyllactose (FSL), 3'-O-sialyllacto-N-tetraose a (LST a), fucosyl-LST a (FLST a), 6'-O-sialyllacto-N-tetraose b (LST b), fucosyl-LST b (FLST b), 6'-O-sialyllacto-N-neotetraose (LST c), fucosyl-LST c (FLST c), 3'-O-sialyllacto-N-neotetraose (LSTd), fucosyl-LST d (FLST d), sialic acid-lacto-N-hexaose (SLNH), sialic acid-lacto-N-neohexaose I (SLNH-I), sialic acid-lacto-N-neohexaose II (SLNH-II), and disialyl-lacto-N-tetraose (DSLNT).

[0412] 25. The genetically engineered cell according to any one of the preceding items, wherein the genetically engineered cell comprises one or more heterologous nucleic acids encoding one or more heterologous glycosyltransferases.

[0413] 26. The genetically engineered cell of item 25, wherein the one or more heterologous glycosyltransferases are selected from the group consisting of β-1,3-N-acetyl-glucosaminyltransferase, β-1,3-galactosyltransferase, β-1,4-galactosyltransferase, α-1,2-fucosyltransferase, α-1,3-fucosyltransferase, α-2,3-sialyltransferase, and α-2,6-sialyltransferase.

[0414] 27. The genetically engineered cell of any one of items 21 to 26, wherein the genetically engineered cell comprises and / or overexpresses a biosynthetic pathway for producing at least one sugar nucleotide selected from the group consisting of glucose-UDP-GlcNAc, UDP-galactose, UDP-glucose, UDP-N-acetylglucosamine, UDP-N-acetylgalactosamine (GlcNAc), and CMP-N-acetylneuraminic acid.

[0415] 28. The genetically engineered cell of item 27, wherein the genetically engineered cell comprises a de novo GDP-fucose pathway and / or a CMP-N-acetylneuraminic acid pathway.

[0416] 29. The genetically engineered cell according to any one of the preceding items, wherein the cell overexpresses at least one recombinant endogenous gene, the transcription of which is regulated by a promoter recognized by the RNA transcription factor RpoD, such as the promoter according to item 20.

[0417] 30. The genetically engineered cell according to item 29, wherein the recombinant endogenous gene is selected from lactose permease, a colanic acid gene cluster, and any one independent gene of the colanic acid gene cluster selected from manA, manB, manC, gmd, and wcaG.

[0418] 31. The genetically engineered cell according to any one of items 22 to 30, wherein the oligosaccharide is a fucosylated oligosaccharide and mannose-6-phosphate isomerase (manA) and / or phosphomannose mutase (manB) are overexpressed.

[0419] 32. The genetically engineered cell of item 31, wherein the genetically engineered cell comprises at least one additional copy of manB compared to the number of copies of manC (encoding mannose-1-phosphate guanylyltransferase) and / or gmd (encoding GDP-D-mannose-4,6-dehydratase) and / or wcaG (encoding GDP-L-fucose synthase).

[0420] 33. The genetically engineered cell of item 31 or 32, wherein the genetically engineered cell comprises at least the same or more copies of manA compared to the number of copies of manC (encoding mannose-1-phosphate guanylyltransferase) and / or gmd (encoding GDP-D-mannose-4,6-dehydratase) and / or wcaG (encoding GDP-L-fucose synthase).

[0421] 34. The genetically engineered cell according to items 31 to 33, wherein the genetically engineered cell comprises at least two copies of manA and three copies of manB.

[0422] 35. The genetically engineered cell according to any one of the preceding items, wherein the genetically engineered cell comprises and / or overexpresses a biosynthetic pathway for the production of at least one sugar nucleotide selected from the group consisting of GDP-fucose, UDP-GlcNAc, UDP-galactose, UDP-glucose, UDP-N-acetylglucosamine, UDP-N-acetylgalactosamine (GlcNAc) and CMP-N-acetylneuraminic acid.

[0423] 36. The genetically engineered cell of any preceding item, wherein lactose import into the cell is enhanced by expression of one or more lactose permeases.

[0424] 37. The genetically engineered cell according to item 36, wherein the lactose permease is LacY, and wherein the nucleic acid sequence encoding LacY is under the control of a promoter as defined in any one of items 1 and 17 to 20.

[0425] 38. The genetically engineered cell according to any one of the preceding items, wherein the genetically engineered cell expresses at least one heterologous glycosyltransferase.

[0426] 39. The genetically engineered cell of item 38, wherein the heterologous glycosyltransferase is selected from the group consisting of β-1,3-N-acetyl-glucosaminyltransferase, β-1,3-galactosyltransferase, β-1,4-galactosyltransferase, α-1,2-fucosyltransferase, α-1,3-fucosyltransferase, α-2,3-sialyltransferase, and α-2,6-sialyltransferase.

[0427] 40. The genetically engineered cell according to any of the preceding items, wherein the genetically engineered cell expresses at least one heterologous MFS sugar transporter.

[0428] 41. The genetically engineered cell of item 40, wherein the heterologous MFS sugar transporter is selected from the group consisting of Nec, YberC, Fred, Bad, and Vag.

[0429] 42. The genetically engineered cell of any preceding item, wherein the cell further expresses a functional sucrose utilization system.

[0430] 43. The genetically engineered cell of item 42, wherein the functional sucrose utilization system is encoded by scrYA and scrBR operons under the control of a promoter recognized by a sigma factor of the cell active in the cell growth phase, such as RpoD or SigA.

[0431] 44. The genetically engineered cell according to any one of the preceding items, wherein the engineered cell is a prokaryotic organism.

[0432] 45. The genetically engineered cell according to any one of the preceding items, wherein the engineered cell is a Gram-negative or Gram-positive bacterium.

[0433] 46. ​​The genetically engineered cell according to item 44 or 45, wherein the prokaryotic organism is a bacterium selected from the group consisting of Escherichia, Bacillus, Lactobacillus, Corynebacterium, and Campylobacter.

[0434] 47. The genetically engineered cell of item 46, wherein the bacterium is Escherichia coli.

[0435] 48. The genetically engineered cell of any preceding item, wherein the cell has reduced acetate and / or glutamate formation.

[0436] 49. A method for biosynthetically producing a heterologous product, wherein the method comprises:

[0437] a. Providing a genetically engineered cell according to any one of items 1 to 48;

[0438] b. culturing the genetically engineered cells in a culture medium under conditions that allow production of the heterologous product; and

[0439] c. recovering the heterologous product from the culture.

[0440] 50. The method for biosynthetically producing a heterologous product according to item 49, wherein the method comprises culturing the genetically engineered cell in the presence of a carbon source selected from the group consisting of glucose, sucrose, fructose, xylose and glycerol.

[0441] 51. The method for the biosynthetic production of a heterologous product according to item 49 or 50, wherein the pH during cultivation is maintained above 6.0, preferably above 6.5.

[0442] 52. The method for biosynthetic production of heterologous products according to items 49 to 51, wherein the fermentation is a fed-batch fermentation or a continuous fed-batch fermentation.

[0443] 53. The method for the biosynthetic production of a heterologous product according to items 49 to 52, wherein the recovered heterologous product is free of living cells.

[0444] 54. The method of any one of items 49 to 52, wherein the product is one or more human milk oligosaccharides (HMOs).

[0445] 55. The method according to item 54, wherein lactose is added as a substrate for HMO formation during the cultivation of the genetically engineered cells.

[0446] 56. The method of any one of items 54 to 55, wherein the produced human milk oligosaccharides (HMOs) are recovered from the culture medium and / or the genetically engineered cells.

[0447] 57. Use of the genetically engineered cell according to any one of items 1 to 48 in the production of a heterologous product.

[0448] 58. The use according to item 57, wherein the heterologous product is cell-free.

[0449] 59. The use according to item 57 or 58, wherein the heterologous product is one or more HMOs.

[0450] 60. The use according to item 57 or 58, wherein the heterologous product is a polypeptide, such as an antibody or an enzyme.

[0451] 61. The use according to items 57 to 60, wherein the heterologous product is not an antigen for vaccination.

[0452] sequence

[0453] This application contains a Sequence Listing in both text and electronic formats, which is incorporated herein by reference.

[0454] A summary of the SEQ ID NOs used in this application is shown in Table 2 below.

[0455] Table 2: Summary of sequences listed in this application

[0456]

[0457]

[0458]

[0459]

[0460] Example

[0461] method

[0462] Unless otherwise stated, standard techniques, vectors, control sequence elements and other expression system elements known in the field of molecular biology are used for nucleic acid manipulation, transformation and expression. Such standard techniques, vectors and elements can be found in the following literature: Ausubel et al. (eds.), Current Protocols in Molecular Biology (1995) (John Wiley & Sons); Sambrook, Fritsch, & Maniatis (eds.), Molecular Cloning (1989) (Cold Spring Harbor Laboratory Press, NY); Berger & Kimmel, Methods in Enzymology 152: Guide to Molecular Cloning Techniques (1987) (Academic Press); Bukhari et al. (eds.), DNA Insertion Elements, Plasmids and Episomes (1977) (Cold Spring Harbor Laboratory Press, NY); Miller, JH Experiments in molecular genetics (1972.) (Coldspring Harbor Laboratory Press, NY).

[0463] The examples described below are chosen to illustrate the present invention and are not intended to limit the present invention in any way.

[0464] strains

[0465] The strain (genetically engineered cell) constructed in this application is based on Escherichia coli K-12DH1, with the genotypes: Fˉ, ˉ, gyrA96, recA1, relA1, endA1, thi-1, hsdR17, supE44. The E. coli K-12DH1 strain was additionally modified to generate an MDO strain with the following modifications: lacZ: 1.5 kbp deletion, lacA: 0.5 kbp deletion, nanKETA: 3.3 kbp deletion, melA: 0.9 kbp deletion, wcaJ: 0.5 kbp deletion, mdoH: 0.5 kbp deletion, and the Plac promoter inserted upstream of the gmd gene.

[0466] Methods for inserting or deleting a gene of interest into the E. coli genome are well known to those skilled in the art. Gene cassettes can be inserted into the E. coli chromosome using gene gorging, utilizing specific selectable marker genes and screening methods (see, for example, Herring and Blattner 2004 J. Bacteriol. 186:2673-81 and Warming et al. 2005 Nucleic Acids Res. 33(4):e36).

[0467] The MDO strains were further engineered to generate different HMO producing strains.

[0468] The genotypes of the background strain (MDO) and the different HMO strains are shown in Table 12 below.

[0469] Table 12: Genotypes of strains used in the examples

[0470]

[0471]

[0472] 1 futC - gene encoding α-1,2-fucosyltransferase of SEQ ID NO: 47.

[0473] 2 CA = additional colanic acid gene cluster (gmd-wcaG-wcaH-wcaI-manC-manB, SEQ ID NO: 57) controlled by the PglpF promoter at a locus different from the native locus.

[0474] 3 nec is a gene encoding a heterologous major facilitator superfamily (MFS) transporter of SEQ ID NO: 51.

[0475] 4 scrYA and scrBR encode two operons with the sequences of SEQ ID NOs: 53 and 54 and SEQ ID NOs: 55 and 56, respectively.

[0476] 5 futA - gene encoding α-1,3-fucosyltransferase of SEQ ID NO:48.

[0477] 6 marc The gene encoding the heterologous major facilitator superfamily (MFS) transporter of SEQ ID NO: 52.

[0478] 7Δ29nst—gene encoding the α-2,3-sialyltransferase of SEQ ID NO: 49.

[0479] 8 ΔnadC – quinolinate phosphoribosyl-transferase deleted from WP_101348535.1. For more details, see WO2017101958.

[0480] 9 pBS-nadC-Plac-neuBCA – Plasmid expressing neuBCA (SEQ ID NO: 58) and nadC. For more details, see WO 2017 / 101958.

[0481] 10 neuB, neuC, neuA—codon-optimized genes encoding NeuB, NeuC, and NeuA of SEQ ID NOs 59, 60, and 61, respectively.

[0482] 11 ST6,Pd2—gene encoding the α2,6-sialyltransferase of SEQ ID NO: 50.

[0483] 12 ΔrpoS deletes the sigma factor 38 gene of SEQ ID NO: 1 and encodes the sequence of SEQ ID NO: 90.

[0484] 13 Δcrl deletes the sigma factor binding protein Crl gene of SEQ ID NO: 8 and encodes the sequence of SEQ ID NO: 92.

[0485] 14 The wcaF::PglpF-PglpF promoter was inserted in front of the natural colanic acid gene cluster (gmd-wcaG-wcaH-wcaI-manC-manB).

[0486] 15 ΔrpoZ deletes the rpoZ σ factor gene of SEQ ID NO:7.

[0487] 16 ΔrpoF deletes the sigma factor 28 gene of SEQ ID NO: 6.

[0488] 17 manB inserts the nucleic acid encoding manB (SEQ ID NO: 113), which encodes the protein phosphomannose mutase (SEQ ID NO: 114).

[0489] 18 manA inserts the nucleic acid encoding manA (SEQ ID NO: 111), which encodes the protein mannose-6-phosphate isomerase (SEQ ID NO: 112).

[0490] Deep well assay for product formation

[0491] Strains were screened for HMO production in 96-well plates using a 3-day protocol. Fresh precultures were grown to high density during the first 24 hours. More specifically, fresh precultures were prepared using minimal basal medium supplemented with magnesium sulfate, thiamine, and glucose. The pH was adjusted to 7.0 with NaOH. The precultures were incubated at 34°C with shaking at 1000 rpm for 24 hours.

[0492] For HMO production, an aliquot of the preculture was transferred to a new deep-well plate containing basal minimal medium (BMM7, pH 7.5) to initiate the main culture. The new BMM was supplemented with thiamine and magnesium sulfate, 0.01% glucose, 2% lactose, 1.75% maltodextrin, thiamine, and glucoamylase to optimize maltodextrin hydrolysis. The HMO main culture was incubated at 28°C with shaking at 1000 rpm for 48 hours. Assays were typically performed in triplicate.

[0493] After incubation, the main cultures were boiled and centrifuged. The samples were analyzed by HPLC (2'FL, DFL and 3FL) or HPAEC (3'SL and 6'SL).

[0494] Deep well assay for acetate evaluation

[0495] Strains were screened for acetate evaluation in 96-well plates using a 2-day protocol with high glucose. Fresh precultures were grown to high density during the first 24 hours and subsequently transferred to a medium that allowed induced acetate formation. More specifically, fresh precultures were prepared using minimal basal medium supplemented with magnesium sulfate, thiamine, and glucose. The pH was adjusted to pH 7.0 with NaOH. The precultures were incubated at 34°C with shaking at 1000 rpm for 24 hours.

[0496] For acetate production, aliquots of the preculture were transferred to new deep-well plates containing BMM medium (pH 7.5) with thiamine and magnesium sulfate and 2.5% glucose. The acetate main culture was incubated at 30°C, 1.000 rpm for 24 hours.

[0497] The samples were collected by centrifuging the broth at 10.000 rpm for 3 minutes. The acetate concentration was measured from the supernatant using the Acetic Acid Assay Kit (Megazyme) according to the manufacturer's instructions.

[0498] Fed-batch fermentation

[0499] E. coli strains were cultivated in a Sartorius Biostat B 2L bioreactor system, starting with 700 g of a mineral medium basal medium containing 6.9 g / kg of carbon source (glucose for the 3'FL fermentation in Example 5 or sucrose for the 2'FL fermentation in Example 6), lactose, H3PO4, MgSO4 x 7H2O, KOH, citric acid, trace element solution, antifoam, and thiamine. The dissolved oxygen level was maintained at 23% by a first stirred cascade, then air flow was started at 1000 rpm (up to a maximum of 2000 rpm) and 1 VVM (up to a maximum of 3 VVM) as a safeguard. The pH was maintained at 6.8 by titration with a 10% NH4OH solution. With containing 20g / L carbon source, (NH4)2HPO4, KH2PO4, MgSO4 x 7H2O, KOH, NaOH, citric acid, trace element solution, defoamer and thiamine, shake flask pre-cultures (shake-flaskpre-cultures) adjusted to pH 7 start to be cultivated with 2% (v / v) inoculum, grow under 33 ℃, 200rpm, until they reach an optical density of 2.5-4 at 600nm (OD600).After the exhaustion of the carbon source in the initial batch growth phase and being included in the basal medium, starting with 1g carbon source / h and following the profile (profile) of any overflow metabolism that gradually increases and avoids triggering the bacterial strain in the container or oxygen limitation with the rate of keeping the cultivation carbon limited, the feed comprises a concentrated feed solution of the same components as in the basal medium. Initially the temperature is set to 33 ℃, but after the feed rate reaches the peak, the temperature is reduced to 32 ℃ with a 1h ramp. The growth and metabolic activity of the cells and their status were followed by online measurement of CO evolution rate, oxygen uptake rate, stirring, pH, temperature, alkali drops and dissolved oxygen level. Throughout the fermentation process, samples were taken and the concentration of 2'-FL, 3FL, DFL, lactose, glutamic acid (glutamic acid) and other minor by-products was measured using HPLC. The total culture solution sample was diluted 3 times in deionized water and boiled for 20 minutes. The supernatant was then analyzed by HPLC at 17000 g for 3 minutes. In addition, OD600 and biological wet weight (defined as the weight fraction (g / kg) of the pellet in the culture solution after 17000 g centrifugal 3 min) were measured to track the growth of the bacterial strain. Acetic acid was measured using Acetic Acid Assay Kit (Megazyme).

[0500] RT-qPCR

[0501] According to the manufacturer's instructions, RNeasy MiniKit (Qiagen) was used to prepare total RNA from Escherichia coli. During RNA purification, RNase-Free DNase set (Qiagen) was used to digest DNA. Agilent 4150 TapeStation System (Agilent Technologies) was used to confirm the integrity of all RNA samples and to measure RNA concentration using Nanodrop (Thermo Fisher Scientific). RT-PCR was performed using 50 ng of total RNA sample in 20 μl reactions, including primers (MWG Eurofins), Power SYBR Green RNA-to-CT 1-Step Kit (Applied Biosystems). RT-PCR was run on QuantStudio 5 instruments (Applied Biosystems) according to the manufacturer's instructions, and PCR products were detected using SYBR Green dye. The results were analyzed using Design and Analysis Software v1.5.1 (Thermo Scientific), in which the amplification of the target gene was normalized using an endogenous control (cysG), and the relative amount of the target was determined by comparing the normalized target amount in each sample with the normalized target amount in the reference sample.

[0502] Determination of primer efficiency by quantitative PCR (qPCR)

[0503] The efficiency of primer couples was determined by generating a standard curve. Standard samples were prepared by PCR reaction and purified by QIAquick PCR purification kit (QIAGEN). For each standard, six points of a 10-fold dilution series were prepared using FastSYBR Green Master Mix (Thermo Scientific) for PCR reaction and run in three technical replicates on a QuantStudio 5qPCR instrument (Applied Biosystems). The results were analyzed using Design and Analysis Software v1.5.1 (Thermo Scientific) and the determined primer efficiency.

[0504] The primers used are listed in Table 13.

[0505] Table 13: RT-qPCR primers:

[0506] Target Primer name direction Primer sequence (5'-3') SEQ ID NO lacY HW001 F GGGAGCCTACTTCCCGTTTT 62 lacY HW002 R GCCCGAGTTTGTCAGAAAGC 63 futC ID0013 F CGGTTGTCAGCTGGGTATTG 64 futC ID0014 R CGCGTGGTCATATCCATGAAC 65 manA HW075 F GCCATTTTGTTCTGCGTCGA 66 manA HW076 R GCCTTTGACAGTCACCGGT 67 manB HW079 F GCCCACCATTACTTCCGTGA 68 manB HW080 R CTGTTGATCTCACCGCTTGC 69 gmd HW071 F CGTCCGGCTGAAGTTGAAAC 70 gmd HW072 R CGCTTCGAGGTCATTAGCCA 71 nec HW055 F GGGTCTGGTTATGCTGTGGT 72 nec HW056 R CGTAAATCGCTTGGTGACCC 73 sqY HW087 F CCCTCAACCTGCGTCTGATT 74 sqY HW088 R TAGAAGCTGCCATTGACCGC 75 crp HW063 F CAGACGCTATGACTCACCCG 76 crp HW064 R TGTGCGGAGATCAGGTTCTG 77 Cra HW083 F AAGGTTTCCGTACTGCCTGG 78 cra HW084 R ATCACTCCTTGCAACAACGC 79 cysG ID0032 F GTATTCCACTCACGCATCGC 80 cysG ID0033 R ATAGTCGCGGCCTGATTCAA 81

[0507] Proteomic analysis

[0508] The fermentation liquid is directly sampled into 3mL ice-cold 0.9% NaCl solution, and the culture fluid is diluted 3 times. By centrifuging at 4 ℃ with 4000g for 10 minutes, the cells are harvested. The pellet is washed in ice-cold 0.9% NaCl solution, and the suspension is centrifuged again at 4 ℃ with 6000g for 5 minutes. The supernatant is removed, and the pellet is immediately placed on dry ice and stored at-80 ℃ until further analysis. Based on biomass measurement, the biomass concentration of the sample is normalized, subsequently cracked by adding lysis buffer (PreOmis) and incubated at 95 ℃ for 20 minutes. Cell lysate is further processed by reduction, alkylation and trypsin digestion. The method used is 20 minutes gradient data independent collection without labeling quantitative (Data-Independent Acquisition Label-Free Quantitation, DIALFQ) proteomics. Samples were analyzed in triplicate by liquid chromatography-tandem mass spectrometry (LC-MS / MS) using a Vanquish UHPLC coupled to a Q Exactive Plus Orbitrap MS (Thermo Fisher Scientific). Peptides were separated by reversed-phase chromatography using a gradient of 5% B to 40% B in acetonitrile containing 0.1% formic acid in water (solvent A) and 20% water and 0.1% formic acid in acetonitrile (solvent B), which was completed in 20 minutes. Data-independent acquisition (DIA) was performed from 400 to 1200 m / z with a resolution of 17,500 and a maximum injection time of 20 ms, followed by high-energy collision-induced dissociation (HCD) MS / MS. Eight 60-Da MS / MS windows were used, ranging from 400 to 873 m / z, with a resolution of 17,500 and a maximum injection time of automatic. Raw data were analyzed using the Pulsar search engine and Spectronaut (version 14.10) for proteins from strains 1 and 2, allowing for trypsin / P-specific peptides, including two uncleaved sites, oxidation of methionine, carbonylmethylation of cysteine, and deamidation of asparagine and glutamine. Label-free quantification was performed using the first three unique peptides measured for each protein. Retention time alignment was performed on the most abundant signal obtained from the peptide measured across all samples. Results were filtered with an FDR of 1% and then normalized using the median ion intensity measured for each sample.

[0509] Example 1

[0510] Testing the Effect of Sigma Factor Deletion in HMO-Producing Escherichia coli

[0511] In this example, we investigated whether the deletion of different sigma factors affects HMO production in E. coli. The E. coli chromosome encodes seven sigma factors required for transcription initiation. Three sigma factors (RpoD, RpoH, and RpoE) are essential for cell growth.

[0512] 2'FL production strains corresponding to strain 1 in Table 12 above were generated, wherein each strain had a deletion of rpoN, rpoF (strain 13), rpoZ (strain 12), or rpoS (strain 2). Cells were screened for 2'FL production in the deep well assay for product formation described in the methods section above.

[0513] From this sigma factor screen, it was observed that deletion of the gene encoding the sigma factor RpoN resulted in no growth in minimal medium with glucose. Removal of the genes encoding the sigma factor RpoF or RpoZ genes did not affect HMO production ( Figure 1 Surprisingly, removal of the gene encoding the sigma factor RpoS in an E. coli strain expressing 2'FL increased the production of 2'FL (see also Figure 1 and Figure 2 A).

[0514] Example 2

[0515] Effects of rpoS deletion in different HMO-producing Escherichia coli strains

[0516] This example aimed to investigate whether the positive effect on 2'FL production was also observed in strains producing other HMOs.

[0517] Specifically, the following strains were generated: 2'FL (strains 1 and 2, Example 1), DFL (strains 3 and 4), 3FL (strains 5 and 6), 3'SL (strains 7 and 8), and 6'SL (strains 9 and 10). The genotypes of the individual strains are shown in Table 12 of the Methods section above.

[0518] All strains were screened according to the deep-well assay for product formation as described in the Methods section. Figure 2 The relative expression of HMO strain + rpoS strain (set as 1) is shown in the middle.

[0519] It can be seen that deletion of rpoS in the 2'FL-producing E. coli strain increased the 2'FL titer by 40% ( Figure 2 A). Deletion of the σ factor rpoS in the E. coli DFL production strain increased the DFL titer by 30% ( Figure 2B). Deletion of the σ factor rpoS in the E. coli 3FL production strain increased the 3FL titer by 70% ( Figure 2 C). Deletion of the σ factor rpoS in the E. coli 3'SL production strain increased the 3'SL titer by 40% ( Figure 2 D) Deletion of the σ factor rpoS in the E. coli 6'SL production strain increased the 6'SL titer by 700% ( Figure 2 E).

[0520] Example 3

[0521] Engineering Escherichia coli to improve HMO production by deleting clr

[0522] The level of RpoS in cells is regulated by several transcription and translation factors. Therefore, modulation of rpoS transcription and / or translation can reduce RpoS levels and thus increase HMO production in E. coli HMO-producing strains.

[0523] Therefore, in this example, we investigated whether alternative regulatory approaches, other than deleting rpoS, could also abrogate RpoS activity and produce similar effects. An example of an RpoS regulator is the sigma factor binding protein Crl, which promotes the binding of RpoS to RNA polymerase, thereby activating the expression of RpoS-regulated genes.

[0524] Deletion of the gene crl encoding Crl in HMO-producing E. coli strains is expected to i) reduce transcription of RpoS-regulated genes and ii) have a positive effect on HMO production.

[0525] In this example, the crl gene was deleted in strain 1 expressing 2'FL, thereby generating strain 11. The strains were screened as described in Example 1. Figure 3 Shown in FIG are relative expressions of strain 1 (set to 1) that does not contain the rpoS deletion.

[0526] It can be seen that the deletion of crl in the E. coli 2'FL production strain (strain 11) increased the 2'FL titer compared to the 2'FL production strain with an intact crl gene ( Figure 2 ).

[0527] Example 4

[0528] Reduced acetate formation in an rpoS-deficient HMO-producing strain of Escherichia coli

[0529] E. coli produces acetate when it grows aerobically on glucose. Acetate has a negative impact on growth and protein production, so it is desirable to minimize acetate formation in E. coli fermentations.

[0530] In this example, it was investigated whether differences in acetate formation could be observed in the DFL (strains 3 and 4), 3FL (strains 5 and 6), and 6'SL (strains 9 and 10) strains when rpoS was deleted. The strains were screened using the deep well assay for acetate evaluation described in the methods section above. Figure 4 The relative amount of acetic acid in Rpos-positive bacteria (set to 1) is shown in the figure.

[0531] It can be seen that deletion of the gene encoding RpoS in E. coli reduced acetate formation in all three HMO-producing strains. For example, deletion of rpoS in the DFL-producing E. coli strain reduced relative acetate formation by 30% after overnight growth in minimal medium supplied with glucose ( Figure 4 A). Similarly, when rpoS was removed, acetate formation was significantly increased in the production of 3FL ( Figure 4 B) or 6'SL( Figure 4 C) was reduced by 30% or 40% in E. coli strains.

[0532] Example 5

[0533] Fermentation using the rpoS-deficient E. coli 3FL production strain

[0534] In this example, it was investigated whether the increased HMO formation and decreased acetate formation observed in Example 4 in the deep well assay could also be observed in fed-batch fermentations.

[0535] 3FL strain 5 (+rpoS) and strain 6 (ΔrpoS) were fermented as described in the Methods section using glucose as the carbon source.

[0536] Figure 5 It was shown that deletion of rpoS in the 3FL producing E. coli strain reduced the relative acetic acid formation during fermentation by 25%-45%. Samples were collected at 6 different time points (21, 41, 66, 90, 95, 113 hours) after the start of the feed and the amount of acetic acid was measured using the megazyme kit. At time point 21 hours ( Figure 5 ) The amount of acetic acid is given as a relative value.

[0537] Likewise, the amount of glutamate was measured using HPLC. Figure 6 As shown, it is clear that deletion of rpoS in the 3FL-producing E. coli strain (strain 6) resulted in unquantifiable levels of glutamate formation, compared to the high levels accumulated in the rpoS-positive strain (strain 5).

[0538] Figure 7It was also shown that deletion of the sigma factor rpoS in a 3FL-producing E. coli strain increased 3FL production to 300% at the end of fermentation. Yield was measured as the cumulative yield of product per carbon source substrate consumed (Yps) (g 3FL / g glucose) and normalized to the Yps of strain 5 (+rpoS) (set to 100%) at the end of fermentation.

[0539] Example 6

[0540] Improved 2'FL production in fermentation by deleting rpoS in Escherichia coli

[0541] In this example, it was investigated whether the increased 2'FL formation observed in Examples 1 and 2 in the deep well assay could also be observed in fed-batch fermentations.

[0542] 2'FL strain 1 (+rpoS) and strain 2 (ΔrpoS) were fermented in duplicate as described in the Methods section using sucrose as the carbon source.

[0543] Figure 8 The results show that deletion of rpoS in a 2'FL-producing E. coli strain increased 2'FL production by 140% during fermentation. Samples were collected at six different time points (21, 41, 66, 90, 95, and 113 hours) after the start of feeding, and the amount of 2'FL was measured. Yield was measured as the cumulative product yield (Yps) per carbon source substrate (g 2'FL / g sucrose) and normalized to the Yps of strain 1 (+rpoS) at the end of fermentation.

[0544] Example 7

[0545] Deletion of rpoS increases transcription of genes involved in lactose uptake, GDP-fucose formation, fucosylation, and 2'FL export in E. coli 2'FL production strains

[0546] In this example, we investigated how the loss of rpoS affects the expression of genes associated with HMO expression.

[0547] Specifically, in the fermentation described in Example 6, samples were collected at different time points (41 and 113 hours) after the start of feeding, and the transcript levels of 9 selected target genes were determined using RT-qPCR as described in the Methods section above (see Table 13).

[0548] Table 13: Selected target genes

[0549]

[0550] Figure 9The relative transcription levels of strain 2 (ΔrpoS) relative to strain 1 (+rpoS) are shown. Specifically, a value above 1 indicates that the corresponding gene is transcribed at a higher level in strain 2 than in strain 1.

[0551] The deletion of rpoS in 2'FL-producing E. coli strains affects the transcription levels of several genes. The relative transcription levels between strain 2 (ΔrpoS) and strain 1 (rpoS+) at time 41 hours are shown in light grey bars ( Figure 9 The relative transcript levels between strain 2 (ΔrpoS) and strain 1 (+rpoS) at time 113 hours are shown in dark grey bars ( Figure 9 Ablation of rpoS increased 2-4 fold the transcription of genes involved in lactose uptake, 2'FL formation, 2'FL export, sucrose uptake, and global regulatory factors.

[0552] Example 8

[0553] Increased heterologous protein expression in rpoS-deficient Escherichia coli strains

[0554] In this example, we investigated how the loss of rpoS affects the expression of heterologous proteins associated with HMO expression. Membrane-bound proteins were excluded from the analysis because they can be difficult to accurately capture using the proteomic analysis described in the methods above.

[0555] Specifically, in the fermentation described in Example 6, in which E. coli 2'FL production strains with an intact rpoS gene (strain 1, rpoS_pos) or lacking rpoS (strain 2, rpoS_neg) were fermented in a fed-batch fermentation, the amount of selected proteins expressed in the cells of samples collected at different time points after the start of feeding (21, 41, 66, 90, 95, 113 hours) was analyzed using the proteomic analysis described in the above methods section.

[0556] In Example 7, it was shown that deletion of rpoS in a 2'FL-producing E. coli strain increased transcription of the heterologous gene futC. This example shows that this increased transcription also leads to increased protein levels of α-1,2-fucosyltransferase, with FutC increased in the RpoS-deleted strain compared to the control strain ( Figure 10 Specifically, the increase was approximately 1.2-fold on log2, and when converted back to log, FutC was increased 2.3-fold in the RpoS deletion strain.

[0557] This clearly demonstrates that reducing RpoS levels in cells expressing heterologous genes is not only useful for the production of HMOs (human milk oligosaccharides), but is also relevant for the production of heterologous protein products using genetically engineered host cells in which stress response sigma factors, such as RpoS or its equivalent, have been reduced or eliminated.

[0558] Example 9

[0559] Increased endogenous protein expression in Escherichia coli 2'FL production strain lacking rpoS

[0560] In this example, we investigated how the loss of rpoS affects the expression of endogenous proteins associated with HMO expression. Membrane-bound proteins were excluded from the analysis because they can be difficult to accurately capture using the proteomic analysis described in the methods above.

[0561] Specifically, in the fermentation described in Example 6, in which E. coli 2'FL production strains with an intact rpoS gene (strain 1, rpoS_pos) or lacking rpoS (strain 2, rpoS_neg) were fermented in a fed-batch fermentation, the amount of selected proteins expressed in the cells of samples collected at different time points after the start of feeding (21, 41, 66, 90, 95, 113 hours) was analyzed using the proteomic analysis described in the Methods section above. The proteins analyzed are listed in Table 14.

[0562] Table 14: Endogenous proteins analyzed using proteomics

[0563]

[0564] exist Figure 11 As can be seen, the levels of all proteins in Table 14 were increased when rpoS was deleted in the 2'FL producing E. coli strain compared to the rpoS positive strain.

[0565] Example 10

[0566] Additional increase in protein expression in E. coli 2'FL production strain with rpoS deletion combined with overexpression of manA and manB

[0567] The formation of GDP-fucose is highly important in cells producing fucosylated HMOs. In Example 7, the deletion of rpoS resulted in a significant increase in the transcription of manA and manB, and in Example 6 ( Figure 8 ), it was shown that deletion of rpoS in an E. coli 2'FL production strain increased 2'FL production in fermentation by 40%.

[0568] In this example, we investigated whether the deletion of rpoS, combined with overexpression of manA and manB, could further increase 2'FL production. In this example, an rpoS-deficient E. coli 2'FL strain (strain 2) and an rpoS-deleted E. coli 2'FL strain (strain 14) combined with overexpression of manA and manB were fermented in fed-batch fermentations. Samples were collected at various time points after the start of feeding (21, 41, 66, 90, 95, and 113 hours) and analyzed for 2'FL production. Figure 12 It was shown that rpoS deletion combined with overexpression of manA and manB in an E. coli 2'FL production strain increased 2'FL production in fermentation by approximately 10% compared to a 2'FL production strain with an rpoS deletion. Yield was measured as cumulative product yield (Yps) per carbon source substrate (g 2'FL / g sucrose) and normalized to the Yps of strain 2 (ΔrpoS) at the end of fermentation. Each strain was tested in duplicate in the fermentation.

Claims

1. A genetically engineered cell for biosynthetically producing one or more heterologous products, wherein a. the genetically engineered cell comprises at least one heterologous nucleic acid encoding a heterologous product and / or a polypeptide required for producing one or more heterologous products, b. wherein the transcription and / or expression of the heterologous nucleic acid is regulated by a promoter that is recognized by a sigma factor of a cell that is actively growing, and c. wherein the function of the cell's sigma factor, which is active in the cell's stationary phase, is reduced or eliminated, and Wherein the genetically engineered cells are not vaccine strains.

2. The genetically engineered cell according to claim 1, wherein the stationary phase RNA polymerase sigma factor is RpoS or sigB.

3. The genetically engineered cell according to claim 1 or 2, wherein the function of the stationary phase RNA polymerase sigma factor is reduced or eliminated by: a. Complete or partial inactivation of the genes encoding RpoS or SigB, or b. Reducing or eliminating the function of one or more factors that promote RpoS or SigB function.

4. The genetically engineered cell according to claim 3, wherein the gene encoding more RpoS promoting factors is selected from the group consisting of fully or partially inactivated ArcZ, DksA, GadX, DsrA, DeaD, RprA and Crl.

5. The genetically engineered cell according to any one of the preceding claims, wherein the function of the cell's sigma factor active in the stationary phase of the cell is reduced or eliminated by increasing the function of one or more factors that inhibit RpoS or SigB function.

6. The genetically engineered cell according to claim 5, wherein the nucleic acid encoding one or more RpoS inhibitors is selected from rssB, RNase III, H-NS, ArcA, CRP, Fur, MqsA, OxyS and CyaR, and is overexpressed.

7. The genetically engineered cell according to any one of the preceding claims, wherein the expression of the protein encoded by the heterologous nucleic acid increases when the functionality of the cell's sigma factor active in the stationary phase of the cell decreases.

8. A genetically engineered cell according to any one of the preceding claims, wherein the sigma factor of the cell that is active in the cell growth phase is a housekeeping transcription factor, such as RpoD or SigA.

9. A genetically engineered cell according to any one of the preceding claims, wherein the promoter comprises the consensus motif TT(G / C / T)(A / T)C(A / G)(n) 14-18 TA(T / A)(A / G)(A / T)T, which is located in the 5' region of the heterologous nucleic acid, 5 to 40 nucleotides upstream of the translation start codon AUG.

10. The genetically engineered cell according to any one of the preceding claims, wherein the promoter is positively regulated by cAMP-bound CRP.

11. A genetically engineered cell according to any one of the preceding claims, wherein the promoter is selected from PglpF, Plac, PmglB_70UTR, PglpA_70UTR, PgatY and PglpT_70UTR listed in Table 1 (SEQ ID NOs: 35, 44, 32, 33, 82 and 34, respectively), and variants thereof.

12. The genetically engineered cell of any of the preceding claims, wherein the heterologous nucleic acid is selected from the group consisting of: one or more glycosyltransferase genes, one or more CMP-N-acetylneuraminic acid pathway genes, one or more transporter genes, and one or more nucleic acids encoding a heterologous product to be produced by the genetically engineered cell.

13. The genetically engineered cell of any one of the preceding claims, wherein the heterologous product is one or more human milk oligosaccharides (HMOs).

14. The genetically engineered cell according to claim 13, wherein the human milk oligosaccharide is selected from the group consisting of lacto-N-triose II (LNT-II), lacto-N-tetraose (LNT), lacto-N-neotetraose (LNnT), lacto-N-neohexose (LNnH), p-lacto-N-neohexose (pLNnH), p-lacto-N-hexaose (pLNH), lacto-N-hexaose (LNH), 2'-fucosyllactose (2'-FL), lacto-N-fucopentaose I (LNFP-I), lacto-N-difucohexaose I (LNDFH-I), 3-fucosyllactose (3-FL), difucose (LNDFH-I), lacto-N-trisaccharide II (LNT-II), lacto-N-tetrasaccharide (LNT), lacto-N-neohexose (LNnH), p-lacto-N-neohexose (pLNnH), p-lacto-N-hexaose (pLNH), lacto-N-hexaose (LNH), 2'-fucosyllactose (2'-FL), lacto-N-fucopentaose I (LNFP-I), lacto-N-difucohexaose I (LNDFH-I), 3-fucosyllactose (3-FL), difucose (LNDFH-I), lacto-N-trisaccharide II (LNT-II ... Lactose (DFL), lacto-N-fucopentaose II (LNFP-II), lacto-N-fucopentaose III (LNFP-III), lacto-N-difucohexaose III (LNDFH-III), fucosyl-lacto-N-hexaose II (FLNH-II), lacto-N-fucopentaose V (LNFP-V), lacto-N-difucohexaose II (LNDFH-II), fucosyl-lacto-N-hexaose I (FLNH-I), fucosyl-p-lacto-N-hexaose I (FpLNH-I), fucosyl-p-lacto-N-neohexaose II (F-pLNNH-II), fucosyl-p-lacto-N-neohexaose II (F-pLNNH-II), fucosyl-p-lacto-N-hexa ... II), fucosyl-lacto-N-neohexaose (FLNnH), 3'-sialyllactose (3'-SL), 6'-sialyllactose (6'-SL), 3-fucosyl-3'-sialyllactose (FSL), 3'-O-sialyllacto-N-tetraose a (LSTa), fucosyl-LSTa (FLSTa), 6'-O-sialyllacto-N-tetraose b (LSTb), fucosyl-LSTb (FLSTb), 6'-O-sialyllacto-N-neotetraose (LSTc), fucosyl-LSTc (FLSTc), 3'-O-sialyllacto-N-neotetraose (LSTd), fucosyl-LSTd (FLST d), sialic acid-lacto-N-hexaose (SLNH), sialic acid-lacto-N-neohexaose I (SLNH-I), sialic acid-lacto-N-neohexaose II (SLNH-II) and disialyl-lacto-N-tetraose (DSLNT).

15. The genetically engineered cell of any of the preceding claims, wherein the genetically engineered cell comprises one or more heterologous nucleic acids encoding one or more heterologous glycosyltransferases selected from the group consisting of β-1,3-N-acetyl-glucosaminyltransferase, β-1,3-galactosyltransferase, β-1,4-galactosyltransferase, α-1,2-fucosyltransferase, α-1,3-fucosyltransferase, α-2,3-sialyltransferase, and α-2,6-sialyltransferase.

16. The genetically engineered cell according to any one of claims 13 to 15, wherein the HMO is a fucosylated HMO and the genetically engineered cell comprises at least two copies of manA and three copies of manB.

17. A genetically engineered cell according to any one of the preceding claims, wherein the engineered cell is a Gram-negative bacterium or a Gram-positive bacterium.

18. The genetically engineered cell according to claim 17, wherein the Gram-positive bacteria is selected from the group consisting of Bacillus sp., Lactobacillus sp., Corynebacterium sp. and Campylobacter sp.

19. The genetically engineered cell of claim 18, wherein the Gram-negative bacterium is Escherichia coli (E. coli.).

20. A method for biosynthetically producing a heterologous product, wherein the method comprises: a. Providing a genetically engineered cell according to any one of claims 1-19; b. culturing the genetically engineered cells in a culture medium under conditions that allow production of the heterologous product; and c. recovering the heterologous product from the culture.

21. The method for the biosynthetic production of a heterologous product according to claim 20, wherein the pH during the cultivation is maintained at greater than 6.0, preferably greater than 6.

5.

22. The method for biosynthetic production of heterologous products according to claims 20-21, wherein the fermentation is a fed-batch fermentation or a continuous fed-batch fermentation, wherein a carbon source is continuously fed to the fermentation broth, thereby maintaining the fermentation under carbon limiting conditions.

23. The method of any one of claims 20-22, wherein the product is one or more human milk oligosaccharides (HMOs).

24. Use of the genetically engineered cell according to any one of claims 1 to 19 in the production of a cell-free heterologous product.

25. Use according to claim 24, wherein the heterologous product is one or more HMOs.

26. Use according to claim 24, wherein the heterologous product is a polypeptide, such as an antibody, an antibody fragment or an enzyme.

Images